Investigation of CYP3A4*22 polymorphism effects on the depressed treatment by citalopram and sertraline

doi:10.21203/rs.3.rs-1967360/v1

Download PDF

Research Article

Investigation of CYP3A4*22 polymorphism effects on the depressed treatment by citalopram and sertraline

https://doi.org/10.21203/rs.3.rs-1967360/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Drug response variability due to interpersonal genetic differences is a new and vital research interest. Many single nucleotide polymorphisms (SNPs) have been characterized for CYP3A4 (alleles *1–*22). PCR-RFLP method performed to check CYP3A4*22 polymorphism as an important allele in drug metabolism. 45 Blood samples were collected from the Iranian population with the depressive disorder. Hamilton Depression Rating Scale (HAM-D) used for evaluate the severity of depression before and after 100 days of treatment. Among the individuals, 40 (91.2%) patients showed wild type (CC) and 5 (91.2%) patients were heterozygous (CT) for the CYP3A4*22 allele. Comparing the rate of decrease in HAM-D score between two genotypic groups in CYP3A4*22 showed a significant difference (p < 0.03). This comparison demonstrated that patients with heterozygote genotype of CYP3A4*22 have improved by SSRIs lower than wild-type of patients. It can be concluded that CYP3A4*22 genotype and dose adjustment can help improve drug treatment.

Pharmacogenetics

genotyping

CYP3A4*22

rs35599367

depression

polymorphism.

Variability of drug response that results from interindividual differences cause significant changes in drug metabolism. So far, pharmacogenetics have not received much attention for the CYP3A4. Mostly, hereditary factors are determinants of these differences. Identifying patients that carry these factors is very challenging to estimate their effect on the metabolic capacity following that adjust the therapeutic range of drugs doses accordingly (Swen et al., 2011, Mulder et al., 2021, van den Oord et al., 2007, Petersen et al., 1982). By identifying these patients, adverse drug reactions reduced and the response to treatment is improved. Single nucleotide polymorphisms (SNPs) in genes encoding CYP450 isoenzymes and biotransformation enzymes have been interested in their potential to describe this interindividual variability. Most of the activity variability CYP3A4 has a genetic basis. Many SNPs have been characterized for CYP3A4, and so many polymorphic CYP3A4 alleles are known (variant alleles *1–*22); these SNPs make much difference in CYP3A4 activity (10-to 100-fold differences) in people with different genotypes. CYP3A4*22 allele that was recently described is different in this respect and is characterized by a C > T substitution (rs35599367, frequency 0.04–0.08) at location 15389 in intron 6 of CYP3A4. It has a strong association with different CYP3A4 expression (Elens et al., 2013, Saiz-Rodríguez et al., 2020, Perera et al., 2009). It has the most correlation with differential CYP3A4 expression.

Major depressive disorder (MDD) is the most common mental disease; a wide range of patients live with this disability all over the world. On the one hand, this disease leads to an economic burden, and on the other hand, it can enhance the risk of suicide in the population. Complex interferences of different factors such as genetic, biological, psychosocial, and environmental factors are associated with the clinical manifestation and development of this disease. Several antidepressant drugs prescribe for this disease with different mechanisms of action. For instance, the effect on the metabolism of monoamines is one of them (Kraus et al., 2019, Bialek et al., 2019, Khan et al., 2021, Liu et al., 2021).

Selective serotonin reuptake inhibitors (SSRIs) are the most common antidepressants prescribed drugs for the treatment of major depressive, panic, anxiety, and obsessive-compulsive disorders. Citalopram, Sertraline, Fluoxetine, Fluvoxamine, and Paroxetine are SSRIs category; and inhibit the reuptake of serotonin into the presynaptic neuron (Mullins et al., 2005, Bialek et al., 2019).

Citalopram is metabolized to main metabolites such as didemethylcitalopram (DDCT) and demethylcitalopram (DCT) in the liver via N demethylation by cytochromes 2C19 (37%), 3A4 (34%), and 2D6 (28%). DCT bioactivity takes to 10 times less potent than citalopram. Sertraline is N-demethylated to the primary metabolite N-desmethylsertraline by the cytochromes P450 2D6(35%), 2C9(29%), 2B6(14%), 2C19(13%), and 3A4(9%)(Sit et al., 2008, Eap et al., 2021). The prominent roles of 2C19 and 2D6 in metabolism may complicate the study of 3A4 on the metabolism of these drugs.

The cytochromes P450 (CYPs) have widespread and common substrates, but some substrates are metabolized in clinical concentrations by a few of these enzymes, which circumstance can limit the phase I drug oxidation system. Approximately a dozen enzymes of 1, 2, and 3 CYP families are related to the metabolism of most drugs. The prediction of variable drug response and pharmacokinetics needs information about various factors that influence the expression and function of the responsible enzymes. Monogenic polymorphisms are very important in drug metabolism that explain a wide range of the variability for only a few CYPs enzymes; these enzymes are controlled by several factors, including extra polymorphisms in regulatory trans-genes and nongenetic host factors such as age, disease, sex, hormonal and other factors (Zanger and Schwab, 2013).

CYP3A4 mRNA levels were reduced in the T-variant allele compared to the C wild-type allele. Evaluation of mRNA levels of 93 liver samples showed the effect of the CYP3A4*22 allele on hepatic expression. Wild-type genotype of Livers (CYP3A4*1/*1- CC), compere to CYP3A4*22 (CT or TT) variant allele, showed 1.7-fold higher mRNA levels (95% CI: 1.1–1.8; p = 0.028). Generally, Wang showed a two-fold increase in the expression of non-functional CYP3A4 compared to the wild-type genotype (Wang and Sadee, 2016, Elens et al., 2013).

Inter-individual genetic variation or polymorphism of CYP P450 can affect drug metabolism, which can disrupt the treatment process of patients. Therefore, the presence of CYP3A4*22 can have an important role in this variation and metabolism of drugs. This way, the pharmacogenetics study and identification of genetic biomarkers improve the treatment process and minimize adverse drug reactions (Abubakar et al., 2018, Van Der Perk et al., 2021).

Since antidepressants (especially SSRIs) are mostly metabolized by CYP3A4, this variation can alter the rate of metabolism of these drugs and, subsequently, the treatment process. In this study, we aimed to check CYP3A4*22 polymorphism as an important allele in drug metabolism influences and its relation with the cure rates of depressed patients receiving citalopram and sertraline in the Iranian population.

Clinical study design

In this Cross-sectional study, we examine the patient with depression disorder their illness was confirmed in the outpatient clinics of Ebn-Sina Psychiatry Rehabilitation Hospital (Mashhad, Iran) from January to October 2017. This study was approved by the Ethics Review Board of Tehran University of Medical Sciences, Iran (NO. IR.TUMS.TIPS.REC.1400.093), and written consent was obtained from all subjects participating in the study.

This study is a continuation of our previous study, and some samples and information from the previous study have been used in this study. Patients are selected According to inclusion and exclusion criteria in table 1. Diagnosis of depression, collecting demographic data, and HAM-D (Iranian state, HDRS21) and method of patient follow-up were performed according to the previous study (Ahmadimanesh et al., 2019).

Twenty-five patients took citalopram (20 mg/day) and 20 patients took sertraline (50mg/day). After one month, for patients who needed to increase doses, double doses were prescribed. After 100 days of treatment, the HAM-D questionnaire was fellfield with each patient again. Finally, blood samples were collected from each patient.

Sample Collection and DNA extraction

Blood samples were collected in a heparin tube by venipuncture (Venoject) from each patient. Genomic DNA was extracted from whole blood with QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany). To determine the concentration and quality of DNA (A260/A280), we used spectrophotometers (Synergy4 fluorometer, Biotek 5, USA).

Genotype analysis by using the RFLP method

In this study, genotyping of polymorphism CYP3A4*22 was performed using the PCR-RFLP method. Primers are designed by Laser gene and Beacon designer software for the PRC. The PCR reaction was performed using the Forward and Reverse primer in 20µl of reaction volume, which is shown in table 2. PCR amplifications were performed with Pre-mixed Master Mix solution (Taq DNA polymerase, NH4+ buffer, MgCl2, and dNTP), DNA template, Forward and Reverse primers, ddH2O(Table 2). Amplification conditions involved an initial denaturation for 5 min at 95 °C, followed by 38 cycles of 30s at 95 °C, 30s at 52.5 °C, and 30s at 72 °C, with a 10 min final extension at 72 °C. After PCR amplification, 10 μL of PCR product (428 bp) was digested for 16–24 hours at 37°C with 1μL of DraIII (GeneMark biolab). The digested PCR products were analysed by electrophoresis on a 3% agarose gel in the presence of gel red (biotium). The bands of DNA fragments in the gel were visualized using an UV transilluminator. DraIII digestion of wild-type DNA creates a band of 428 bp. The CYP3A4*22 variant allele creates one restriction site, and DraIII digestion yields 354- and 74-bp fragments.

DNA Sequencing

In order to ensure the genotyping process, a number of samples were sequenced to accurately determine the nucleotides within the DNA molecule by Genetic Analyzer Applied Biosystems ABI 3100 sequencing machine (Thermo Fisher Scientific, Waltham, MA, USA). All fragments were sequenced in the forward and reverse directions for identification of any nucleotide variation in the exons 3 to 7. Sequence products were aligned for each participant with the original CYP3A4*22 sequence (NG_008378) using CLC workbench 7.7 (QIAGEN bioinformatics) to detect the presence of SNPs or mutations as well as to define each patient’s genotype. ClinVar (NCBI) and dbSNP databases were used to examine the influence of the DNA changes at the protein level and thus the enzymatic activity.

Statistical analysis

Results were analyzed by using Prism version 8 statistically. The differences in the rate of decrease in HAM-D score before and after treatment between wild and heterozygous patients in CYP3A4*22 allele were analyzed with the Mann-Whitney U test.

A Chi-square test was used to compare the frequency of alleles between men and women in the study population. P values less than 0.05 were statistically considered significant. Comparisons were evaluated using appropriate parametric tests.

Demographic and genetic data

In this study, 45 patients (13 male, 32 female) from the Iranian population with the depressed disorder have participated. The age of patients was between 19-58 years, with an average of 35.8 ± 8.86. Polymorphism CYP3A4*22 and allelic frequencies of participants summarize and reported in table 3. Among the individuals, 40 (91.2%) patients showed wild type (CC), 5 (91.2%) patients were heterozygous (CT) for the CYP3A4*22 allele, and none of the DNA samples had the Homozygous (TT) variant allele.

Electrophoresis of PCR product

Electrophoresis results of PCR-RFLP products showed two bands for heterozygous individuals in regions 354 and 74bp, and for wild genotype, a band was seen in 428bp. The result of CYP3A4 gene variation by PCR-RFLP method for patients was shown in fig. 1.

DNA Sequencing

Sequence analyses have shown rs35599367C > T, CYP3A4*22 in 5 cases as heterozygote genotypes. Other participants had the wild type of CYP3A4 tested alleles. Additionally, the image of the Sanger sequencing result for heterozygous samples is shown in fig. 2.

Correlation between HAM-D score and genotype of CYP3A4

The mean HAM-D score in 40 patients with wild polymorphism was 26.65 ± 10.76 and 17.05 ± 11.75, respectively, before and after treatment with SSRI; this difference was statistically significant (p < 0.0001). This difference was 29 ± 6.78 and 28.8 ± 9.88 in patients with heterozygous genotypes before and after treatment, respectively. This difference was not statistically significant (p < 0.48). After 100 days of consumption of citalopram and sertraline, the satisfaction of treatment was evaluated and compared with their genotype. Comparing the rate of decrease in HAM-D score before and after treatment between wild and heterozygous patients in CYP3A4*22 showed a significant difference between the two groups (p < 0.03). You can see the results in Table 3 and Fig. 3. This comparison was demonstrated that patients with heterozygote genotype of CYP3A4*22 have improved lower than the wild-type of patients by SSRIs.

This is the first study in the investigation of CYP3A*22 genotype variation in the Iranian population. According to past studies, the CYP3A4*22 allele was related to decreased CYP3A4 protein expression levels and resulted in decreased CYP3A4 enzymatic activities (Okubo et al., 2013). Since 34% and 9% of the metabolism of citalopram and sertraline are done with this cytochrome, respectively (Sit et al., 2008), The polymorphism of CYP3A4*22 allele is effective in the metabolism of these drugs and subsequent treatment of the disease. Moreover, CYP3A4 ∗ 22 significantly affects the pharmacokinetics of several drugs, including tacrolimus, cyclosporine, and statins (Mulder et al., 2021). We examined this polymorphism in 45 depressed patients who were treated with SSRI drugs for 100 days. Five of the 45 patients in this study had heterozygous genotypes, and the others had wild polymorphism for CYP3A4*22b (Table 3). The difference between the HAM-D score before and after treatment of patients with wild genotype and heterozygous genotype is shown in Table and Fig. 3; the difference was statistically significant (p = 0.03). This comparison demonstrated that patients with heterozygote genotype of CYP3A4*22 have improved by SSRIs lower than the wild type of patients. In a study by Zastrozhin et al., in Patients with alcoholism and anxiety disorders, CYP3A4*22 carriers significantly reduced the therapeutic response, as reflected in the HAMA scale scores. Out of 105 subjects, 94 patients had CC genotype, 11 had CT genotype, and none of the patients had TT genotype (Zastrozhin et al., 2020).

According to Okubo et al., The expression of CYP3A4 protein is associated with the CYP3A4*22 allele and leads to differences in the clearance of drugs (Okubo et al., 2013). The study by Holmberg et al., Showed that the plasma concentration of Ticagrelor and also the effects of platelet inhibition of this drug in patients with CYP3A4*22 alleles were higher than in the control group (Holmberg et al., 2019).

Given the results of our study and the importance of CYP3A4 in drug metabolism, additional studies focusing on toxicity and clinical outcome are necessary to demonstrate the clinical application of a dose based on the CYP3A4*22 genotype.

This comparison demonstrated that patients with heterozygote genotype of CYP3A4*22 have improved by SSRIs lower than wild-type patients. This study could indicate the prominent role of CYP3A4*22 in addition to CYP2D6 and CYP2C19 in the metabolism and efficacy of antidepressants. It can be concluded that CYP3A4*22 genotype and dose adjustment can help improve drug treatment.

Acknowledgments

We thank Dr. Mohammad Reza Zirak for his help in statistical analyses and Ali Kazemi for technical assistance.

Author Contributors

MHG, ABP conceived and designed research. SM conducted all experiments part and wrote the manuscript. MA supervised experiments part of the study. SM, MHG, MGKh and RH analyzed data. SAM and MA collected blood samples and extracted DNA. All authors read and approved the manuscript.

Funding information

Tehran University of Medical Sciences, Tehran, Iran. Grant/Award Number: 99-3-104-50925 and 97-03-33-40268.

Data availability statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

Conflict of interest

The authors report no conflicts of interest in relation to the current manuscript.

Ethical approval

This study was approved by the Ethics Review Board of Tehran University of Medical Sciences, Iran (NO. IR.TUMS.TIPS.REC.1400.093).

Abubakar M B, Tan H L & Gan S H (2018) A Novel Multiplex Pcr-Rflp Method For Simultaneous Genotyping Of Cyp3a4* 4 A> G, Cyp3a4* 18b G> A And Cyp3a4* 22 C> T. Malays J Med Sci 25(4):72-81. doi: 10.21315/mjms2018.25.4.7.
Ahmadimanesh M, Abbaszadegan M R, Morshedi Rad D, Moallem S A, Mohammadpour A H, Ghahremani M H, Farid Hosseini F, Behdani F, Akhondpour Manteghi A & Jowsey P (2019). Effects Of Selective Serotonin Reuptake Inhibitors On Dna Damage In Patients With Depression. J Psychopharmacol 33(11):1364-1376. doi: 10.1177/0269881119874461.
Bialek K, Czarny P, Strycharz J & Sliwinski T (2019) Major Depressive Disorders Accompanying Autoimmune Diseases–Response To Treatment. Prog Neuropsychopharmacol Biol Psychiatry 20;95:109678. doi: 10.1016/j.pnpbp.2019.109678.
Eap C, Gründer G, Baumann P, Ansermot N, Conca A, Corruble E, Crettol S, Dahl M-L, De Leon J & Greiner C (2021) Tools For Optimising Pharmacotherapy In Psychiatry (Therapeutic Drug Monitoring, Molecular Brain Imaging And Pharmacogenetic Tests): Focus On Antidepressants. World J Biol Psychiatry 22(8):561-628. doi: 10.1080/15622975.2021.1878427.
Elens L, Van Gelder T, Hesselink D A, Haufroid V & Van Schaik R H (2013) Cyp3a4* 22: Promising Newly Identified Cyp3a4 Variant Allele For Personalizing Pharmacotherapy. Pharmacogenomics 14(1):47-62. doi: 10.2217/pgs.12.187.
Holmberg M T, Tornio A, Paile‐Hyvärinen M, Tarkiainen E K, Neuvonen M, Neuvonen P J, Backman J T & Niemi M (2019) Cyp3a4* 22 Impairs The Elimination Of Ticagrelor, But Has No Significant Effect On The Bioactivation Of Clopidogrel Or Prasugrel. Clin Pharmacol Ther 105(2):448-457. doi: 10.1002/cpt.1177.
Khan D M, Yahya N, Kamel N & Faye I (2021) Automated Diagnosis Of Major Depressive Disorder Using Brain Effective Connectivity And 3d Convolutional Neural Network. Ieee Access, 9, 8835-8846. doi: 10.1109/ACCESS.2021.3049427
Kraus C, Kadriu B, Lanzenberger R, Zarate Jr C A & Kasper S (2019) Prognosis And Improved Outcomes In Major Depression: A Review. Transl Psychiatry 3;9(1):127. doi: 10.1038/s41398-019-0460-3.
Liu L, Lv X, Zhou S, Liu Q, Wang J, Tian H, Zhang K, Wei J, Wang C & Chen Q (2021) The Effect Of Selective Serotonin Reuptake Inhibitors On Cognitive Impairment In Patients With Depression: A Prospective, Multicenter, Observational Study. J Psychiatr Res 141:26-33. doi: 10.1016/j.jpsychires.2021.06.020.
Mulder T A, Van Eerden R A, Elens L, Hesselink D A, Matic M, Bins S, Mathijssen R H & Van Schaik R H (2021) Cyp3a4∗ 22 Genotyping In Clinical Practice: Ready For Implementation? Front Genet 8;12:711943. doi: 10.3389/fgene.2021.711943.
Mullins C D, Shaya F T, Meng F, Wang J & Harrison D (2005) Persistence, Switching, And Discontinuation Rates Among Patients Receiving Sertraline, Paroxetine, And Citalopram. Pharmacotherapy 25(5):660-7. doi: 10.1592/phco.25.5.660.63590.
Okubo M, Murayama N, Shimizu M, Shimada T, Guengerich F P & Yamazaki H (2013) The Cyp3a4 Intron 6 C> T Polymorphism (Cyp3a4* 22) Is Associated With Reduced Cyp3a4 Protein Level And Function In Human Liver Microsomes. J Toxicol Sci 38(3):349-54. doi: 10.2131/jts.38.349.
Perera M, Thirumaran R, Cox N, Hanauer S, Das S, Brimer-Cline C, Lamba V, Schuetz E, Ratain M & Di Rienzo A (2009) Prediction Of Cyp3a4 Enzyme Activity Using Haplotype Tag Snps In African Americans. Pharmacogenomics J 9(1):49-60. doi: 10.1038/tpj.2008.13
Petersen D R, Collins A C & Miles R G (1982) An Overview Of The Genetics Of Psychopathology. Behav Genet 12(1):3-10. doi: 10.1007/BF01065737.
Saiz-Rodríguez M, Almenara S, Navares-Gómez M, Ochoa D, Román M, Zubiaur P, Koller D, Santos M, Mejía G & Borobia A M (2020) Effect Of The Most Relevant Cyp3a4 And Cyp3a5 Polymorphisms On The Pharmacokinetic Parameters Of 10 Cyp3a Substrates. Biomedicines 22;8(4):94. doi: 10.3390/biomedicines8040094.
Sit D K, Perel J M, Helsel J C & Wisner K L (2008) Changes In Antidepressant Metabolism And Dosing Across Pregnancy And Early Postpartum. J Clin Psychiatry 69(4):652-8. doi: 10.4088/jcp.v69n0419.
Swen J, Nijenhuis M, De Boer A, Grandia L, Maitland‐Van Der Zee A-H, Mulder H, Rongen G, Van Schaik R, Schalekamp T & Touw D (2011) Pharmacogenetics: From Bench To Byte—An Update Of Guidelines. Clin Pharmacol Ther 89(5):662-73. doi: 10.1038/clpt.2011.34.
Van Den Oord E, Mcclay J, York T, Murrelle L & Robles J (2007) Genetics And Diagnostic Refinement. Behav Genet 37(3):535-45. doi: 10.1007/s10519-006-9135-y. Epub 2006 Dec 12.
Van Der Perk M M, Broer L, Yasui Y, Robison L L, Hudson M M, Laven J S, Van Der Pal H J, Tissing W J, Versluys B & Bresters D (2021) Effect Of Genetic Variation In Cyp450 On Gonadal Impairment In A European Cohort Of Female Childhood Cancer Survivors, Based On A Candidate Gene Approach: Results From The Pancarelife Study. Cancers (Basel) 13;13(18):4598. doi: 10.3390/cancers13184598.
Wang D & Sadee W (2016) Cyp3a4 Intronic Snp Rs35599367 (Cyp3a4* 22) Alters Rna Splicing. Pharmacogenet Genomics 26(1):40-3. doi: 10.1097/FPC.0000000000000183.
Zanger U M & Schwab M (2013) Cytochrome P450 Enzymes In Drug Metabolism: Regulation Of Gene Expression, Enzyme Activities, And Impact Of Genetic Variation. Pharmacol Ther 138(1):103-41. doi: 10.1016/j.pharmthera.2012.12.007.
Zastrozhin M, Skryabin V Y, Smirnov V, Petukhov A, Pankratenko E, Zastrozhina A, Grishina E, Ryzhikova K, Bure I & Golovinskii P (2020) Effects Of Plasma Concentration Of Micro-Rna Mir-27b And Cyp3a4* 22 On Equilibrium Concentration Of Alprazolam In Patients With Anxiety Disorders Comorbid With Alcohol Use Disorder. Gene 20;739:144513. doi: 10.1016/j.gene.2020.144513.

Table 1 Inclusion and exclusion criteria

	Inclusion criteria	Exclusion criteria
Age	18 - 60	-
Depression score	13 - 50	-
Other diseases	-	history of any somatic diseases, history of bipolar, psychosis, acute suicidality, ongoing ECT, mental retardation, OCD, anxiety, personality disorders, hormone therapy, allergic diseases, history of irritable, bowel syndrome (IBS),
Other condition		Addiction, alcohol consumption, smoking, pregnancy, lactation and Patients who need to receive any concurrent psychosocial therapy in addition to SSRI treatment, added other drugs and/or changes along with those experiencing changes in their condition

*Depression score was based on Hamilton criteria.

Table 2 Primer sequences used for CYP3A4*22 alleles in PCR assay and sequencing analyses.

Sequence

Primer

Gene

(5'- TCTCTGTCTTCCTATGATGG -3')

(5'- GTAGTCCACATACTTATTGAGAG -3')

Forward

Reverse

CYP3A4*22

Table 3 Comparison of depression score change between genotype variations.

		Depression score change (Mean ± SD)		Gender (N)
Genotype	Depression score change (Mean ± SD)		P Values		Male	Female	P Values
Wild		9.6 ± 8.92	0.03*		12	28	0.99
Heterozygous		0.2 ± 6.3			1	4
Homozygous		-	-		-	-

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Investigation of CYP3A4*22 polymorphism effects on the depressed treatment by citalopram and sertraline

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Status:

Version 1