The luminescent mechanism of UCNP@SiO2 + QDs composite material
UCNP luminescence is a complex multi-photon energy transfer and conversion process. UCNP under 980nm excitation light excitation, 345 nm and 362 nm UV light originates from 1I6 to 3F4 energy level jump and 1D2 to 3H6 energy level jump, respectively. In the visible band, the purple band at 450 nm originates from the 1D2 to 3F4 energy transition, the blue band at 477 nm originates from the 1G4 to 3H6 energy transition, and the red band at 645 nm originates from the 1G4 to 3F4 energy transition. In the near-infrared band, the near-infrared light at 802 nm originates from the energy level jump from 3H4 to 3H6, and the doping ratio of UCNP is NaYF4: 20% Yb3+,0.5% Tm3+@NaYF4:10% Yb3+, the luminescence mechanism of the UCNP@SiO2 + QDs composite material is shown in Fig. 2.
The UCNP@SiO2 + QDs composite material under the excitation of near-infrared 980 nm excitation light, the UCNP as the donor and the QDs as the acceptor, the multicolor luminescence of the UCNP is re-excited by the FRET to the QDs. The individual quantum dots may be adjusted by the doping ratio of different halogen elements (X = Cl, Br, I), which can achieve continuous modulation in the entire visible wavelength band, and QDs have an extremely narrow half-peak width of 12nm-37nm, it proves that QDs have good monochromatic properties, which can achieve high fluorescence purity, The QDs doped with different ratios of halogen elements in the UCNP@SiO2 + QDs composite can be precisely tuned in the full wavelength range of 400nm-700nm to achieve tunable multicolor luminescence, and the reasonable design of the composite structure can be widely used in various fields.
Synthesis of UCNP@SiO2
A typical high-temperature co-precipitation method was used to prepare UCNP luminescent nanomaterials (Liu et al. 2018; Wang et al. 2021), the fluorescence spectra of UCNP and UCNP@SiO2 are shown in Fig. 3A. There were intense emission peaks in the UV and visible as well as near-infrared wavelength range, with an overall visible expression of blue radiation. The fluorescence peak position of UCNP@SiO2 exhibited no shift, only the fluorescence intensity decreased to 77% of the UCNP structure. The XRD pattern of UCNP@SiO2 are shown in Fig. 3B, which was compared with the standard card of NaYF4 (JCPDS NO 16.0334), the positions of diffraction peaks basically correspond to each other, and the positions of diffraction peaks could not change significantly before and after wrapping, and there was a wider diffraction peak at 22° position, which was attributed to the factor of amorphous silicon. After generating QDs in the mesopores of SiO2, the new composite UCNP@SiO2 + QDs was obtained, and the basic diffraction peak position was not significantly changed, with the increase of diffraction peaks with QDs and a relative weakening of the peak size.
The TEM of UCNP is shown in Fig. 3C. The whole structure of UCNP nanomaterials was shell structure and could have better dispersion, the high-resolution TEM image of individual nanoparticles clearly showed lattice stripes with a spacing of 0.54 nm, and the UCNP structure size was 37.2 nm. To ensure the effective distance between UCNP and quantum dots, it was necessary to control the thickness of silica and mesopore size, the UCNP surface was accompanied by a large amount of hydrophobic oleic acid, and a typical Stober method was used to prepare mesoporous silica (Kim et al. 2008; Yang et al. 2009), with UCNP as the core and the mesoporous silica wrapped on the conversion structure using a structure guide (CTAB).The mesoporous silica had a high specific surface area, strong adsorption and excellent stability properties. The TEM image of UCNP@SiO2 is shown in Fig. 3D. Which showed that a number of small white holes and stripes, the particles were relatively transparent, and the overall size of UCNP@SiO2 was 91 nm, at which point the overall luminescence intensity was reduced due to the thickness of the encapsulated silica, yet the overall luminescence performance remained good, which was accomplished with the measurement of UCNP@SiO2 for QDs growth.
Synthesis and characterization of UCNP@SiO2 + QDs
In order to ensure the effective combination of both UCNP and QDs to yield the composite material UCNP@SiO2 + QDs, mesoporous SiO2 was used as the carrier, on the one hand, the mesopores made the energy transfer process achievable, and more importantly, to enhance the stability of QDs to water and oxygen environment, the SiO2 mesopores were utilized to wrap and passivate the quantum dots, which further improved the stability of QDs to sensitive conditions. SiO2 also provided better biocompatibility and water solubility of the whole composite material for the stability of sensitive surroundings. The TEM image of UCNP@SiO2 + QDs as shown in Fig. 4A. It was obvious that the QDs were successfully grown in the mesopores, and the whole particles were composite material UCNP@SiO2 + QDs. The high-resolution TEM image of a single nanoparticle clearly showed a lattice stripe with a d-spacing of 0.26 nm in the (200) plane, which indicated that the growth of QDs was accomplished in the mesopores of SiO2. The protection of mesoporous Si secured the luminescence efficiency and stability of UCNP@ SiO2 + QDs in aqueous badlands. The EDS energy spectrum of UCNP@SiO2 + QDs as shown in Fig. 4B, which showed the new elements of Cs, Pb, Br, and I in the distribution of UCNP@SiO2 elements, and it indicated the existence of QDs on the surface of UCNP@SiO2 appear.
To indicate whether QDs intervene in the mesopores of SiO2, the specific surface area BET (Brunauer-Emmet-Teller) was used to comparatively analyze the changes in surface adsorption capacity and pore number before and after the addition of QDs in UCNP@SiO2. N2 isothermal adsorption and desorption curves are shown in Fig. 4C, when P/P0 was larger than 0.28, the adsorption amount started to increase slowly, and the adsorption rate had been kept steady. This indicates that the pore channel homogeneity was well and the pore size was small. The BET specific surface area and the pore volume of UCNP@SiO2 were measured to be 935.264m2g− 1 and 1.116cm3/g− 1. After the growth of QDs in the mesopores of SiO2, the BET specific surface area and the pore volume of UCNP@SiO2 + QDs were measured to be 764.707 m2g− 1 and 0.925 cm3g− 1. Due to the entry of QDs into the mesopores, the specific surface area and pore volume were significantly lowered. the pore size distribution of UCNP@SiO2 as shown in Fig. 4D, the number of pores on its surface were measured to be decreased, and the number of pores at the 2.6 nm position was significantly lowered. these variations could offer a powerful basis for the incorporation of QDs into the small size mesopores of UCNP@SiO2.
Fluorescence properties of UCNP@SiO2 + QDs
The fluorescence spectra of different halogen element ratios as shown in Fig. 5A. The size of the QDs growing in the mesopores was less than 5 nm, which was slightly lower than the corresponding Bohr exciton diameter of 12 nm, due to the band gap and quantum confinement effect of QDs proper (Swarnkar et al. 2015; Protesescu et al. 2015), which makes the QDs emission peak appear to have a blue shift phenomenon, and the position of blue shift occurs at about 10 nm, and this phenomenon exists for all the other composite materials. The fluorescence chromatogram corresponding to the whole emission peak as shown in Fig. 5B, and any fluorescence color in the visible wavelength band can be obtained, realizing the panchromatic emission at wavelengths beyond the availability of lanthanide elements. Under the excitation of near-infrared light, the halogen element doping ratio and size effect of QDs can be used to control the luminescence position of UCNP@SiO2 + QDs composites continuously in the full wavelength range of 400nm-700nm, which can be accurately modulated to the best luminescence peak position for detecting the target, so as to enhance the practical application efficiency of UCNP@SiO2 + QDs composite material.
To illustrate the process of the change of the composite surface structure more clearly, the FTIR spectra of UCNP@SiO2 + QDs are shown in Fig. 5C. The surface of the UCNP was accompanied by a large amount of oleic acid, and the absorption peaks at 2931 cm− 1 and 2858 cm− 1 were derived from the stretching vibration of the C-H bond of the surface oleic acid ligand. The absorption peak at 1049 cm− 1 corresponded to the stretching and bending vibrations of Si-O-C. In addition, the absorption peak at 1125 cm− 1 was due to the bending vibrations of Si-O-Si, which indicated that SiO2 has been successfully encapsulated on the surface of the upconverted UCNP. The vibrational peak at the 1610 cm− 1 position was the bending vibration of Pb-X3 in QDs owing to the removal of structure-directing. The absorption peaks at 1543 cm− 1 and 1654 cm− 1 corresponding to the N-H bending vibrations were significantly weaker after the removal of the structure-directing agent (CTAB). Using the trace hydrolysis of APTES for amination on the surface of UCNP@SiO2 + QDs, the weak absorption band at 946 cm− 1 was Si-OH stretching, and it indicated that APTES underwent hydrolytic condensation, which further demonstrated that amination was achieved on its surface and obtained the aminated UCNP@SiO2 + QDs composite material.
Characterization of UCNP@SiO2 + QDs (Br:I = 0.7:0.3)
As an example, the absorption spectrum of separate QDs (Br:I = 0.7:0.3) were used to analyze the luminescence mechanism of UCNP@SiO2 + QDs. The fluorescence spectra of UCNP@SiO2 and the absorption spectra of QDs (Br:I = 0.7:0.3) are shown in Fig. 6A. The emission peaks of UCNP@SiO2 at 345 nm, 362 nm, 450 nm, and 477 nm position of the emission peaks overlap with the strong absorption range of QDs, which makes QDs multi-photon absorption of the luminescence of UCNP@SiO2. Under the excitation of 980 nm near-infrared light, the FRET occurs between both UCNP and QDs, and the multi-emission light of UCNP excited the luminescence of QDs again synergistically, the position of the luminous peak of the desired target could be obtained. To achieve the best conversion efficiency of both UCNP@SiO2 and QDs (Br:I = 0.7:0.3), UCNP@SiO2 was combined with various concentrations of QDs (Br:I = 0.7:0.3) to obtain the various graphs of UCNP@SiO2 + QDs at each peak value, as shown in Fig. 6B.
As the concentration of QDs in UCNP@SiO2 + QDs increases, the light intensity at the 531 nm position is gradually increased, mainly at the sacrifice of UV and blue light, and the UV intensity at 345 nm and 362 nm decreases much faster than the blue emission intensity at 450 nm and 477 nm, while the red emission at 645 nm is nearly changeless. This may be attributed to the much larger absorbance of QDs in the UV than in the blue and almost no absorption in the red, which is shown in Fig. 6C. In order to ensure the structural stability of UCNP@SiO2 + QDs and to maintain the strong luminescence intensity of UCNP@SiO2 + QDs at 531 nm, QDs (Br:I = 0.7:0.3) at a concentration of 0.3 mg/ml is chosen as the best level, and the FRET efficiency of both of them is obtained up to 70.6%. It can be shown that there is a high energy conversion efficiency between UCNP and QDs.
In order to improve miRNA detection, we combined UCNP@SiO2 with QDs (Br: I = 0.7: 0.3). Figure 6D showed the fluorescence spectrum of UCNP@SiO2 + QDs (Br: I = 0.7: 0.3) and the absorption spectrum of MB-BHQ1. The emission peak of UCNP@SiO2 + QDs at 531nm overlaps with the strong absorption peak. The emission peak overlaps with the position of the strong absorption peak of BHQ1 on the molecular beacon, which could achieve the best quenching effect on the luminescence of UCNP@SiO2 + QDs at 531 nm. The detection of UCNP@SiO2 + QDs (Br:I = 0.7:0.3) and the BHQ1 quenching group was designed by connecting the two sides of MB, according to the fluorescence intensity at the 531 nm position to complete the detection of miRNA-155.
Synthesis and optimization of MB-UCNP@SiO2 + QDs fluorescent probes
MB was directly attached to the surface of UCNP@SiO2 + QDs via a chemical bond, which allowed the BHQ1 quenching group to be close to the surface of the material, the 5' side of the MB chain was modified with COOH and the BHQ1 quenching group was modified at the 3' side, and the maximum distance between the surface of UCNP@SiO2 + QDs and the BHQ1 quenching group was 0.68 nm. (According to the length of one base pair), this distance was much smaller than the effective action distance of FRET at 10 nm, so it made the fluorescence quenching occur, the fluorescence quenching effect of MB-UCNP@SiO2 + QDs fluorescent probe at the position of 531 nm was obtained, and the energy transfer efficiency was obtained to be 66.3%, which reduced the fluorescence background signal of the probe itself. The fluorescence characteristics of MB-UCNP@SiO2 + QDs fluorescence probe sensing are shown in Fig. 7A, and the normalized fluorescence intensity is plotted in Fig. 7B. When the fluorescent probe was linked to the neutral miRNA-155, the structural loop of the MB-155 was opened, causing the BHQ1 quenching group to move away from the surface of UCNP@SiO2 + QDs. The maximum distance between the surface of UCNP@SiO2 + QDs and the BHQ1 quenching group was calculated to be 11.9 nm. (According to the number of bases of MB length), which was greater than the effective action distance of FRET at 10 nm. This made the partial fluorescence of UCNP@SiO2 + QDs at the 531 nm position recovered, and the efficiency of energy transfer at this time was obtained to be 35.6%. It did not complete recovery, probably because there was still a partial fluorescence burst mechanism of energy radiative transfer, and the UCNP@SiO2 + QDs released the excitation energy in the form of radiation and returned to the ground state itself.
UCNP@SiO2 + QDs were shielded with mesoporous silica. For further enhancing the stability of UCNP@SiO2 + QDs to sensitive conditions, we used a slightly weaker polar 75% ethanol solution as the reaction solvents. To optimize the configuration of fluorescent probes, MB-UCNP@SiO2 + QDs fluorescent probes were generated based on the same volume of 80ul of aminated UCNP@SiO2 + QDs with 20ul of different concentrations (0.05, 0.1, 0.2, 0.4, 0.8, and 1 µM) of MB solution, and the fluorescence detection of the probes was performed. The fluorescent spectra as shown in Fig. 7C. Figure 7D depicted the change curve of fluorescence intensity at 531 nm as MB concentration increased, and when the concentration of MB increased to 1 µM, the light intensity was basically stable and remained unchanged, indicating that the fluorescence had been quenched to the maximum extent. so that the optimal concentration of MB was 1µM, and this concentration of MB-155 fluorescence was used.
Detection of miRNA-155 with fluorescent probe MB-UCNP@SiO2 + QDs
Equal volumes of 20 µL of miRNA-155 solutions with different concentrations (100 pM, 1 nM, 10 nM, 100 nM, 1 µM, and 10 µM) were prepared and connected to the fluorescent probe MB-UCNP@SiO2 + QDs, which as shown in Fig. 8A. The relationship between the logarithm of miRNA-155 concentration (logCmiRNA-155) and the fluorescence intensity ratio (F/F0) was plotted in Fig. 8B, with F0 represented the fluorescence intensity of MB-UCNP@SiO2 + QDs and F represented the fluorescence intensity of miRNA-155 + MB-UCNP@SiO2 + QDs, it could be observed that from 100 pM to 10 µM miRNA-155 concentration followed the linear fitting curve F/F0 = 0.15×logCmiRNA−155+2.67 (R2 = 0.99), according to the definition of the limit of detection (LOD) 3σ/s the LOD of miRNA-155 was calculated to be 73.5 pM, here σ is the standard deviation of F/F0 and s is the linear equation of the slope.
To analyze the effect of fluorescent probes on the detection of specific recognition of different miRNAs, we selected other markers in the process of malignant proliferation expression of tumor cells as comparisons, which were used for further experiments using miRNA-155, miRNA-141, miRNA-21 and random rRNA sequence samples. MB-155 and the base sequences of other miRNAs are shown in Table 1.
Table 1
Nucleotide sequences of miRNAs and MB in fluorescent probes.
name | Sequences (5’-3’) |
miRNA-155 | UUAAUGCUAAUCGUGAUAGGGGU |
MB-155 | COOH-ATAGCGACCCCTATCACGATTAGCATTAACGCTAT-BHQ1 |
miRNA − 141 | UAACACUGUCUGGUAAAGAUGG |
miRNA − 21 | UAGCUUAUCAGACUGAUGUUGA |
rRNA | AUAUACGAUUAGCACUAUCUCA |
Different base sequences of the target with the same concentration of 1 µM were formulated and the fluorescence spectra were obtained as shown in Fig. 8C, and the fluorescence peaks of the five fluorescence spectra were plotted as bar graphs as shown in Fig. 8D. It could be seen that the degree of fluorescence recovery was different, with the maximum fluorescence recovery signal for normal miRNA-155 and nearly absent for random rRNA. Which indicated that the prepared fluorescent probes have good specific recognition in the detection. Even a few single or individual mismatched bases on miRNA-155 can be detected, and it could specifically distinguish miRNA-155 from miRNA with mismatched sequences, which could provide a strong basis for the early diagnosis of diseases such as cancer and tumors. The performance of the constructed nanoprobes was compared with similarly reported UCNP nanoprobes (Table 2). The detection limits of the established fluorescent probes were equal to or lower than the detection limits of other fluorescent probes.
Table 2
Comparison of the performance of the established fluorescent probes and the reported similar fluorescent probes.
Energy donor | Energy acceptor | Target | Linear range | Detection limit | Ref. |
UCNP | Cy3 | miRNA-21 | 200pM-1.4nM | 95pM | (Zhu et al. 2018) |
UCNP | BHQ3 | miRNA-21 | 50-500nM | 2nM | (Wang et al. 2018) |
UCNP | TAMRA | DNA | 40-200nM | 2.8nM | (Zhu et al. 2015) |
UCNP | MoS2 | miRNA-155 | 50-500nM | 0.25nM | (Wu et al. 2021) |
UCNP, QDs | BHQ1 | miRNA-155 | 100pM-10µM | 73.5pM | This work |