Chandipura virus nucleoprotein interact with heat shock cognate 71 and actin proteins in Neuro-2a cells during replication

doi:10.21203/rs.3.rs-1975995/v1

Download PDF

Research Article

Chandipura virus nucleoprotein interact with heat shock cognate 71 and actin proteins in Neuro-2a cells during replication

https://doi.org/10.21203/rs.3.rs-1975995/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

To complete their lifecycle, viruses interacts with variety of cellular proteins. Identifying host proteins involved in the viral lifecycle is an excellent target for drug. In neuro-2a cells, we employed recombinant Chandipura virus (CHPV) nucleoprotein (N) as bait in a protein pull down assay to see which cellular proteins interact with nucleoprotein. A total of ten proteins interact with the CHPV N protein. Out of ten proteins, heat shock cognate 71 (HSC70) and actin proteins were investigated further. In CHPV-infected neuro-2a cells, confocal microscopy revealed that HSC70 and actin co-localized with CHPV N protein, and that the expression was altered by viral infection. The association with HSC70 may help to mitigate the negative repercussions of misfolded proteins produced by viral polymerase's erroneous nature. More research on the role of these proteins in viral replication in infected cells is needed.

Chandipura virus

Nucleoprotein

Neuro-2a cells

HSC70

Actin filaments

viral lifecycle

Viruses perform number of steps to complete their lifecycle. Earlier it was thought that assembling the viral progeny particles is a spontaneous and thermodynamically driven process. However, later it was proved that the capsid assembly process is a multifactorial event which involves number of host proteins. Identifying such host proteins involved in viral lifecycle are the likely candidates of druggable targets [1]. Chandipura virus (CHPV) garnered the worldwide attention in 2003 after the encephalitic outbreak in Children’s of Andhra Pradesh state in India. Among the vesiculoviruses discovered so far, CHPV is having concern over public health point of view. Till today no vaccine or treatment modality is available for CHPV. Identifying the suitable drug is paramount importance in controlling CHPV infection. CHPV is an enveloped RNA virus containing negative sense single stranded RNA genome. It belongs to Rhabdoviridae family in the order Mononegavirales. The 11 kb genomic RNA of CHPV codes for nucleocapsid (N) protein, phospho (P) protein, matrix (M) protein, Glyco (G) protein and large (L) protein. The major biological property of N protein is to bind with nascent leader RNA to initiate encapsidation of replication product concomitant to its synthesis [2, 3, 4]. It is proved that co-expression of P protein is essential along with N protein for the proper encapsidation of genomic RNA. It protects the genomic RNA from degradation by cellular ribonucleases. Along with protecting the viral RNA, N protein also plays a regulatory role in the transition from transcription to replication activity of viral RNA dependent RNA polymerase (L protein) in the viral life cycle [5, 6]. Among the vesiculoviruses, the N protein amino acid sequence is highly conserved. The intraviral interactions between N-P and N-RNA are well studied in CHPV [7, 8]. The involvement of CHPV N protein in interaction with host cell proteins has been reported; the functional consequences of these interactions are not fully understood. The structural similarity based approach proposed the repertoires of host proteins interacting with CHPV N protein [9].

Still understanding of lifecycle and pathogenesis of this virus is largely derived from studies on vesicular stomatitis virus (VSV) and rabies virus (RV). Experimental studies on CHPV are necessary since there is a remarkable difference in target hosts and pathogenicity between these viruses. So far, there has been no significant effort been made to understand CHPV interactions with its host cells i.e. neurons and its neuronal transmission. Information on the viral-host interactions allows the thorough characterization of the viral life cycle and the potential to reveal important information that could be targeted for drug therapy. Spectrums of host proteins are found to interact with VSV and RV, although they differ in their mode of cytopathogenesis. VSV and RV share many interacting host protein partners – La, Hsp70, RLR, TLR, Mx family of GTPases, YAP and NEDD4 [10].

This study aims to profile the interaction of the CHPV nucleoprotein (N) with the neuronal proteins. The present study adopted pull-down assay to identify the host proteins interacting with CHPV N protein. The selected interactions were further validated by immunofluorescence assay (IFA) and qualitative RT-PCR. Subsequently, the structure of viral protein and selected host proteins were docked computationally and the interfacial residues involved in interactions were predicted. On the basis of identified protein interactions between CHPV-N protein and neuronal cell proteins, the probable mode of CHPV pathogenesis in neuronal cells can be interpreted.

Cell lines and viruses

Mouse Neuroblastoma (Neuro-2a) cell line (ECACC Cat No.89121404, Sigma) and African green monkey kidney cells (Vero) (ECACC Cat. No. 84113001, Sigma) were grown and maintained as explained in our previous research article [11]. The quantification of Chandipura virus (CHPV) strain used in this study (Isolate no.034267) [12] was performed as per the standardized protocol [11, 13].

Cloning of CHPV N gene in E.coli based expression plasmids

The CHPV genomic RNA was extracted using RNAiso plus reagent (TaKaRa, Japan) and cDNA was prepared by AMV-RT (Promega Corporation, Madison, USA) as per manufacturer’s instructions. The gene specific primers used to amplify the CHPV N gene are mentioned in Table no 1. The full length CHPV N gene was cloned into pET28a (+) bacterial expression vector.

Expression and purification of recombinant CHPV N protein

The pET28a vector having CHPV N gene was transformed into E. coli BL21 (DE3) cells. The expression of recombinant N protein was induced using 1mM IPTG (Isopropyl-β-D-thiogalactopyranoside, Sigma) at 18 °C for overnight. The cells were harvested, pelleted and lysed into bacterial lysis buffer (50mM Tris-pH 8.0, 500mM NaCl, 1 mM EDTA, 0.1% Triton X-100). The cell lysate was clarified by centrifugation. The clear supernatant was applied to a Ni-NTA-agarose column pre-equilibrated with bacterial lysis buffer. The recombinant His-tagged CHPV N protein was purified under native conditions as per manufactures protocol (Thermofischer, USA). The eluted fractions from the Ni-NTA columns were pooled, dialyzed and used for western blot analysis as described earlier [11] using anti-CHPV N antibody (1:1000) and Horseradish peroxidase (HRP) conjugated anti rabbit IgG (Thermofischer, USA).

Pull down assay

Confluently grown Neuro-2a cells were lysed in RSB-Triton X-100 lysis buffer (10 mM Tris-pH8.0, 1.5mM MgCl₂, 10mM NaCl, 0.1% Triton X-100, 1mM EDTA) containing 20 mM imidazole and EDTA free protease cocktail inhibitor. The cell lysate was clarified by centrifugation at 4°C. The soluble cytoplasmic fraction was pre-cleared by incubating the lysate with Ni-NTA agarose that was pre-equilibrated with RSB-Triton X-100 lysis buffer. The pre-cleared lysate was used to pull down cellular proteins interacting with purified N protein bound to Ni-NTA agarose beads by incubating the clarified cell lysate with n protein bound Ni-NTA resin. The resin was washed extensively with interaction buffer (50 mM NaH2PO4, 200mM NaCl, 0.1% Triton X-100) and cellular proteins interacting with the immobilized N proteins were eluted in high ionic strength buffer (50 mM NaH₂PO₄, 500mM NaCl). The eluted cellular proteins were concentrated by Tri-chloro-acetic acid (TCA) precipitation. The elute fractions were separated on 12% SDS-PAGE and stained with colloidal Coomassie brilliant blue (CBB) stain for overnight.

Protein Identification by Q-TOF LC-MS

The SDS-PAGE protein bands were subjected for in-gel tryptic digestion and examined by Q-TOF LC-MS analysis (Agilent 6540 Q-TOF MS). The resulting peptide sequences were analyzed against SWISS-PROTdatabase available in MASCOT search tool.

In-silico analysis of protein-protein interaction

The structure of CHPV N protein was constructed using chain J (pdb id: 5uk4) of VSV N protein complex and the homology model of CHPV N (Uniprot ID: P11211) available from the SWISS-PROT. The molecular docking between the structure of CHPV N protein and selected cellular proteins was performed by ZDOCK module in Discovery Studio software. Top poses in largest cluster were manually observed and selected for Refine docked protein program (rDock) in Discovery Studio software. The refined poses again sorted according to E_Dock value. The pose having lowest EDock value was selected and the docked protein interfaces were analyzed.

Absolute Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total cellular RNA was isolated from the CHPV infected (0.1 MOI) and mock-infected Neuro-2a cells using RNAiso plus reagent (TaKaRa, Japan) and cDNAs was prepared using AMV-RT as per manufacturer’s instructions. The qRT-PCR (BioRad CFX96 Touch RT-PCR) reaction was standardized to analyze the mRNA levels of selected cellular proteins using SYBR Green Premix Ex-Taq (TaKaRa, Japan). Thermal profile of the assay for selected neuronal genes is shown in supp. Table no. 1. Results were analyzed with the inbuilt CFX Maestro software. Absolute mRNA level quantification was done using the standard curve generated using HSC70 and Actin TA clones. The qPCR primers used in the current study are listed in the supp. Table no. 2.

Co-immunoprecipitation

The Neuro-2a cells grown in 6-well tissue culture plate (Nucleon Delta Surface, Thermo Scientific) were infected and mock infected with CHPV (1.0 MOI) for 6 h. After infection, cells were rinsed with PBS and lysed in IP lysis buffer (25 mM Tris [pH7.0], 150 mM NaCl, 1% Triton X-100) supplemented with protease inhibitors (100 mM EGTA, 100 mM Na-pyrophosphate, 100 mM Na-orthovandate, 100 mM Na-F) and protease inhibitor cocktail (Sigma). After centrifugation, the supernatant was pre-cleared by incubating it with Protein G beads (Thermofischer, USA). The pre-cleared lysate was immune-precipitated using HSC70 monoclonal antibodies (Cat. No. MA3-014, Invitrogen) coated on Protein G beads, for overnight. After extensive washing with IP lysis buffer and PBS, the resulting immune-precipitate was eluted in a 1X SDS sample loading buffer. The eluted proteins were separated on SDS-PAGE. Western blot analysis was performed using anti-CHPV N rabbit antibody and HSC70 mAb. HRP-conjugated goat anti-mouse antibody and goat anti-rabbit antibody (Sigma, USA) was used to develop the signal. The signals were captured on photographic films.

Confocal microscopy study

Neuro-2a cells cultured on poly L-lysine treated glass coverslips in 24-well tissue culture plate (Nucleon Delta Surface, Thermo scientific, USA) were infected with CHPV (1.0 MOI) for 6 h. Post infection, cells were fixed with 4% paraformaldehyde (PFA), permeabilized using 0.1% Triton X-100 and blocked with 3% BSA prepared in PBS (pH 7.4). The cells were further incubated with anti-CHPV N rabbit antibody (in house antibody) and HSC70 mAb (Invitrogen, USA) for 60 min at 37 °C. Subsequently, the cells were double-stained with Alexa Fluor 546-conjugated goat anti-rabbit IgG antibody (Invitrogen, USA) and Alexa Fluor 488-conjugated goat anti-mouse IgG antibody (Invitrogen, USA). The cell nuclei were counter stained with DAPI (4’, 6-Diamidino-2-phenylindole dihydrochloride, Sigma). The cover-slips were mounted on microscope slides with Moiwal 4-88 (Sigma, USA) mounting medium and viewed under confocal microscope (Cell Insight CX7 High Content Screening platform, Thermofisher, USA). The pictures were captured and merged.

The same protocol was followed to study the co-localization of CHPV N protein with actin filaments using anti-CHPV N rabbit antibody and Alexa fluor 488 phalloidin antibodies (Invitrogen, USA).

Expression of recombinant N protein

The Ni-NTA purified recombinant N protein was confirmed by Coomassie staining and Western blot using rabbit anti CHPV-N antibodies. The Western blot confirmed the expression and purification of CHPV N protein as shown in Fig 1.

Identification of Neuro-2a cellular proteins interacting with viral proteins

The purified 6x-His tagged N protein was immobilized on Ni-NTA agarose resin and used as bait to pull down the cellular proteins from Neuro-2a cell lysate that interact with it. The pre-cleared cellular lysate was used to screen cellular proteins non-covalently interacting to the immobilized recombinant N protein. In a parallel experiment, Ni-NTA resin alone was incubated with pre-cleared cellular lysate and used as control. The eluted proteins were separated on SDS-PAGE gel and identified two distinct bands as shown in supp. Fig 1. The protein bands from the CBB stained SDS-PAGE gel were excised and subjected to in-gel tryptic digestion. The peptides were analyzed by Q-TOF LC/MS. MASCOT search analysis of the peptide masses resulted in identification of 10 cellular proteins interacting with CHPV N protein and the result is summarized in Table 2.

In silico analysis of interaction between CHPV N protein and neuronal proteins

The structure of CHPV N protein was designed using VSV-N protein as template in SWISS-PROT while the structures of HSC70 and cytoplasmic actin were downloaded from SWISS-PROT. During the docking process, The RNA binding domain of CHPV N protein was excluded during the docking process. The poses with lowest E_RDOCK values were analysed for the amino residues involved in interaction at the interface. The structures of docked complexes are shown in Fig 2. The list of amino acids involved in the interaction of N protein and cellular proteins at the interface were mentioned in supp. Table 3 while the Z_DOCK and R_DOCK values along with the number of H-bonds found in the docked complexes are represented in supp. Table no.4

Expression of HSC70 and actin mRNA in CHPV infected cells

The qRT-PCR assay results shown that there was increase in expression of HSC70 mRNA 10 h PI in CHPV infected Neuro-2a cells in comparison with mock infected cells (Fig 3a). Similarly, the protocal was standerdized for analysing the change in actin mRNA expression level in the CHPV infected and non-infected Neuro-2a cells. The qRT-PCR results showed that the expression of actin mRNA was slightly elevated at 12 h PI in CHPV infected Neuro-2a cells compared to the mock infected Neuro-2a cells (Fig 3b).

The standard curve was created using HSC70 and actin TA clones and used for calculating the changes in the HSC70 and actin mRNA expression level respectively. The standard curve displayed a linear relationship between correlation coefficient of 0.996 and 0.997 for HSC70 and Actin gene fragment amplification with high amplification efficiency as shown in supp. Fig 2. Melt curve data of both the standard TA clones represented the single peak. This indicates the specificity of the primers in amplifying the correct gene segment without any non-specific amplification.

HSC70 binds to CHPV N protein in vivo

To demonstrate the interaction of HSC70 and N protein in vivo, co-immuno precipitation & co-localisation assays were carried out in Neuro-2a cells. The Neuro-2a cells were infected with CHPV. Subsequently the infected cells and the mock infected cells were harvested 6h PI. The lysates were subjected for immune-precipitation with antibody against HSC70. The immune-precipitated complex obtained was resolved in SDS-PAGE, transferred to PVDF membrane and immune-blotted using anti-HSC70 mAb and anti-CHPV N antibody separately. The assay confirmed that CHPV N protein co-immunoprecipitated with HSC70 protein from CHPV infected Neuro-2a cells as shown in Fig 4. Also, interaction of CHPV N protein with HSC70 was confirmed by indirect IFA in infected cells under permeabilized conditions. CHPV N protein entirely co-localized with HSC70 protein as shown in Fig 5a.

CHPV co-localizes with actin in vivo

We further investigated this interaction of CHPV proteins with cytoplasmic actin by performing indirect IFA under permeabilized conditions. In the CHPV infected cells, CHPV N protein focally co-localized with actin as shown in Fig 5b.

By using a pull down assay and a proteomic technique, we were able to identify a variety of cellular proteins that interacted with the CHPV N protein in this work. Out of the total identified proteins HSC70 and cytoplasmic actin proteins being chosen for further research based on comprehensive referencing. The other protein interactions identified in mass spectrometry are seems to be nucleic acid binding proteins, because of which they are excluded from the further analysis. Proteomic examination of isolated VSV particles revealed the presence of HSP90, HSC70, annexin, and integrin proteins in the virus structure [14]. Tubulin [15], cyclophilin A [16], translation elongation factor 1 alpha (eF1a) [17], RNA guanyltransferase [18], and casein kinase II [19] have all been found in VSV virion in earlier investigations. The Rabies virion was shown to be related with the heat shock cognate 71 kDa protein (HSC70, also known as HSPA8) [20]. Many of the cellular proteins identified in this study have also been found in the virion of other RNA and DNA viruses, implying that these viruses may employ similar physiological pathways to complete their life cycle.

The amino acid residues involved in interaction at interfaces of chosen cellular proteins (HSC70 and actin protein) and CHPV N protein were identified using in silico approach. During the docking process, the RNA binding domain of the N protein was excluded from the analysis to reduce the prediction of non-specific amino acid residues involved in interactions. This finding reveals that the contact was specific and implying CHPV N protein might interact with neural proteins in vivo. Further research into the specific role of anticipated amino acids implicated in CHPV-neuronal protein interaction is required. These discovered interactions could be exploited to develop targeted therapeutics to combat Chandipura infection. The discovered proteins were then need to be tested for their functional ability to interact with the CHPV N protein, because functional impact is not always implied by an in vitro interaction research. The "Accidental" interactions between the proteins are most likely due to the quantity of proteins in the sample.

CHPV infection increases HSC70 and cytoplasmic actin mRNA expression in neural cells, according to our findings. HSP60 and HSC70 were shown to be upregulated in SV-40 converted keratinocytes [21]. Actin and HSC70 protein have been implicated in the replication of RNA and DNA viruses. As a result, we chose to continue with these two proteins for additional testing.

Co-immunoprecipitation and confocal imaging were used to examine the functional relationship between CHPV N protein and HSC70 proteins. CHPV N protein was immune-precipitated with HSC70 from CHPV-infected neuronal cells, as shown in fig no. 6. Furthermore, confocal microscopy result revealed that CHPV N and HSC70 protein had a high co-localization. These findings suggest that the CHPV N protein interacts specifically with the HSC70 protein in vivo. HSC70 is a member of the HSP70 family of ATP-dependent cellular chaperones involved in the proper folding and transport of freshly produced and misfolded proteins [22]. HSC70 has also been found on the surface of a variety of cells, where it is thought to play an important role in the immune response [23].

HSP70 family chaperons have been found to interact with viral proteins in DNA and RNA viruses infecting a wide range of species at every stage of the viral life cycle, from entry through budding [24]. In RNA viruses, HSC70 interacts with N protein in Rabies virus [25], Measles virus [26], and Hantan virus [27]. The presence of HSC70 in virion structure was further confirmed by proteomic analysis of pure VSV particles [14]. These findings suggest that HSC70 proteins may have an impact on more than one step of the viral life cycle. RNA viruses are notorious for their high rates of genome mutation, which results in a pool of misfolded proteins being produced. These interactions could help to mitigate the negative repercussions of misfolded proteins produced by viral polymerase's erroneous nature.

The RNP complex of CHPV is made up of numerous copies of N protein that wrap around the RNA genome and an associated polymerase. The tight helical RNP complex is formed by 9 nucleotides per N monomer, i.e. the genomic RNA is surrounded by over 1200 N protein [28]. It's possible that CHPV has devised a mechanism in which cellular chaperones assist in overcoming the impact of frequent polymerase errors. A thorough understanding of important virus-host cell interactions, such as the N-HSC70 interaction, could aid in the development of effective management techniques for pathogenic viruses like CHPV and other related viruses. This may be especially true in this case, because HSP inhibition is a well-studied phenomenon with well-characterized inhibitory agents [29].

Similarly, the association of CHPV N proteins with cytoplasmic actin filaments was confirmed by our IFA results. In CHPV-infected neuronal cells, the CHPV proteins were found to be focally co-localized. Actin filaments are involved in a variety of cellular functions, including organelle movement, cell adhesion, and division, as well as cell-cell signaling. Despite the fact that actin molecules are found throughout the cytoplasm, their concentration is higher beneath the plasma membrane [30]. The cytoskeleton also plays a crucial part in the viral life cycle. Actin has been implicated in the replication of Vaccinia virus [31, 32], human parainfluenza virus type 3 [33], human respiratory syncytial virus [34], and Sendai virus [35].

Actin filaments interact with the viral nucleo-capsid during the life cycle of these viruses. The nucleo-capsid protein of the rabies virus has been shown to alter the state of actin filaments in neuronal cells [36]. To further understand how non-lytic neurotropic viruses cause brain pathogenesis, more research into the role of actin filaments in CHPV replication is needed.

Finally, we undertook the first systematic analysis of CHPV protein interactions with host proteins in this study. For millions of years, viruses have evolved as cell biologists, and as a result, they may offer us unexpected molecular lessons about intracellular itineraries. More research on these interactions will shed light on this crucial aspect of host-virus interaction.

Acknowledgement

The Vishal K Kavathekar was the recipient of the Senior Research Fellowship (SRF) from the University Grant Commission (UGC), Govt. of India. The authors wish to acknowledge the Director, National Institute of Virology, Pune for the in-house funding during this research work. We also thank Dr. Kavita Lole, NIV, Pune and all the staff of NIV, Kerala for their support during the study.

Competing interest

The authors have no relevant financial or non-financial interests to disclose.

Author Contribution

All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Vishal K Kavathekar and Susmit Sambhare. The final data analysis and draft of the manuscript was reviewed by Dr. B. Anukumar. All authors read and approved the final manuscript.

Maxwell KL, Frappier L. (2007) Viral Proteomics. Microbiology and Molecular Biology Reviews 71(2);398-411 https://doi.org/10.1128/MMBR.00042-06
Blumberg BM, Giorgi C, Kolakofsky D. (1983) N protein of vesicular stomatitis virus selectively encapsidates leader RNA in vitro. Cell 32(2);559-567 https://doi.org/10.1016/0092-8674(83)90475-0
Patton JT, Davis NL, Wertz GW. (1984) N protein alone satisfies the requirement for protein synthesis during RNA replication of vesicular stomatitis virus. J Virol 49(2);303-309 https://doi.org/10.1128%2Fjvi.49.2.303-309.1984
Banerjee AK. (1987). Transcription and replication of rhabdoviruses. Microbiol Rev 51(1); 66-87 https://doi.org/10.1128%2Fmr.51.1.66-87.1987
Majumdar A, Bhattacharya R. Basak S, Shaila MS, Chattopadhyay D, Roy S. (2004). P-protein of Chandipura virus is an N-protein-specific chaperone that acts at the nucleation stage. Biochemistry 43;2863–2870 https://doi.org/10.1021/bi035793r
Bhattacharya R, Basak S, Chattopadhyay DJ. (2006) Initiation of encapsidation as evidencedby deoxycholate-treated Nucleocapsid protein in the Chandipura virus life cycle. Virology 349(1); 197-211 https://doi.org/10.1016/j.virol.2006.01.017
Majumdar A, Basak S, Raha T, Chowdhury SP, Chattopahyay D, Roy S. (2001) Effect of Osmolytes and Chaperone-like Action of P-protein onFolding of Nucleocapsid Protein of Chandipura virus. J. Biol. Chem 276(33);30948-30955 https://doi.org/10.1074/jbc.M011705200
Kumar K, Rajasekharan S, Gulati S, Rana J, Gabrani R, Jain CK, Gupta A, Chaudhary VK, Gupta S. (2013) Elucidating the interacting domains of chandipura virus nucleocapsid protein. Adv. Virol. 594319. https://doi.org/10.1155/2013/594319
Rajashekharan S, Rana J, Guati S, Sharma SK, Gupta V, Gupta S. (2013) Predicting the host protein interactors of Chandipura virus using a structural similarity based approach. Pathog Dis 69(1); 29-35 https://doi.org/10.1111/2049-632x.12064
Guleria A, Kiranmayi M, Sreejith R, Sharma SK, Gupta S.(2011) Reviewing host proteins of Rhabdoviridae: Possibe elads for lesser studied viruses. J Biosci 36(5);929-937 https://doi.org/10.1007/s12038-011-9164-4
Kavathekar VK, Dhanawade MJ, Sonawane KD, Balakrishanan A.(2020) Role of cell surface vimentin in Chandipura virus replication in Neuro-2a cells.Virus Research 285(198014) https://doi.org/10.1016/j.virusres.2020.198014
Rao BL, Basu A, Wairagkar NS, Gore MM, Arankalle VA, Thakare JP. (2003) A large outbreak of acute encephalitis with a high fatality rate in children in Andhra Pradesh, India, in 2003, associated with Chandipura Virus. Lancet 364(9437);869–874 https://doi.org/10.1016/s0140-6736(04)16982-1
Jadi RS, Sudeep AB, Satyendra K, Arankalle VA, Mishra AC. (2010). Chandipura virus growth kinetics in vertebrate cell lines, insect cell lines & embryonated eggs. Indian J. Med. Res. 132,155-159.
Moerdyk-Schauwecker M, Hwang S, Grdzelis VZ. (2009) Analysis of virion-associated host proteins in vesicular stomatitis virus using a proteomics approach. Virol J 6:166. https://doi.org/10.1186/1743-422X-6-166
Moyer SA, Baker SC, Lessard JL. (1986) Tubulin: a factor necessary for the synthesis of both Sendai virus and vesicular stomatitis virus RNAs. Proc Natl Acad Sci U S A. 83;5405–5409 https://doi.org/10.1073%2Fpnas.83.15.5405
Bose S, Mathur M, Bates P, Joshi N, Banerjee AK. (2003) Requirement for cyclophilin A for the replication of vesicular stomatitis virus New Jersey serotype. J Gen Viro. 84;1687-1699 https://doi.org/10.1099/vir.0.19074-0
Das T, Mathur M, Gupta AK, Janssen GM, Banerjee AK. (1998). RNA polymerase of vesicular stomatitis virus specifically associates with translation elongation factor-1 alphabetagamma for its activity. Proc Natl Acad Sci USA 95(4);1449-1454 https://doi.org/10.1073/pnas.95.4.1449
Gupta AK, Mathur M, Banerjee AK. (2002) Unique mapping activity of recombinant RNA polymerase (L) of Vesicular stomatits virus: association of cellular capping enzyme with L protein. Biochem Biophys Res commun 293(1);264-268 https://doi.org/10.1016/s0006-291x(02)00217-6
Gupta AK, Das T, Banerjee AK. (1995) Casein kinase II is the P protein phosphorylating cellular kinase associated with the ribonucleoprotein complex of purified Vesicular stomatitis virus. J GenVirol 76;365-372 https://doi.org/10.1099/0022-1317-76-2-365
Sagara J, Kawai A. (1992) Identification of heat shock protein 70 in the rabies virion. Virology 190(2);845-48 https://doi.org/10.1016/0042-6822(92)90923-d
Honoré B, Rasmussen HH, Celis A, Leffers H, Madsen P, Celis J. (1994) The molecular chaperones HSP28, GRP78, endoplasmin, and calnexin exhibit strikingly different levels in quiescent keratinocytes as compared to their proliferating normal and transformed counterparts: cDNA cloning and expression of calnexin. Electrophoresis 15;482–490 https://doi.org/10.1002/elps.1150150166
Schlecht R, Scholz SR, Dahmen H, Wegener A, Sirrenberg C, Musil D, Bomke J, Eggenweiler HM, Mayer MP, Bukau B. (2013) Functionalanalysis of Hsp70 inhibitors. PLoS One 8:e78443 https://doi.org/10.1371/journal.pone.0078443
Multhoff G, Hightower LE. (1996) Cell surface expression of heat shock proteins and the immune response. Cell Stress Chaperones 1(3);167–176 https://doi.org/10.1379/1466-1268(1996)001%3C0167:cseohs%3E2.3.co;2
Santoro MG, Amici C, Rossi A. (2009) Role of Heat Shock Proteins in Viral Infection. Infect Dis 24(4);51–84 https://doi.org/10.1007%2F978-90-481-2976-8_3
Lahaye X, Vidy A, Fouquet B, Blondel D. (2012) Hsp70 protein positively regulates rabies virus infection. J Virol 86;4743–4751 https://doi.org/10.1128%2FJVI.06501-11
Couturier M, Buccellato M, Costanzo S, Bourhis JM, Shu Y, Nicaise M, Desmadril M, Flaudrops C, Longhi S, Oglesbee M. (2010) High affinity binding between Hsp70 and the C-terminal domain of the measles virus nucleoprotein requires an Hsp40 co-chaperone. J Mol Recognit 23(3);301– 315 https://doi.org/10.1002/jmr.982
Yu L, Ye L, Zhao R, Liu YF, Yang SJ. (2009) HSP70 induced by Hantavirus infection interacts with viral nucleocapsid protein and its overexpression suppresses virus infection in Vero E6 cells. Am J Transl Res 1(4);367–380.
Thomas D, Newcomb WW, Brown JC, Wall JS, Hainfeld JF, Trus BL, Steven AC. (1985) Mass and molecular composition of Vesicular Stomatitis Vims: a scanning electron microscopy analysis. J Virol 54(2);598-607 https://doi.org/10.1128/jvi.54.2.598-607.1985
Geller R, Vignuzzi M, Andino R, Frydman J. (2007) Evolutionary constraints on chaperone-mediated folding provides an antiviral approach refractory to development of drug resistance. Genes Dev 21(2);195–205 https://doi.org/10.1101%2Fgad.1505307
Radtke K, Döhner K, Sodeik B. (2006) Viral interactions with the cytoskeleton: a hitchhiker’s guide to the cell. Cell Microbiol 1;8(3);387–400 https://doi.org/10.1111/j.1462-5822.2005.00679.x
Mallardo M, Schleich S, Krijnse Locker J. (2001) Microtubule-dependent organization of vaccinia virus corederived early mRNAs into distinct cytoplasmic structures. Mol Biol Cell 12(12);3875–3891 https://doi.org/10.1091/mbc.12.12.3875
Schramm B, Locker JK. (2005) Cytoplasmic organization of POXvirus DNA replication. Traffic 6(10);839–846 https://doi.org/10.1111/j.1600-0854.2005.00324.x
Gupta S, De BP, Drazba JA, Banerjee AK. (1998) Involvement of actin microfilaments in the replication of human parainfluenza virus type 3. J Virol 72(4);2655–2662 https://doi.org/10.1128%2Fjvi.72.4.2655-2662.1998
Burke E, Mahoney NM, Almo SC, Barik S. (2000) Profilin is required for optimal actin-dependent transcription of respiratory syncytial virus genome RNA. J Virol 74(2);669–675 https://doi.org/10.1128/JVI.74.2.669-675.2000
Ogino T, Iwama M, Ohsawa Y, Mizumoto K. (2003) Interaction of cellular tubulin with Sendai virus M protein regulates transcription of viral genome. Biochem Biophys Res Comm 311(2);283–293 https://doi.org/10.1016/j.bbrc.2003.09.205
Ceccaldi PE, Valtorta F, Braud S, Hellio R, Tsiang H. (1997). Alteration of the actin-based cytoskeleton by rabies virus. J Gen Virol 78;2831–2835 https://doi.org/10.1099/0022-1317-78-11-2831

Table 1: Primers used for CHPV N gene amplification

Sr.No.	Primer Name	Primer Sequence
1	CHP NF1	5’CGCGGATCCATGACTTCTTCAGTGAC3’
2	CHP NR1	5’ CGGTTCGAATACTCTGGCTCTCATGT3’

Table no. 2: Result of Q-TOF LC/MS analysis

Sample	Protein(s) identified	Accession	Mascot Score	Molecular mass (kDa)	Sequence Coverage (%)
N1	Heat shock cognate 71 kDa protein OS=Mus musculus	HSP7C_MOUSE	4326	71	64
	Stress-70 protein, mitochondrial OS=Mus musculus	GRP75_MOUSE	679	73	48
	Nucleolin OS=Mus musculus	NUCL_MOUSE	332	76	23
	Heat shock protein HSP 90-beta OS=Mus musculus	HS90B_MOUSE	304	83	30
	Annexin A6 OS=Mus musculus	ANXA6_MOUSE	242	76	44
	Actin, cytoplasmic 1 OS=Mus musculus	ACTB_MOUSE	79	42	31
	DNA topoisomerase 1 OS=Mus musculus	TOP1_MOUSE	70	91	22
	Polyadenylate-binding protein-interacting protein 1 OS=Mus musculus	PAIP1_MOUSE	63	46	8
	Moesin OS=Mus musculus	MOES_MOUSE	58	67	14
N2	Actin, cytoplasmic 1 OS=Mus musculus	ACTB_MOUSE	702	42	49
	60S acidic ribosomal protein P0 OS=Mus musculus	RLA0_MOUSE	552	34	53
	ELAV-like protein 2 OS=Mus musculus	ELAV_MOUSE	285	39	39
	Heat shock protein HSP 90-beta OS=Mus musculus	HS90B_MOUSE	170	83	15
	Peroxiredoxin-2 OS=Mus musculus	PRDX2_MOUSE	93	21	23
	40S ribosomal protein SA OS=Mus musculus	RSSA_MOUSE	80	32	31
	Glyceraldehyde-3-phosphate dehydrogenase OS=Mus musculus	G3P_MOUSE	61	36	24

Supplementaryinformation.doc

Download PDF

Version 1

posted

You are reading this latest preprint version

Chandipura virus nucleoprotein interact with heat shock cognate 71 and actin proteins in Neuro-2a cells during replication

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Tables

Supplementary Files

Status:

Version 1