Apolipoprotein C3 facilitates internalization of cationic lipid nanoparticles into terminally differentiated bone marrow-derived mouse mast cells

doi:10.21203/rs.3.rs-1976315/v1

Download PDF

Article

Apolipoprotein C3 facilitates internalization of cationic lipid nanoparticles into terminally differentiated bone marrow-derived mouse mast cells

https://doi.org/10.21203/rs.3.rs-1976315/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 09 Jan, 2023

Read the published version in Scientific Reports →

You are reading this latest preprint version

Mast cells (MCs), are hematopoetically-derived secretory immune cells that release preformed as well as de novo synthesized inflammatory mediators in response to activation by several stimuli. Based on their role in inflammatory responses, particularly in the lung and skin, MCs provide a convenient and effective target for anti-inflammatory therapeutic strategies. Drug-delivery of lipophilic payloads to MCs can be challenging due to their functionally distinct intracellular structures. In the present study, pH-sensitive cationic lipid-based nanoparticles (LNPs) composed of DODMA, DODAP or DOTAP lipids that encapsulated a GFP or eGFP plasmid were constructed using non-turbulent microfluidic mixing. This approach achieved up to 75-92% encapsulation efficiency. Dynamic light scattering revealed a uniform and homogeneous size distribution of LNPs.To promote cellular internalization, LNPs were complexed with apolipoproteins, amphipathic proteins capable of binding lipids and facilitating their transport in the bloodstream and into cells. Cryo-TEM analysis showed that LNP structure was differentially modified when associated with different types of apolipoproteins. LNP preparations made up of DODMA or DODMA, DODAP and DOTAP lipids were coated with seven apolipoproteins (Apo A1, B, C3, D, E2, E4 and H). Terminally differentiated bone-marrow derived mouse mast cells (BMMCs) were exposed to Apolipoprotein-LNP mixture and internalization was measured using flow cytometry. Out of all the apolipoproteins tested, ApoC3 most efficiently facilitated cellular internalization of the LNP into BMMCs as determined by GFP fluorescence using flow cytometry. These effects were confirmed in a less differentiated but also interleukin-3-dependent model of mouse mast cells, MC/9. ApoC3-LNP enhanced internalization by BMMC in a concentration-dependent manner and this was significantly increased when BMMC were pre-treated with inhibitors of actin polymerization, suggesting a dependence on intracellular shuttling. Activation of peroxisome proliferator-activated receptor gamma (PPAR) decreased ApoC3-LNP internalization and reduced the expression of apolipoprotein E receptor 2 (ApoER2) , suggesting that ApoC3-LNP binding to ApoER2 may be responsible for its enhanced internalization. Altogether, our studies reveal an important role of ApoC3 in facilitating internalization of cationic LNPs into MCs.

Apolipoprotein

internalization

mast cells

actin polymerization

PPARγ

ApoER2

Lrp8

ApoC3 promotes internalization of GFP-DODMA-LNP into BMMC and MC/9
GFP-DODMA-LNP internalizes via actin cytoskeleton-dependent endocytic pathway
Actin polymerization inhibitors enhance internalization efficiency of GFP-DODMA-LNP
ApoC3 mediated internalization is independent of lipid composition of LNP and size of payload
PPARγ activation reduces ApoC3-mediated eGFP-DODMA-LNP internalization

Clinical approval of Lipid Nano Particles (LNP) for delivery of nucleic acids and small molecule drugs heralded the advent of nanotechnology-based pharmacotherapy. In particular, this approach has recently been utilized to deliver antigenic payloads to immune cells and initiate protective immune responses in vaccine development. However, LNP delivery to immune cells remains a major unmet challenge, particularly to cell types that are difficult to isolate and culture in vitro. Cationic lipids have several advantages to polymer-based nanoparticles. First, cationic lipids are much more likely to penetrate immune cell membranes because they can interact with the anionic phospholipids in the plasma membrane and thereby promote its uptake via endocytic pathways [1-3]. Second, they are immunologically inert and therefore unlikely to activate nonspecific immune responses [4]. Third, cationic lipids can be easily functionalized to specifically target cell membrane receptors and biomarkers. Although cationic lipid nanoparticles are sometimes synthesized using the double emulsion-solvent evaporation method, it can result in heterogeneous populations of LNPs with differing sizes, compositions and incomplete encapsulation of payloads. We have previously used controlled microfluidic mixing to generate discrete populations of 50-150 nm LNPs with higher encapsulation efficiencies [5]. We have optimized several different formulations based on six specific lipids: 1,2-dioleyloxy-3-dimethylaminopropane (DODMA), 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DMPE) and cholesterol. In combination these lipids created stable and effective LNP delivery vehicles.

Although cationic lipids are effective in delivering cargo to adherent cells, they are particularly troublesome for cells grown in suspension due to reduced probability of interaction with the delivery vehicle [6]. Non-transformed, primary cultured immune cells are extremely difficult to transfect due to their low division rate, intrinsic self-defence mechanisms to prevent introduction of foreign genetic material, and increased susceptibility to apoptosis when exposed to cationic lipids [7, 8]. These challenges can be overcome by coating LNPs with apolipoproteins (Apo) which bind both lipids and lipoproteins to form polar structures that act as lipid transport mechanisms in the lymph, blood and cerebrospinal fluid [9-12]. Apos can act as intrinsic docking and plasma membrane entry facilitators and are exploited by hepatitis C to enable virus entry [13-16]. Apos have recently been used to create thermostable lipid-like nanoparticles for delivery of RNAi [17], miRNA [18], siRNA [19], and small molecule therapies [20]. These studies demonstrate that targeting of specific tissues appears to be dependent upon the type of Apo or combination of Apos that were used to coat the nanoparticles. It is yet to be demonstrated whether this strategy is effective for the transfection of immune cells, specifically primary cultured immune cells.

Mast cells are a tissue-resident innate immune cell that mediate tissue homeostasis but also facilitates inflammatory disease [21]. Unlike lymphocytes, mast cells are large, granular and extremely difficult to transfect using conventional non-viral strategies [22, 23]. We hypothesized that Apos may facilitate the internalization of cationic LNPs into terminally differentiated mouse bone marrow-derived mast cells (BMMC). We have screened seven different Apos (Apo A1, B, C3, D, E2, E4 and H) and showed that ApoC3 significantly enhances the internalization efficiency of two distinct LNP preparations (made up of DODMA or DOTAP, DODAB and DODMA) into BMMC. Internalization efficiency was significantly enhanced when BMMC were pre-treated with actin polymerization inhibitors as well as a significant decrease was observed when PPARγ was activated using agonist GW1929 and troglitazone.

Lipids and chemicals

The lipid 1,2-dioleyloxy-3-dimethylaminopropane (DODMA) was purchased from Cayman Chemical (Ann Arbor, MI, USA), 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DMPE) and cholesterol were obtained from Sigma–Aldrich Canada (Oakville, ON, Canada). Anhydrous ethanol was obtained from Commercial Alcohols (Brampton, ON, Canada).

Plasmid DNA

The plasmid pMIPS-VEE V 34 expressing a GFP gene (6.3 Kb) was a gift from Defence Research and Development Canada. The plasmid peGFP which expresses enhanced green fluorescent protein (eGFP) (4.7 Kb) from a human cytomegalovirus immediate early promoter was purchased from Clontech BD Biosciences (Mississauga, ON, Canada) [5]. All plasmids were isolated using GeneJET Endo-free plasmid Maxiprep or PureLink Expi Endotoxin-free Maxi Plasmid Purification Kits (ThermoFisher Scientific, Burlington, ON, Canada) as per the manufacturer’s instructions.

Generation of LNPs

All LNPs were prepared by combining appropriate volumes of cationic lipid (DODMA, DODAP, DOTAP or a combination of DODMA, DODAP and DOTAP lipids (Hydrid LNPs); 50 mol% unless otherwise stated), helper lipid (DOPE; 11.5 mol%), PEGylated lipid (PEG-DMPE; 1.0 mol%; unless otherwise stated), and cholesterol (37.5 mol%; unless otherwise stated) in anhydrous ethanol with plasmid DNA in 25 mM sodium acetate (pH 4.0) at a nitrogen to phosphorus (N/P) ratio of 6:1 using the NanoAssemblr Benchtop instrument and microfluidic cartridges (Precision Nanosystems, Vancouver, BC, Canada) set to a combined flow rate of 9 ml/min [flow rate ratio of 3 (DNA/ aqueous) to 1 (ethanol/lipid)]. The total lipid concentration was maintained at 14.68 mM and the cholesterol content was varied to offset changes in cationic lipid or PEGylated lipid content. The LNP formulations were diluted with PBS (pH 7.4, without magnesium and calcium; Gibco) and subjected to three sequential diafiltration steps using Amicon Ultra centrifugal filters with a nominal molecular weight limit of 10 kDa (Millipore, Etobicoke, ON, Canada) [5]. The GFP-Hybrid-LNP and GFP-DODMA-LNP preparations were stable for at least 17 months and two years respectively when stored at 4^oC, with no detectable changes in size.

Characterization of LNPs

The Z-average of each LNP formulation in PBS was determined using dynamic light scattering (DLS) with a Zetasizer Nano ZS (Malvern Instruments, Malvern, Worcs, UK) set to 25ºC and a measurement angle of 173º. Samples were diluted 20 times with PBS for instrument optimization.

DNA encapsulation efficiencies were measured using a Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher Scientific) [5]. Briefly, the amount of PicoGreen fluorescence associated with free (unencapsulated) DNA (Ff) in the LNP solution was compared to the level of PicoGreen fluorescence obtained following a 5 min lysis of the LNPs using 0.05% Triton X-100 (total fluorescence, Ft). The unlysed and lysed LNP solutions (100 µl) were combined with 100 µl 1:200 PicoGreen solution prior to measurement (final [Triton X-100] = 0.025%). Standard curves containing pMIPS-VEE V 34 or eGFP plasmid DNA in the presence or absence of 0.025% Triton X-100 were also generated. Fluorescence was measured using a Synergy H1M plate reader (BioTek, Winooski, VT, USA) and the percentage of DNA encapsulation was calculated with the following formula: (Ft – Ff)/Ft × 100.

The morphology of LNPs in each formulation was characterized in JEOL2200FS TEM with an in-column Omega energy filter, running at 200 kV accelerating voltage. The cryo-TEM specimen of LNPs in aqueous solution were prepared using plunge freezing method. Briefly, 4 µl of LNPs solution was deposited on lacey carbon film supported TEM grids, glow discharged prior to placing the solution on and excess solution was blotted away from TEM grids using a filter paper. TEM grids were rapidly plunged into liquid ethane at -180^oC (Leica EM GP2 Plunge Freezer) and transferred to a storage box in liquid nitrogen until imaging. Bright field cryo-TEM images of LNPs embedded in vitreous ice were obtained at -180^oC. A 10-eV energy slit and defocusing were applied to enhance the contrast of LNPs and a low dose imaging was used to mitigate electron beam damage.

Cell culture

BMMC

All animals were sacrificed in accordance with the Canadian Council on Animal Care Guidelines and Policies (https://ccac.ca/en/about-the-ccac/) with approval from the Health Science Animal Care and Use Committee for the University of Alberta. The study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org). Femurs were removed from 12-week-old mice using standard dissection. Bone marrow was aspirated using a 27 gauge needle and the cells were cultured in RPMI media (Fisher, Hampton, New Hampshire, USA) supplemented with 4 mM L-glutamine (Fisher), 50 μM BME (Sigma-Aldrich, Oakville, Ontario, Canada), 1 mM sodium pyruvate (Fisher), 100 U/ml penicillin/100 μg/ml streptomycin (Fisher), 0.1 mM nonessential amino acids (Fisher), 25 mM HEPES (Fisher), 10% FBS (Gibco, Burlington, Ontario, Canada) and 30 ng/ml mouse recombinant interleukin (IL)-3 (Peprotech, Rocky Hill, New Jersey, USA), pH-7.4-7.6, in a humidified atmosphere of 5% CO2 in air at 37^oC. This media will be referred to as “supplemented RPMI”. The cell suspensions were maintained at a density of 0.25-0.5 x 10⁶ cells/ml for 4 weeks when the cells were tested for FceRI and c-Kit expression by flow cytometry to confirm maturation. After 4 weeks, 99% of cells were double positive for c-Kit and FceRI (Fig. 2A-ii). BMMC were used between 4 and 8 weeks of age.

MC/9

MC/9 cells were cultured in supplemented RPMI and maintained at a density of 0.25-0.5 x 10⁶ cells/ml. The cells were used up to 15 weeks of culture from time of removal from cryopreservation.

Flow cytometric analysis of FceRI and Kit expression and GFP fluorescence

BMMC or MC/9 were suspended in phosphate-buffered saline (PBS) supplemented with 0.5% bovine serum albumin (BSA) (PBS-BSA, Calbiochem Omnipur BSA fraction V) at 1.5× 10⁶ cells/ml, and incubated with 0.006 µg/ml CD117 (c-Kit) PE (eBioscience, San Diego, California, USA) and 0.006 μg/ml FcεRIα APC (eBioscience) for 1 hour (hr) at 4^oC. After washing with PBS-BSA twice, cells were re-suspended in 100 μl 0.5% BSA/0.05% sodium azide in PBS (PBS-BSA-sodium azide) and analyzed on a CytoFlex flow cytometer (Bechman Coulter, USA) by acquiring 20,000 events. Rat IgG2b k PE (eBioscience) and Armenian Hamster IgG APC (eBioscience) were used as isotype controls.

To measure GFP fluorescence, BMMC or MC/9 were washed twice with PBS-BSA and resuspended in 100 µl PBS-BSA-sodium azide and analyzed on a Cytoflex flow cytometer (Beckman Coulter, USA) equipped with an Argon ion laser (488-514 nm) and bandpass filter to enable detection fluorescence emission at 516 nm (for GFP), 578 nm (for c-Kit PE) and 660 nm (for FcεRIα APC). 20,000 events per sample were acquired at a flow rate of 30 µl/minute at room temperature. As mast cells are very granular (high SSC) and large (high FSC) when compared to other immune cell types such as monocytes and lymphocytes, a well-defined cell population containing relatively high FSC and SSC were gated and analyzed as shown in Figure 2A-i (BMMC) and 2F-i (MC/9). Data was generated using FlowJo 10.6.2 software (Becton, Dickinson and Company, USA).

LNP and apolipoprotein complex formation

LNPs and Apos were incubated in ddH₂O water overnight at 4°C. LNPs equivalent of 5 µg encapsulated plasmid DNA were incubated with 3 µg of each of the different human Apos; ApoA1 (Sigma, SRP4693), ApoB (Sigma, 178456), ApoC3 (Sigma, A3106), ApoD (Sigma, SRP4326), ApoE2 (Peprotech, 350-12), ApoE4 (Peprotech, 350-04) and ApoH (Sigma, G9173), unless otherwise stated, in a final volume of 200 µl. For control experiments (i.e. LNP only), LNPs were incubated with ddH₂O water (in the absence of any apolipoprotein) overnight at 4°C in a final volume of 200 µl. For Cryo TEM reactions were set up as described above in the absence of ddH₂O.

Transfection

BMMC were treated with Apo-LNP mixture (200 µl) in serum free supplemented RPMI media in a total volume of 500 µl. After four hr, 500 µl of supplemented RPMI media was added to the cell suspension, so that the final concentration was 0.1 X 10⁶ cells/ml, 5 µg plasmid/ml and 3 µg Apo/ml. Control cells (BMMC or MC/9) were treated with 200 µl ddH₂O water. The plate was incubated in a humidified 5% CO₂ incubator at 37°C for 24 hr followed by cell collection and processing for flow cytometry as described above.

Endocytosis inhibitor and PPARγ experiments

BMMC (1 X 10⁶ cells/ml) were treated with cytochalasin B (0.3 µM), 3-methyladenine (600 µM), chloroquine (20 nM), latrunculin B (3 µM) or a cocktail consisting of all the inhibitors for 1 hr at 37^oC prior to treatment with ApoC3-LNP mixture. Samples were collected at 24 hr post transfection and were processed for flow cytometry as described above.

BMMC (1 X 10⁶ cells/ml) were treated with the PPARγ agonist GW1929 (10 µM) or troglitazone (5 µM), PPARγ antagonist GW9662 (5 µM) or DMSO for 1 hr at 37^oC prior to treatment with the ApoC3-LNPs. Samples were collected at 24 hr post transfection and were processed for flow cytometry as described above.

Trypan blue staining

0.1 X 10⁶ BMMC were incubated with 5 µg plasmid equivalent of LNP’s for 24 hr at 37°C followed by trypan blue staining to measure % viability. Cell numbers were counted on a hemocytometer and analyzed under a light microscope (Leica MiroSystems CMS GmbH, Ernst-Leitz-ste, Model DMi1, China).

β- hexosaminidase assay

BMMC (100,000 cells/treatment) were suspended in HEPES buffer (10 mM HEPES, 137 mM NaCl, 2.7 mM KCl, 0.4 mM Na₂HPO₄.7H₂O, 5.6 mM glucose, 1.8 mM CaCl₂.2H₂O, 1.3 mM MgSO₄.7H₂O, pH 7.4) and treated with 1, 5 or 10 µg/ml ApoC3 for 45 minutes. Degranulation was determined by measuring the amount of β-hexosaminidase released into the supernatants and normalized to the amount of b-hexosaminidase remaining in the cells after the 45 min incubation period. b-hexosaminidase was quantified by measuring the hydrolysis of p-nitrophenyl N-acetyl-β-D-glucosamide (Sigma-Aldrich) in 0.1 M sodium citrate buffer (40 mM citrate, 20 mM Na₂HPO4.7H₂O, 20 mM Na₂HPO₄, pH 4.5) for 60 min at 37^oC. The percentage of β-hexosaminidase release was calculated as a percent of total content. BMMC activated with the calcium ionophore, A23187 (1 µM) was included as a positive control.

RNA extraction and cDNA synthesis

BMMC or MC/9 were treated with the PPARγ agonist GW1929 (10 µM) or troglitazone (5 µM), and antagonist GW9662 (5 µM) or DMSO for 24 hr at 37^oC followed by RNA extraction using the Qiagen RNeasy Mini Kit (Cat# 74106) that employed the on-column DNase (Qiagen RNase- Free DNase Set, Cat# 79254) digestion.

The purity and concentration of the RNA was determined using the Nanodrop One (Thermo Scientific) and cDNA was synthesized using 1 mg of total RNA utilizing the High capacity cDNA reverse transcription kit (4368814, Applied Biosystems).

qPCR

qPCR was performed utilizing 20 ng of cDNA, Fast SYBR Green master mix (438612, Applied Biosystems), gene specific IDT oligonucleotide primers as described in Table 1 and a StepOnePlus real time PCR machine (Applied Biosystems)

Table 1- Intron spanning mouse oligonucleotide primers used in this study.

Gene ID	Gene name	Abbreviation	Forward primer	Reverse primer
NM_001080926	Low density lipoprotein receptor-related protein 8	Lrp8	CATCGTGCCCATAGTGGTAATA	GCTCATCTTCCTCTTCCTCTTC
NM_008084.3	Glyceraldegyde-3-phosphate dehydrogenase	GapDH	GGGTTCCTATAAATACGGACTGC	CCATTTTGTCTACGGGACGA

Protein extraction and quantification

BMMC (1X 10⁶cells) were collected by centrifugation at 500 × g for 10 minutes and the cell pellet was washed once in cold PBS. BMMC were lysed with 100 µl of 1 X RIPA lysis and extraction buffer (PI89900, Thermo Scientific™) containing protease and phosphatase inhibitor cocktail (PPC1010, Sigma-Aldrich). The lysate was gently rocked on a shaker for 60 minutes at 4°C followed by centrifugation at ∼14,000 × g for 15 minutes. The supernatant was utilized for further analysis. The protein concentration was determined by BCA assay (PI23225, Thermo Scientific™, Pierce™ BCA Protein Assay Kit).

Western Blotting

Twenty micrograms of protein from each sample was electrophoresed on Bolt™ 4 to 12%, Bis-Tri Protein Gel (NW04122BOX, Thermo Scientific™, Invitrogen™) and electroblotted onto a nitrocellulose membrane (LC2000, Thermo Scientific™, Invitrogen™). The membrane was blocked with intercept (TBS) blocking buffer (LiCOR Catalog No. 927-60001) for 1 hr at room temperature (RT), and then incubated for 3 hr at RT with antibodies against ApoER2 (ab108208, ABCAM) and β-Actin (5441, Sigma-Aldrich). The membrane was washed three times with TBS buffer and then incubated with IRDye800CW goat anti-rabbit (827-08365, LiCOR) and IRDye680RD goat anti-mouse (926-68170, LiCOR) secondary antibodies for 1 hr at room temperature. The membrane was washed three times with TBS buffer and fluorescence was detected using the LiCOR Odyssey CLX Imaging System.

Statistical analysis

Experiments were conducted at least in triplicate using three independent BMMC or MC/9 cultures started from three animals and values represent mean of n=3, 4 or 5 + standard error of the mean. P values were determined using Student t test and data was analyzed using GraphPad Prism software (https://www.graphpad.com/quickcalcs/ttest1.cfm).

Physicochemical properties of LNP formulations

Cationic lipid-based nanoparticles (LNP) composed of DODMA lipids and a 6.3 Kb (GFP-DODMA-LNP) or 4.7 kb (eGFP-DODMA-LNP) plasmid DNA expressing GFP and enhanced GFP respectively, were synthesized using microfluidic mixing. Another LNP formulation (GFP-Hybrid-LNP) was generated from three different cationic lipids: DODMA, DODAP, DOTAP and encapsulating a 6.3 Kb plasmid DNA expressing GFP (Table 2). The LNP formulations were generated by combining a 1:3 molar ratio of the lipids with the aqueous phase. PicoGreen analysis showed a robust > 71% encapsulation efficiency of the DNA payload for all the formulations (Table 2). Dynamic light scattering (DLS) analysis indicated that the majority of the LNPs in various formulations (such as GFP-DODMA-LNP, eGFP-DODMA-LNP or GFP-Hybrid-LNP) had a Z-average (average diameter) of approximately >127 nm and <190 nm. Moreover, the LNPs generated by microfluidic mixing were homogeneous with a polydispersity index (PDI) measuring close to 0.1. The overall negative or positive zeta potential of the LNP preparations suggest that the particles had an overall net negative or net positive charges respectively on their surface, indicative of net repulsive force between individual LNPs in solution to attain physical stability (Table 2).

Table 2: Physicochemical properties of LNPs and Apo-LNP complex:

Formulation Name and abbreviation	Composition	Ratio of organic to aqueous phase	Z average (nm)	Zeta potential (mV)	PDI	Encapsulation efficiency (%)
GFP-DODMA-LNP (LNP)	DODMA, DOPE, Cholesterol, PEG2000-PE	1:3	127.2-189.3	(-) 4.68	0.105	71.35-97.25
No DNA-DODMA-LNP control	DODMA, DOPE, Cholesterol, PEG2000-PE	1:3	154.6	(-) 3.17	0.139	NA
GFP-Hybrid-LNP (Hy-LNP)	DODMA/DODAP/DOTAP, DOPE, Cholesterol, PEG2000-PE	1:3	161	(-) 7.11	0.087	92
No DNA-Hybrid-LNP control	DODMA/DODAP/DOTAP, DOPE, Cholesterol, PEG2000-PE	1:3	140	(-) 1.44	0.139	NA
eGFP-DODMA-LNP (eGFP-LNP)	DODMA, DOPE, Cholesterol, PEG2000-PE	1:3	136-180.73	(-) 1.67- (+) 18.80	0.107-0.206	88.57-94.5
ApoC3-eGFP-DODMA-LNP	ApoC3+ eGFP-DODMA-LNP	NA	137.9	(-) 7.52	0.103	NA
ApoB-eGFP-DODMA-LNP	ApoB+ eGFP-DODMA-LNP	NA	287.53	(+) 8.95	0.187	NA
ApoE2-eGFP-DODMA-LNP	ApoE2+ eGFP-DODMA-LNP	NA	186.97	(+) 18.33	0.186	NA
ApoE4-eGFP-DODMA-LNP	ApoE4+ eGFP-DODMA-LNP	NA	207.90	(+) 15.90	0.212	NA

Characterization of LNP and Apo-LNP complex formulations using DLS and picogreen analysis: Physicochemical properties ofLNPs weredeterminedas described in the Materials and Methods. For Apo-LNP complexes, 5 µg plasmid equivalent LNPs were incubated with 3 µg ApoC3, ApoB, ApoE2 and ApoE4 overnight at 4ºC followed by DLS analysis.

Cryo TEM analysis (Fig.1A and B) showed that LNPs in all the formulations are “sponge” like mesophase structured particles rather than solid particles. DODMA-LNPs with smaller plasmid DNA (eGFP-DODMA-LNPs with 4.7 kb plasmid DNA, Figure 1D) are denser than those with larger plasmid DNA (GFP-DODMA-LNPs with 6.3 kb plasmid DNA, Figure 1B). Also, LNPs without plasmid DNA have more electron dense core compared to LNPs encapsulating plasmid DNA (Compare images in Fig. 1A-i and ii or Fig, 1B-i and ii).

To evaluate the changes in the structure and physicochemical properties of LNPs in the presence of Apos known to bind lipids, eGFP-DODMA-LNPs were complexed with ApoC3 (since it facilitates LNP internalization, see below). Cryo-TEM analysis showed that the ApoC3 (darker dots, shown by a white arrow in Fig. 1D-i) were entrapped on the lipid surface or mesoporous matrix of the eGFP-DODMA-LNPs, making them appear slightly bigger in size when compared to eGFP-DODMA-LNPs alone. To evaluate if this feature was specific to ApoC3, eGFP-DODMA-LNPs were complexed with ApoB and ApoE2 followed by Cryo-TEM analysis. Each of the Apo-LNP complexes displayed unique structural characteristics (Fig. 1D). Whereas the ApoC3-LNP appear dense with a defined outer edge and electron dense inner core, ApoB-LNP appear less organized outer surface with projections and a less dense core. The ApoE2-LNP were the least organized, similar to balls of long string-like structures and no definitive core structure.

Apolipoprotein C3 facilitates internalization of GFP-DODMA-LNP into BMMC.

Since, Apos are known to bind lipids for facilitating their transport and metabolism in human circulation [9, 24], we tested seven different Apos (Apo A1, B, C3, D, E2, E4 and H) for their ability to facilitate internalization of GFP-DODMA-LNP into BMMC. Highly pure populations of terminally-differentiated BMMC expressing both CD117 (KIT) and FceRI (Fig. 2A-ii) were treated with GFP-DODMA-LNP or Apo-GFP-DODMA-LNPs for 24 hr and the GFP expression was measured by flow cytometry. Transfection efficiency was measured as % GFP positive cells. GFP-DODMA-LNPs were not toxic to BMMCs as determined by trypan blue exclusion assay (Fig. 2C, compare % viability of Cells and LNP). ApoB and ApoC3 significantly enhanced internalization of GFP-DODMA-LNPs into BMMC (Fig. 2B, p<0.05) and ApoC3 gave the best relative transfection efficiency out of all the tested Apos with 12+/- 0.7 % GFP positive cells compared to cells that have been treated with just the GFP-DODMA-LNPs having a background fluorescence of 1.8%. ApoC3 decreased BMMC viability by 30% (Fig. 2C, compare % trypan blue negative cells between LNP and ApoC3+LNP), thus all the flow cytometric analysis only considered cells having a high side scatter (SSC) and forward scatter (FSC) value (gated cells, G1; Fig. 2A-i) which represented the healthy, unaltered cell population.

Apolipoprotein C3 facilitates internalization of GFP-DODMA-LNPs in a concentration-dependent manner.

Since, ApoC3 was the most efficient in facilitating internalization of GFP-DODMA-LNP cargo into BMMC, we determined whether increasing concentrations of ApoC3 would lead to enhanced transgene delivery and expression. When increasing concentrations of ApoC3 (1, 5 and 10 µg) were incubated with GFP-DODMA-LNP, followed by transfection into BMMC, we found that there was a significant increase in % GFP positive cell with 5 and 10 µg of ApoC3 (Fig. 2D, p<0.05) and a concentration-dependent shift of histograms towards right (Fig. 2E).

Apolipoprotein C3 facilitates internalization of GFP-DODMA-LNP into MC/9.

Since BMMC are considered to be an end-stage terminally differentiated myeloid-derived immune cells, we tested the internalization efficiency of GFP-DODMA-LNPs into a rapidly-dividing transformed mouse mast cell line called MC/9. MC/9 are similar to BMMC in that they express FceRI (Fig. 2F-ii). When MC/9 cells were incubated with GFP-DODMA-LNPs for 24 hr, a 14% reduction in cell viability was observed (Fig. 2G). MC/9 cells were treated with GFP-DODMA-LNP or ApoC3-GFP-DODMA-LNPs for 24 hr and the GFP expression was measured by flow cytometry. For analysis purpose, healthy and unaltered cell population having high FSC and SSC (gated cells, G1; Fig. 2F-i) were considered to preclude the fluorescence emitted by dead cells/debris. ApoC3 significantly enhanced transfection efficiency of GFP-DODMA-LNPs into MC/9 to about 12.6+/-0.8% when compared to cells treated with GFP-DODMA-LNP alone as determined by the % GFP positive cells (Fig. 2H) and histogram overlay (Fig. 2I).

Apolipoprotein C3 facilitates internalization of GFP-Hybrid-LNP (composed of DODMA, DOTAP and DODAP lipids) into BMMC.

Next, we tested whether ApoC3 promoted internalization efficiency of GFP-Hybrid-LNP cargo composed of three different cationic lipids (DODMA, DOTAP and DODAB). Trypan blue exclusion assay showed that the GFP-Hybrid-LNP’s reduced BMMC viability by only 4% (Fig. 3A).

BMMC were transfected with GFP-Hybrid-LNPs or Apo-GFP-Hybrid-LNPs for 24 hr and the GFP expression was measured by flow cytometry. Consistent with the observation that ApoB and ApoC3 facilitated the internalization of GFP-DODMA-LNPs, ApoB (4.5%) and ApoC3 (8.6%) significantly increased internalization of GFP-Hybrid-LNP into BMMC as determined by an increase in the % GFP positive cells (Fig. 3B, p<0.05) when compared to cells treated with just the GFP-Hybrid-LNP (2.6%).

Since the overall transfection efficiency of GFP-DODMA-LNPs (Fig. 2B, 10.2%) was greater than that observed with the GFP-Hybrid-LNPs (Fig. 3B, 5.96%), subsequent experiments were performed with GFP-DODMA-LNPs.

Apolipoprotein C3 does not activate BMMC degranulation

The results shown so far suggest that ApoC3 facilitates internalization of LNP composed of different cationic lipids (DODMA DODAP or DOTAP) into BMMC. ApoC3 has been shown to activate monocytes [25, 26]. Mast cells release granules when activated by receptor-dependent and receptor-independent stimuli [27]. Hence, BMMC were treated with ApoC3 (1,5 and 10 µg/ml) and their degranulation was measured. As shown in Fig. 3C, none of the concentrations of ApoC3 resulted in BMMC degranulation when compared to the A23187, a calcium ionophore that activates mast cell degranulation by increasing the intracellular calcium concentration.

Apolipoprotein C3-mediated GFP-DODMA-LNP internalization is enhanced when BMMC were pre-treated with inhibitors of actin polymerization

The cytoskeletal network plays a prominent role in the lipid-mediated delivery of non-viral vectors to intracellular compartments [28]. To evaluate the role of the intracellular trafficking network in the internalization of GFP-DODMA-LNPs, we pre-treated the cells with various inhibitors of the endocytic pathway followed by transfection with GFP-DODMA-LNP or ApoC3-GFP-DODMA-LNP. There was a significant increase in transfection efficiency as determined by % GFP positive cells when BMMC were pre-treated with latrunculin B and cytochalasin B, specific inhibitors of actin polymerization or a combination of these two inhibitors along with 3-methyadenine (phosphoionositide 3-Kinase inhibitor) and chloroquine (endolysosomal pH inhibitor) (Fig. 4A).

Apolipoprotein C3-mediated internalization of GFP-DODMA-LNP cargo into BMMC is independent of the payload size.

Previous studies have shown that payload size does not affect the physicochemical properties of the lipoplex, but modulates gene transfer efficiency [29]. Hence, we determine whether the payload size would affect ApoC3-mediated internalization of the GFP-DODMA-LNP into BMMC. We constructed eGFP-DODMA-LNPs that encapsulated a smaller plasmid DNA (4.7 Kb instead of the 6.3 Kb plasmid DNA encapsulated in GFP-DODMA-LNP). Trypan blue exclusion assay showed that eGFP-DODMA-LNP’s were biocompatible with BMMCs with negligible loss in viability after 24 hr of treatment (Fig. 4B). BMMC were treated with eGFP-DODMA-LNP or ApoC3-eGFP-DODMA-LNPs for 24 hr and eGFP expression was measured by flow cytometry. ApoC3 significantly enhanced internalization of eGFP-DODMA-LNPs into BMMC (Fig. 4C) when compared to BMMC treated with eGFP-DODMA-LNP alone. A comparison of the relative increase in ApoC3 mediated transfection efficiency of GFP-DODMA-LNPs (Fig. 2B, 10.2%) to that of eGFP-DODMA-LNPs (Fig. 4C, 2.12%), showed that the former was internalized relatively better despite its larger payload size (6.3 Kb as compared to 4.7 Kb). These results collectively suggest that ApoC3 mediated potentiation of DODMA-LNP cargo delivery seems to be independent of the plasmid DNA payload size.

PPARγ agonists inhibit Apolipoprotein C3-mediated internalization of eGFP-DODMA-LNP into BMMC

Peroxisome proliferator-activated receptor gamma (PPARγ) is a nuclear transcription factor that modulates the expression of low-density lipoprotein receptor (LDLR) that is crucial in the transport and metabolism of low-density lipoprotein (LDL) [30]. Hence, we evaluated the effects of PPARγ activation on ApoC3-mediated eGFP-DODMA-LNP internalization into BMMC. Our results showed that pre-treatment of BMMC with PPARγ agonists GW1929 and troglitazone, led to a significant reduction in internalization efficiency (Fig. 4D). However, the PPARγ antagonist GW1929 had no effect on ApoC3-mediated eGFP-DODMA-LNP cargo internalization.

PPARγ agonists reduce Lrp8 mRNA expression and ApoER2 protein expression

PPARγ regulates the expression of low-density lipoprotein receptors [30-32] such as apolipoprotein E receptor 2 (ApoER2). Previous microarray analysis suggested that BMMCs may express low density lipoprotein receptor related protein 8 (Lrp8) mRNA [33] that encodes ApoER2. Therefore, the effect of the PPARγ agonists and antagonist on Lrp8 and ApoER2 expression by BMMC and MC/9 was measured. PPARγ agonists troglitazone and GW1929 significantly reduced expression of Lrp8 mRNA by BMMCs compared to DMSO control (Fig. 5A) but there was no significant decrease in ApoER2 protein expression (Fig. 5B-i and ii). Similarly, PPARγ agonists and antagonist decreased both Lrp8 mRNA (C) as well as ApoER2 protein (D-i and ii) expression by MC/9 when compared to DMSO.

Apos are regulatory proteins that bind lipids to form lipoproteins and are important in the assembly, transport and metabolism of lipoproteins in tissues by binding to membrane lipoprotein receptors [9]. Apos also maintain lipoprotein structure as well as serve as activators or inhibitors of enzymes involved in lipoprotein metabolism [24]. There are several different types of Apos that play distinct roles in lipid transport and metabolism to specific cell types throughout the human body [9]. Cationic lipid-based surface engineering is most effective in enhancing the properties of nanospheres for gene delivery [34]. The integration of Apo targeted nanoparticles as pharmaceutical carriers opens new diagnostic and therapeutic avenues in nanomedicine [35]. The intrinsic characteristic of Apos to bind lipids and facilitate their transport across different cell types in human circulation offers a very exciting tool for nanobiotechnologists.

In this study we tested seven Apos (Apo A1, B, C3, D, E2, E4 and H) for their ability to facilitate internalization of a DNA payload encapsulated in a cationic LNP into end stage terminally differentiated BMMCs. Cell cycle plays a prominent role in endocytosis and internalization primarily occurs during the proliferative stages (S+G2/M) of the cell cycle [36]. Since BMMCs are partially quiescent, only a small % of fully differentiated cells are expected to be in the proliferative stages of the cell cycle which would make them extremely difficult to manipulate genetically [23]. However, when cationic LNPs were complexed particularly with ApoC3, BMMCs were genetically modified by expressing significantly higher levels of the reporter GFP plasmid DNA (Fig. 2, 3). LNP structures were subjected to differential morphological changes when they were complexed with different Apos such as ApoC3 (~9 kDa), ApoB (~500 kDa), ApoE2 (~34 kDa) (Fig. 1C and D). These results suggest that different Apos bind or associate with the LNP differentially. Changes in LNP structure are associated with different biological outcomes as different Apos behave differently when complexed with LNPs (Fig. 2 and Fig. 3).

Our results show that the 6.3 Kb plasmid DNA payload encapsulated within DODMA (GFP-DODMA-LNP) and Hybrid-LNPs (GFP-Hybrid-LNP) were unable to achieve significant transfection above background fluorescence (Fig. 2B and 3B, compare % GFP positive cells of “Cells” with that of “GFP-LNP” and “GFP-Hy-LNP” respectively). However, when the size of the DNA payload was reduced to 4.7 Kb, transfection efficiency was slightly improved when compared to the background fluorescence of untreated BMMC (Fig. 4C, compare % GFP positive cells of “Cells” and “eGFP-LNP”).

When LNP preparations were incubated with different types of Apos, in particular ApoC3, transfection efficiency was significantly enhanced (Fig. 2B, 2H, 3B, 4C). ApoC3 promoted internalization of a 6.7 Kb plasmid DNA encapsulated in two distinct LNP preparations made up of DODMA or a combination of DODMA, DOTAP and DODAB lipids (Fig. 2B, 3B; compare % GFP positive cells of GFP-LNP or GFP-Hy-LNP with that of ApoC3+GFP-LNP and ApoC3+GFP-Hy-LNP respectively). Hence, ApoC3 mediated potentiation of internalization of the 6.7 Kb plasmid DNA payload seems to be independent of the composition of lipids within the LNP structure.

ApoC3 promoted internalization of GFP-DODMA-LNPs in a concentration-dependent manner (Fig. 2D, 2E), suggesting that binding and hence transport of the GFP-DODMA-LNP cargo into BMMC enhances with increasing concentration of ApoC3. ApoC3 also effectively increased transport of the 6.3 Kb DNA payload into a rapidly dividing mouse mast cell line MC/9 (Fig. 2H and 2I). MC/9 is an IL-3-dependent mouse MC line that expresses FceRI [37], but low levels of KIT/CD117 (Fig. 2F-ii). The MC/9 cells have often been used as model of mouse mast cells because they grow rapidly and are capable of responding to antigen activation through FceRI by producing cytokines and chemokines such as IL-6 and TNF. Unlike BMMC, MC/9 cells do not possess mature granules that contain pre-stored mediators such as histamine and therefore, when MC/9 are activated, they do not degranulate like BMMC. By comparing ApoC3-LNP internalization by these two cell types, it is possible to distinguish the behaviour of a mast cell model with a relatively mature intracellular organelle structure (BMMC) and one with a less complex structure (MC/9). Furthermore, MC/9 divide rapidly while mature BMMC divide infrequently providing important information as to whether this approach is cell division dependent. Our data suggest that ApoC3 facilitated the internalization of DODMA-LNPs into both rapidly dividing MC/9 and quiescent BMMCs, suggesting that cells do not need to be rapidly dividing in order to be transfected with our approach.

Although ApoC3 has been shown to activate other immune cell types, possibly through toll-like receptors [25, 26], ApoC3 did not activate BMMC degranulation, suggesting that ApoC3 may be immunologically inert to BBMC (Fig. 3D). This is an important and necessary characteristic of any LNP approach directed to mast cells.

ApoC3 is a 79 amino acid glycopeptide having a molecular weight of 8.8 KDa, that contains two amphipathic helices [38]. It is possible that ApoC3 binds or intercalates within the LNP structure via utilising its amphipathic helices. It is synthesized mostly in the liver and to a lesser extent in intestine and its expression is chiefly regulated at the transcriptional level [39]. ApoC3 plays a central role in promoting the transport of different types of lipoproteins in human body such as very low-density lipoproteins (VLDL, 30-80 nm), intermediate density lipoprotein (IDL, 25-35 nm), chylomicrons (75-1200 nm) and high-density lipoproteins (HDL, 5-12 nm) [24, 40].

Although, ApoC3 was consistently found to promote internalization of GFP-DODMA-LNP cargo into BMMC, we observed that there were differences in overall transfection efficiency from different preparations of LNP (compare transfection efficiency of ApoC3-GFP-LNP in Fig. 2B and Fig. 4A). This could be attributed to slight differences in encapsulation efficiency between different preparations. Regardless, it is noteworthy that even though the transfection efficiency seems to vary between independent experimental sets, the overall trend in ApoC3-mediated increase in GFP-DODMA-LNP cargo delivery is consistent.

Lipid mediated delivery of DNA payloads can be hindered by both extracellular and intracellular barriers that can have a significant impact on transfection efficiency [28]. The involvement of actin and microtubules in the intracellular dynamics of cationic liposomes have been studied extensively [41, 42]. Our data show that pre-treatment of BMMC with inhibitors of actin polymerization (latrunculin B and cytochalasin B) significantly increased transfection efficiency (Fig. 4A). Cationic lipid-based nanoparticles are thought to exploit the endocytic pathway [1-3] for internalization and the actin cytoskeleton plays a major role in intracellular trafficking and fusion of endosomes to lysosomes that form the endolysosomal compartments [43-45], where the internalized payload is often degraded due to the acidic pH conditions. Only a few DNA molecules can escape endolysosomal degradation before entering the nucleus for transcription. Our results suggest that when actin polymerization is impaired, the LNPs are less frequently shuttled to the endolysosomal compartments and this increases their chances of escape from endolysosomes to allow for the transcription of the encapsulated DNA. Our results collectively suggest that DODMA-LNPs primarily utilize an actin-dependent endocytic pathway for internalizing into BMMC that is largely independent of phosphoionositide 3-kinase and alterations in endolysosomal pH.

PPARγ is highly expressed in adipose tissue and plays a regulatory role in lipid metabolism by controlling the expression of an array of genes involved in lipid transport and metabolism in adipocytes [46-49]. PPARγ regulates the expression of low-density lipoprotein receptors (LDLR) that comprise a group of endocytic receptors (such as VLDLR, ApoER2/Lpr8, LRP1, LRP2, LRP6) on cell surface that bind and internalize lipoprotein ligands containing LDL, VLDL, IDL and chylomicrons [30-32]. ApoC3 plays a central role in promoting the transport of VLDL [24, 40]. In macrophages, another type of immune cells, apolipoprotein E receptor 2 (ApoER2) also known as low-density lipoprotein receptor-related protein 8 (Lrp8), a type of LDLR, limits PPARγ expression [50]. BMMCs have been shown to express Lrp8 mRNA [33]. Our results show that activation of PPARγ using agonists GW1929 and troglitazone, inhibits ApoC3-mediated internalization of LNP cargo into BMMC (Fig. 4D). Since PPARγ functions as a transcription regulator, we hypothesized that activation of PPARγ in BMMC may alter surface expression of lipid receptors such as ApoER2 and that could, in turn, inhibit ApoC3 mediated internalization of eGFP-DODMA-LNP cargo. PPARγ agonists troglitazone and GW1929 decreased Lrp8 mRNA expression by BMMC (Fig. 5A) and Lrp8 mRNA and ApoER2 protein expression by MC/9 (Fig. 5C and D). The PPARγ antagonist GW9662 decreased Lrp8 mRNA in both BMMC (Fig. 5A) and MC/9 (Fig. 5C), although did not have an effect on ApoER2 expression by MC/9 (Fig. 5D). It is possible that GW9662 may have non-specific effects on the PPARγ pathway that may interfere with Lrp8 gene expression [51]. Also, However, since BMMC express substantially less ApoER2 protein than MC/9 it is also possible that the effects of the PPARγ agonists are difficult to detect by this technique (Fig. 5B). It is likely that only a small subpopulation of BMMC (about 6-12%) are responsive to ApoC3-mediated LNP transfection and hence small changes in ApoER2 protein levels might be difficult to detect using western blot analysis of the entire population and even qPCR may be missing the full extent of changes in Lrp8 expression when observed in the whole cell population (Fig. 5A). A more cell-specific approach, using either fluorescent activated cell sorting (FACS) or single cell PCR (scPCR) would be more informative and will be future directions of this research. However, based on these data it is possible to speculate that ApoER2 which may impact ApoC3-LNP internalization.

Our results show that ApoC3 can play an important role in facilitating the binding and transport of cationic LNPs into BMMC and MC/9. Moreover, since ApoC3 does not activate BMMC degranulation, their immunologically inert nature would make them an attractive candidate for promoting transport into MC. MCs provide a convenient and effective target for anti-inflammatory therapeutic strategies due to their role in inflammatory responses, particularly in the lung and skin. Hence, based on our results, we suggest that functionalizing DODMA-LNPs with ApoC3 and co-encapsulating actin cytoskeletal inhibitors along with the payload might help achieve better transfection efficiency in difficult to genetically manipulate MCs and hence can be utilized towards development of cell directed therapeutics. Altogether, our studies reveal an important role of ApoC3 in facilitating internalization of LNPs into MCs that can have an impact on fabrication of novel nanotherapies against inflammatory diseases directed to skin or lungs.

Bone marrow derived mast cells -BMMC, Mast cell-MC, Apolipoprotein-Apo, Lipid nanoparticle-LNP, peroxisome proliferator-activated receptor gamma-PPARγ, Apolipoprotein E receptor 2- ApoER2, Low density lipoprotein receptor-related protein 8- Lrp8

Ethics approval and consent to participate- Yes

Consent for publication- Yes

Availability of Data and materials- The dataset

Availability of Data and materials- The datasets supporting the conclusions of this article are included within the article and can be provided by Dr. Marianna Kulka at [email protected] upon reasonable request.

supporting the conclusions of this article are included within the article and can be provided by Dr. Marianna Kulka at [email protected] upon reasonable request.

Competing interests- None

Funding- This work was supported by funding from National Research Council Canada.

Author’s contribution- SBA, FW, HQ and MK designed and performed the experiments and analyzed the data. SBA wrote the original draft of the manuscript; MK, FW and HQ edited and approved the final version of the manuscript. MK conceived of the project design, obtained funding and acquired all necessary safety approvals.

Acknowledgements- We thank Bradley Smith, Valentyna Semenchenko, Narcy Arizmendi, Ashley Wagner, Peter Sony and Mickie Weibe for their technical support.

Conflict of interest- Authors declare no conflict of interest

Wahane, A., et al., Role of Lipid-Based and Polymer-Based Non-Viral Vectors in Nucleic Acid Delivery for Next-Generation Gene Therapy. Molecules, 2020. 25(12).
Guevara, M.L., S. Persano, and F. Persano, Lipid-Based Vectors for Therapeutic mRNA-Based Anti-Cancer Vaccines. Curr Pharm Des, 2019. 25(13): p. 1443-1454.
Xue, H.Y., et al., Lipid-Based Nanocarriers for RNA Delivery. Curr Pharm Des, 2015. 21(22): p. 3140-7.
Ramamoorth, M. and A. Narvekar, Non viral vectors in gene therapy- an overview. J Clin Diagn Res, 2015. 9(1): p. Ge01-6.
Duguay, B.A., K.W.-C. Huang, and M. Kulka, Lipofection of plasmid DNA into human mast cell lines using lipid nanoparticles generated by microfluidic mixing. Journal of Leukocyte Biology, 2018. 104(3): p. 587-596.
Basiouni, S., H. Fuhrmann, and J. Schumann, High-efficiency transfection of suspension cell lines. Biotechniques, 2012. 53(2).
Ebert, O., et al., Lymphocyte apoptosis: induction by gene transfer techniques. Gene Ther, 1997. 4(4): p. 296-302.
Cotten, M. and M. Saltik, Intracellular delivery of lipopolysaccharide during DNA transfection activates a lipid A-dependent cell death response that can be prevented by polymyxin B. Hum Gene Ther, 1997. 8(5): p. 555-61.
Dominiczak, M.H. and M.J. Caslake, Apolipoproteins: metabolic role and clinical biochemistry applications. Ann Clin Biochem, 2011. 48(Pt 6): p. 498-515.
Koch, M., et al., Apolipoproteins and their subspecies in human cerebrospinal fluid and plasma. Alzheimers Dement (Amst), 2017. 6: p. 182-187.
Getz, G.S. and C.A. Reardon, Apoprotein E as a lipid transport and signaling protein in the blood, liver, and artery wall. J Lipid Res, 2009. 50 Suppl(Suppl): p. S156-61.
Randolph, G.J. and N.E. Miller, Lymphatic transport of high-density lipoproteins and chylomicrons. J Clin Invest, 2014. 124(3): p. 929-35.
Owen, D.M., et al., Apolipoprotein E on hepatitis C virion facilitates infection through interaction with low-density lipoprotein receptor. Virology, 2009. 394(1): p. 99-108.
Jiang, J., et al., Hepatitis C virus attachment mediated by apolipoprotein E binding to cell surface heparan sulfate. J Virol, 2012. 86(13): p. 7256-67.
Wrensch, F., et al., Hepatitis C Virus (HCV)-Apolipoprotein Interactions and Immune Evasion and Their Impact on HCV Vaccine Design. Front Immunol, 2018. 9: p. 1436.
Meunier, J.C., et al., Apolipoprotein c1 association with hepatitis C virus. J Virol, 2008. 82(19): p. 9647-56.
Hu, B., et al., Thermostable ionizable lipid-like nanoparticle (iLAND) for RNAi treatment of hyperlipidemia. Sci Adv, 2022. 8(7): p. eabm1418.
Shamaeizadeh, N., et al., Glutathione targeted tragacanthic acid-chitosan as a non-viral vector for brain delivery of miRNA-219a-5P: An in vitro/in vivo study. Int J Biol Macromol, 2022. 200: p. 543-556.
Huang, Y., et al., Ionizable liposomal siRNA therapeutics enables potent and persistent treatment of Hepatitis B. Signal Transduct Target Ther, 2022. 7(1): p. 38.
Zhang, Z.A., et al., Novel brain-targeted nanomicelles for anti-glioma therapy mediated by the ApoE-enriched protein corona in vivo. J Nanobiotechnology, 2021. 19(1): p. 453.
Kulka, M. and A.D. Befus, The dynamic and complex role of mast cells in allergic disease. Arch Immunol Ther Exp (Warsz), 2003. 51(2): p. 111-20.
Alam, S.B. and M. Kulka, Internalization of benzylisoquinoline alkaloids by resting and activated bone marrow-derived mast cells utilizes energy-dependent mechanisms. Inflamm Res, 2022.
Alam, S.B. and M. Kulka, Is Clathrin Involved in Internalization of The Small Molecule Berberine by Primary Mouse Mast Cells? Archives of microbiology and Immunology, 2022. 6(2): p. 141-148
Zewinger, S., et al., Apolipoprotein C3 induces inflammation and organ damage by alternative inflammasome activation. Nat Immunol, 2020. 21(1): p. 30-41.
Gong, T. and R. Zhou, ApoC3: an 'alarmin' triggering sterile inflammation. Nat Immunol, 2020. 21(1): p. 9-11.
Moon, T.C., A.D. Befus, and M. Kulka, Mast cell mediators: their differential release and the secretory pathways involved. Front Immunol, 2014. 5: p. 569.
Coppola, S., et al., The role of cytoskeleton networks on lipid-mediated delivery of DNA. Ther Deliv, 2013. 4(2): p. 191-202.
Kreiss, P., et al., Plasmid DNA size does not affect the physicochemical properties of lipoplexes but modulates gene transfer efficiency. Nucleic Acids Res, 1999. 27(19): p. 3792-8.
Shende, V.R., A.B. Singh, and J. Liu, A novel peroxisome proliferator response element modulates hepatic low-density lipoprotein receptor gene transcription in response to PPARδ activation. Biochem J, 2015. 472(3): p. 275-86.
Tao, H., et al., Peroxisome proliferator-activated receptor-gamma regulates the expression and function of very-low-density lipoprotein receptor. Am J Physiol Endocrinol Metab, 2010. 298(1): p. E68-79.
Krogsdam, A.M., et al., Nuclear receptor corepressor-dependent repression of peroxisome-proliferator-activated receptor delta-mediated transactivation. Biochem J, 2002. 363(Pt 1): p. 157-65.
Polakovicova, I., et al., Multiple regulatory roles of the mouse transmembrane adaptor protein NTAL in gene transcription and mast cell physiology. PLoS One, 2014. 9(8): p. e105539.
Bose, R.J., et al., Influence of cationic lipid concentration on properties of lipid-polymer hybrid nanospheres for gene delivery. Int J Nanomedicine, 2015. 10: p. 5367-82.
Almer, G., et al., Lipoprotein-Related and Apolipoprotein-Mediated Delivery Systems for Drug Targeting and Imaging. Curr Med Chem, 2015. 22(31): p. 3631-51.
Hinze, C. and E. Boucrot, Endocytosis in proliferating, quiescent and terminally differentiated cells. J Cell Sci, 2018. 131(23).
Kurosaki, T., et al., The beta subunit of the Fc epsilon RI is associated with the Fc gamma RIII on mast cells. J Exp Med, 1992. 175(2): p. 447-51.
Gangabadage, C.S., et al., Structure and dynamics of human apolipoprotein CIII. J Biol Chem, 2008. 283(25): p. 17416-27.
Zannis, V.I., et al., Transcriptional regulatory mechanisms of the human apolipoprotein genes in vitro and in vivo. Curr Opin Lipidol, 2001. 12(2): p. 181-207.
Mahley, R.W., et al., Plasma lipoproteins: apolipoprotein structure and function. J Lipid Res, 1984. 25(12): p. 1277-94.
Hasegawa, S., N. Hirashima, and M. Nakanishi, Microtubule involvement in the intracellular dynamics for gene transfection mediated by cationic liposomes. Gene Ther, 2001. 8(21): p. 1669-73.
Wang, L. and R.C. MacDonald, Effects of microtubule-depolymerizing agents on the transfection of cultured vascular smooth muscle cells: enhanced expression with free drug and especially with drug-gene lipoplexes. Mol Ther, 2004. 9(5): p. 729-37.
Mooren, O.L., B.J. Galletta, and J.A. Cooper, Roles for actin assembly in endocytosis. Annu Rev Biochem, 2012. 81: p. 661-86.
Qualmann, B., M.M. Kessels, and R.B. Kelly, Molecular links between endocytosis and the actin cytoskeleton. J Cell Biol, 2000. 150(5): p. F111-6.
Smythe, E. and K.R. Ayscough, Actin regulation in endocytosis. J Cell Sci, 2006. 119(Pt 22): p. 4589-98.
Tontonoz, P. and B.M. Spiegelman, Fat and beyond: the diverse biology of PPARgamma. Annu Rev Biochem, 2008. 77: p. 289-312.
Lehrke, M. and M.A. Lazar, The many faces of PPARgamma. Cell, 2005. 123(6): p. 993-9.
Desvergne, B. and W. Wahli, Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev, 1999. 20(5): p. 649-88.
Frohnert, B.I., T.Y. Hui, and D.A. Bernlohr, Identification of a functional peroxisome proliferator-responsive element in the murine fatty acid transport protein gene. J Biol Chem, 1999. 274(7): p. 3970-7.
Waltmann, M.D., et al., Apolipoprotein E receptor-2 deficiency enhances macrophage susceptibility to lipid accumulation and cell death to augment atherosclerotic plaque progression and necrosis. Biochim Biophys Acta, 2014. 1842(9): p. 1395-405.
Majeed, Y., et al., Rapid and contrasting effects of rosiglitazone on transient receptor potential TRPM3 and TRPC5 channels. Mol Pharmacol, 2011. 79(6): p. 1023-30.

No competing interests reported.

RawdataforWesternblot.pdf

Download PDF

Journal Publication

published 09 Jan, 2023

Read the published version in Scientific Reports →

Editorial decision: Major revision
26 Sep, 2022
Reviews received at journal
11 Sep, 2022
Reviewers agreed at journal
08 Sep, 2022
Reviewers invited by journal
05 Sep, 2022
Editor assigned by journal
05 Sep, 2022
Editor invited by journal
31 Aug, 2022
Submission checks completed at journal
31 Aug, 2022
First submitted to journal
18 Aug, 2022

You are reading this latest preprint version

Apolipoprotein C3 facilitates internalization of cationic lipid nanoparticles into terminally differentiated bone marrow-derived mouse mast cells

Status:

Journal Publication

Version 1

Abstract

Figures

Highlights

Introduction

Materials And Methods

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1