7-Geranyloxcycoumarin enhances radiosensitivity in human prostate cancer cells

doi:10.21203/rs.3.rs-1979971/v1

Download PDF

Research Article

7-Geranyloxcycoumarin enhances radiosensitivity in human prostate cancer cells

https://doi.org/10.21203/rs.3.rs-1979971/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 22 May, 2023

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background: Prostate cancer is the second most prevalent and the sixth deadliest cancer among men worldwide. To improve the efficacy of radiotherapy on prostate cancer cells, we investigated the apoptosis-inducing effects of ionizing radiation (IR) in combination with auraptene (AUR).

Methods and Results: PC3 cells were pretreated with various concentrations of the synthesized AUR and then were exposed to IR. After recovery, the viability of cells was determined by alamarBlue assay. Flow cytometric analysis with annexin V and propidium iodide was performed to assess apoptosis induction. Cell viability assay indicated that the toxicity of IR was enhanced by AUR, which was also confirmed by an increased number of apoptotic cells. The expression of P53, BAX, BCL2, GATA6, and CCND1 was analyzed by quantitative polymerase chain reaction (qPCR). qPCR demonstrated significant overexpression of P53 and BAX, while the expression of BCL2, GATA6, and CCND1 was significantly downregulated.

Conclusion: These findings suggest that AUR is able to improve the apoptosis-inducing effects of IR in prostate cancer cells. Thus, this combinatorial treatment could be considered as a potential approach for further investigations.

Anticancer

Auraptene

Coumarin

Ionizing radiation

Natural compound

Prostate cancer

Prostate cancer with an estimated 1,276,000 registered cancer cases and 359,000 cancer related deaths in 2018 is considered the second most prevalent neoplasm and the sixth cause of cancer related deaths among men worldwide [1].

Although using ionizing radiation (IR) is an effective strategy for the treatment of localized solid tumors [2, 3], utilization of IR as a single modality treatment is accompanied by a range of side effects such as fatigue, distress, anxiety, and depression [4]. Another obstacle in the field of cancer radiotherapy is the limited capacity of adjacent healthy tissues to toleration of IR. Thus, designing new methods to maximize cancer cell killing efficiency at the lowest doses of IR along with the least amounts of injuries to adjacent healthy tissues is desired [5].

Natural products with preventive and anticancer properties [6] are potential candidates for reducing radiotherapy-induced side effects [7]. These phytochemicals are able to interfere with different mechanisms of cancer, such as cell proliferation, differentiation, angiogenesis, apoptosis, and metastasis [8]. Coumarins are a group of natural compounds possessing antitumor activities through inhibition of growth and proliferation of a variety of cancer cells at low concentrations, which makes them potential candidates to be used as adjuvant therapies [9]. Auraptene (AUR), also known as 7-geranyloxycoumarin, is a coumarin with the ability to exert anticancer effects by interfering with various signaling pathways related to cytokines, growth factors, or apoptosis (Fig. 1) [10]. Also, in two distinct studies conducted by Salari et al. [11] and Movaffagh et al. [12] it was observed that AUR potentiated the therapeutic effect of IR against cancer cells.

Considering the anticancer properties of AUR and previous reports on AUR + IR combination therapy, we hypothesized that AUR could enhance the anticancer efficacy of IR against human prostate cancer PC3 cells. In this study, we investigated the effects of AUR and AUR in combination with IR on the viability of cells and the induction of apoptosis by alamarBlue assay and flow cytometry, respectively. Furthermore, the expression of genes that are involved in the path of apoptosis induction was analyzed by quantitative polymerase chain reaction (qPCR).

2.1. Synthesis of AUR

AUR synthesis was carried out through a reaction between 7‑hydroxycoumarin (1 M) and trans geranyl bromide (1.5 M) in the presence of 1,8‑diazabicyclo (5.4.0) undec‑7‑ene (2 M), as previously described [13]. In order to purify the synthesized AUR, Column chromatography (petroleum ether/ethyl acetate 9:1 v/v) was performed (mp = 62.7°C–63.4°C). ¹H and ¹³C NMR were used to confirm the AUR structure. Dimethyl sulfoxide (DMSO) (Merck, Germany) was used as a solvent to prepare different concentrations of AUR. Prepared solutions were kept at -20 ^⸰C and were diluted with a complete culture medium before use. (The final amount of DMSO was equal to 0.4% v/v after dilution).

2.2. Cell culture

Human prostate cancer cell line PC3 was purchased from Pasteur institute of Iran (Tehran, Iran). Cells were maintained in RPMI 1640 medium (Biowest, France) supplemented with 10% fetal bovine serum (Biowest, France) and 1% penicillin-streptomycin (Biowest, France). Cells were incubated at 37 ^⸰C in a humidified environment of 95% air and 5% CO2.

2.3. Cell viability assay

The cell viability assay was performed according to the following procedure. First, cells were cultured in 96-well plates and incubated overnight. Then, for single administration of AUR, cells were treated with various concentrations of AUR (5, 10, 20, 40, or 80 µM) and incubated for 48, 72, 96, 120, or 144 h as distinguished groups. For AUR + IR combination therapy, cells were treated with 20 or 40 µM of AUR for 24, 48, or 72 h and then were exposed to a variety of IR doses (2, 4, or 6 Gy) followed by 72 h recovery. Untreated cells and wells with no cells were utilized as negative control and blank, respectively. To evaluate the cell viability, alamarBlue reagent (Sigma-Aldrich, Germany) was utilized. AlamarBlue solution (0.01 mg/ml) was added to each well (18µL/well) followed by 3 h of incubation. The absorbance of all wells was measured by the Elisa reader instrument (Biotek, USA) at a wavelength of 570 nm. Finally, cell viability values were calculated based on the obtained optical density (OD) by the following equation:

Cell viability (%) = 100 – [((OD _treat – OD _untreated) / (OD _blank - OD _untreated)) × 100]

2.4. Flow cytometry for apoptosis detection

Upon single or combined administration of AUR and IR, apoptosis induction was detected. To do so, cells were trypsinized, collected, and centrifuged to remove the supernatant. The collected cells were washed with chilled phosphate buffered saline (PBS) to eliminate trypsin, completely. Fluorescein isothiocyanate (FITC)-Annexin V apoptosis detection kit (MabTag’s, Germany) was used according to the manufacturer’s protocol, which is described as follows: The binding buffer (90 µL) was added to the cell pellet, FITC/Annexin-V (5 µl) and propidium iodide (PI) (5 µl) were added to the suspension and incubated for 20–30 min. Finally, cells were resuspended in 200 µl of annexin V binding buffer and assessed by BD FACS-Calibur flow cytometer to measure the fluorescence intensity of samples.

2.5. Real time PCR for gene expression evaluation

Total RNA was collected from all experimental groups using an RNA extraction kit (Denazist Asia, Iran) based on the manufacturer’s protocols. First strand cDNA synthesis was carried out using cDNA synthesis kit (Parstous, Iran) according to the manufacturer’s instructions. The fidelity of amplified cDNAs was validated by PCR using TBP primers (Table 1). The Rotor-Gene 6000 detection system (Qiagen, Germany) was then used to perform qPCR for P53, BAX, BCL2, GATA6, and CCND1 using SYBR green mix and primers listed in Table 1, with PCR cycling conditions at 95°C for 2 min [95°C for 15 sec, 58°C for 30 sec, and 72°C for 30 sec] (38 cycles).

Table 1

Primer sequences used for amplification of *TBP*, *P53*, *BCL2*, *BAX*, *CCND1*, and *GATA6* by qPCR
Gene name	Gene symbol	5’→3’ Forward primer	5’→3’ Reverse primer	Product size (bp)
TATA-Box Binding Protein	TBP	ACAACAGCCTGCCACCTTA	GAATAGGCTGTGGGGTCAGT	120
P53	P53	GTTCCGAGAGCTGAATGAGG	TTATGGCGGGAGGTAGACTG	123
B-Cell lymphoma 2	BCL2	GATGACTGAGTACCTGAACCG	CAGAGACAGCCAGGAGAAATC	124
BCL2-Associated X Protein	BAX	GGACGAACTGGACAGTAACATGG	GCAAAGTAGAAAAGGGCGACAAC	150
Cyclin D1	CCND1	TGAAGGAGACCATCCCCCTG	TGTTCAATGAAATCGTGCGG	151
GATA Binding Protein 6	GATA6	GCCAACTGTCACACCACAAC	AGTTGGAGTCATGGGAATGG	125

2.6. Statistical analysis

GraphPad Prism® 7.01 (GraphPad Software, San Diego, CA, USA) was used to process the data. The one-way ANOVA analysis was used to compare the results of multigroup experiments with more than two groups. The data are presented as the mean ± standard deviation (mean ± SD). Statistically, P value < 0.05 was considered a significant difference.

3.1. AUR enhanced proliferation inhibitory effects of IR on PC3 cells

To investigate the proliferation inhibitory effects of AUR and AUR + IR combination against PC3 cells, the viability of cells was evaluated using alamarBlue assay. Although results revealed that AUR reduced cell viability in all treatment groups in a time-and concentration-dependent manner, a significant (P < 0.01) cell viability reduction was only observed in groups that were treated with 80 µM AUR (Fig. 2a). Assessment of cell viability upon combinatorial treatment with AUR + IR revealed a substantial increase in the toxicity of applied IR in almost all groups as compared to the control samples treated with 0.4% DMSO + 2, 4, or 6 Gy. In particular, cell death was significantly (P < 0.0001) increased when cells were treated with 40 µM AUR for 48 h before being exposed to 4 Gy of IR (Fig. 2b). Figure 3 highlights the morphology of PC3 cells in different groups.

3.2. AUR combined with IR enhanced apoptosis induction

Results of flow cytometry indicated that single administration of AUR led to 73%, 10.7%, and 16.2% of alive, early apoptotic, and late apoptotic cells, respectively. In the case of the AUR + IR combinatorial treatment, 60.7% of cells remained alive while 5.87% and 31% of cells underwent early and late apoptosis, respectively. We also evaluated the percentages of alive and apoptotic cells in other treatment groups, as shown in Fig. 4.

3.3. AUR and IR combinatorial effects on expression of apoptosis related genes

Results of qPCR indicated that the expression of P53 in both AUR and IR single-treatment groups was increased. However, the most significant (P < 0.0001) increase in P53 expression occurred due to AUR + IR combination therapy. Although expression of BAX did not increase upon treatment with either AUR or IR, BAX was significantly (P < 0.0001) up-regulated after AUR + IR combined treatment. In addition, while IR increased BCL2 expression, AUR + IR combined treatment led to its significant (P < 0.0001) downregulation. It is worth mentioning that the highest BAX/BCL2 gene expression ratio (around 15) was achieved in AUR + IR combined treatment. Moreover, significant (P < 0.0001 and P < 0.001) downregulation of CCND1 was detected in both single and combined treatments. Regarding GATA6 expression, while IR significantly (P < 0.0001) increased the expression of this gene, AUR, on the other hand, in single-use or combination with IR, prevented such a change from being observed (Fig. 5).

Prostate cancer is the second most prevalent cancer in men worldwide, accounting for 13.5% of all diagnosed cases in men [14]. Despite many advancements in understanding the molecular mechanisms and risk factors of prostate cancer, it is still considered to be the sixth cause of cancer-related deaths among men worldwide [1, 15].

Although IR is a major modality for the treatment of cancer, its application is in line with a series of challenges such as limited toleration of healthy tissues and side effects such as fatigue, distress, anxiety, and depression [2, 4, 5]. Coumarins such as AUR have anticancer properties at low concentrations and are suitable candidates to be utilized as adjuvants for radiotherapy as well as to minimize IR-induced adverse effects. [7, 9, 10]. Previous studies indicated that AUR had anticancer properties against glioblastoma, colon, and breast cancer cells [16–18]. Studies have also reported synergistic effects of AUR in combination with other therapeutic agents, for example, in a study on colon adenocarcinoma, Moussavi et al. (2017) indicated synergistic effects of AUR and anticancer drugs cisplatin, doxorubicin, or vincristine as well as a strong synergy between AUR and IR [19]. Furthermore, Salari et al. (2020) and Movaffagh et al. (2021) have reported radio-sensitizing effects of AUR in colon and gastric adenocarcinomas, respectively [11, 12]. The results of the present study are consistent with previous reports and indicate that AUR is able to enhance the proliferation inhibitory and apoptosis-inducing effects of IR against prostate cancer PC3 cells.

In order to further investigate the underlying mechanism of AUR + IR synergistic effect, the expression level of genes involved in the path of apoptosis induction was evaluated. P53, a tumor suppressor protein, can be activated by DNA damage and regulates the expression of a number of target genes, inducing cell senescence, cell cycle arrest, and apoptosis. [20]. BAX and BCL2 are two downstream targets that can be regulated by P53. While a homodimer of BAX induces apoptosis, a BAX-BCL2 heterodimer leads to the survival of cells [21]. AUR has the potential to alter the expression of P53, BAX, and BCL2 [22–26], and it is also known that IR is able to increase the expression of these genes [24, 27, 28]. Our results showed that both AUR and IR single treatments increased the expression of P53, and this increase was even more significant (p < 0.0001) in cells treated with a combination of AUR and IR. Similarly, AUR + IR combinatorial treatment indicated a significant (p < 0.0001) increase in the expression of BAX. In addition, it was observed that IR-induced overexpression of BCL2 was significantly (p < 0.0001) inhibited when IR was administered in combination with AUR pretreatment. According to these results, it can be speculated that BAX overexpression and BCL2 inhibition probably led to the formation of more BAX-BAX homodimers rather than BAX-BCL2 heterodimers which can explain the increased number of apoptotic cells in AUR + IR combination therapy. CCND1 is one of the main molecules that regulate the progression of the cell cycle during the G₁ phase, and its deregulation in a series of neoplasms is associated with tumorigenesis and tumor progression [29]. Inhibiting the expression of CCND1 in cancerous cells leads to a longer duration of G₁ phase, reduced cell proliferation and tumorigenicity, as well as chemosensitivity [30–32]. Previously, it was demonstrated that CCND1 was downregulated due to AUR + IR combination therapy in vitro and in vivo [11]. Similarly, in the present study, treatment with IR caused a significant (p < 0.001) decrease in CCND1 expression, and this downregulation was more significant (p < 0.0001) in AUR + IR combined treatment group. GATA6 with a high level of expression in the embryonic endoderm and mesoderm maintains a key role in the development of various organs and systems of the body in a normal manner, and it is also known that its overexpression correlates with several cancers [33]. In this way, IR treatment induces GATA6 overexpression in cancer cells [34], however, in a study by Moussavi et al. (2017), it was shown that AUR pretreatment inhibited GATA6 overexpression in irradiated colon adenocarcinoma cells [19]. In the present study, while irradiated cells indicated a significant (p < 0.0001) increase in the expression of GATA6, AUR pretreatment prevented such alteration from being observed, which further suggested the anti-cancer synergistic effect of AUR + IR combination therapy.

The results of the present study indicated the anticancer properties and radio-sensitizing effects of AUR in PC3 cells, suggesting that AUR could be considered a potential candidate for further studies on AUR and IR combinatorial treatments of prostate cancer.

Funding: This work was supported by the Vice-Chancellor for Research and Technology, Mashhad University of Medical Sciences (Grant number: 980632; Ethical code: IR.MUMS.MEDICAL.REC.1398.653) and Ferdowsi University of Mashhad, Mashhad, Iran.

Competing interests: The authors have no relevant financial or non-financial interests to disclose.

Data availability: All data generated or analyzed during this study are included in this article.

Authors' contributions: Yasaman Abolhassani: Methodology, Investigation, Software, Analysis and interpretation of data, Writing- Original Draft. Masoud Nejabat: Writing – Review & Editing. Seyedehsaba Talebian: Methodology, Investigation. Hamid Gholamhosseinian: Methodology. Fatemeh B. Rassouli, Khadijeh Jamialahmadi: Supervision, Conceptualization and design, Funding acquisition.

Ferlay J, Ervik M, Lam F, Colombet M, Mery L, Piñeros M, Znaor A, Soerjomataram I, Bray F (2018) Global cancer observatory: cancer today. Lyon, France: international agency for research on cancer, 1–6
Schaue D, McBride WH (2015) Opportunities and challenges of radiotherapy for treating cancer. Nat reviews Clin Oncol 12:527–540
Hashemi R, Farahi M, Bagheri R, Iranshahi M, Torabinejad S, Gharedaghi S, Soleymanifard S (2021) In vitro Study of Radiosensitivity Effects of Galbanic Acid on Ovarian Tumor Cells (OVCAR-3 Cell Line). Nat Prod Commun 16:1934578X211046068
Dilalla V, Chaput G, Williams T, Sultanem K (2020) Radiotherapy side effects: integrating a survivorship clinical lens to better serve patients. Curr Oncol 27:107–112
Chen HH, Kuo MT (2017) Improving radiotherapy in cancer treatment: Promises and challenges. Oncotarget 8:62742
Sanders K, Moran Z, Shi Z, Paul R, Greenlee HElsevier, pp.215–240
Zhang Q-Y, Wang F-X, Jia K-K, Kong L-D (2018) Natural product interventions for chemotherapy and radiotherapy-induced side effects. Front Pharmacol 9:1253
Dutta S, Mahalanobish S, Saha S, Ghosh S, Sil PC (2019) Natural products: An upcoming therapeutic approach to cancer. Food Chem Toxicol 128:240–255
Wu Y, Xu J, Liu Y, Zeng Y, Wu G (2020) A review on anti-tumor mechanisms of coumarins. Front Oncol 10:2720
Tayarani-Najaran Z, Tayarani-Najaran N, Eghbali S (2021) A Review of Auraptene as an Anticancer Agent.Frontiers in Pharmacology12
Salari H, Afkhami-Poostchi A, Soleymanifard S, Nakhaei-Rad S, Merajifar E, Iranshahi M, Matin MM, Rassouli FB (2020) Coadministration of auraptene and radiotherapy; a novel modality against colon carcinoma cells in vitro and in vivo. Int J Radiat Biol 96:1051–1059
Movaffagh J, Salari H, Merajifar E, Gholamhosseinian H, Shahroodi A, Iranshahi M, Rassouli FB (2021) 7-geranyloxycoumarin enhanced radiotherapy effects on human gastric adenocarcinoma cells
Askari M, Sahebkar A, Iranshahi M (2009) Synthesis and purification of 7-prenyloxycoumarins and herniarin as bioactive natural coumarins
Barsouk A, Padala SA, Vakiti A, Mohammed A, Saginala K, Thandra KC, Rawla P, Barsouk A (2020) Epidemiology, staging and management of prostate cancer. Med Sci 8:28
Rawla P (2019) Epidemiology of prostate cancer. World J Oncol 10:63
Afshari AR, Roshan MK, Soukhtanloo M, Ghorbani A, Rahmani F, Jalili-Nik M, Vahedi MM, Hoseini A, Sadeghnia HR, Mollazadeh H (2019) Cytotoxic effects of auraptene against a human malignant glioblastoma cell line. Avicenna J phytomedicine 9:334
Epifano F, Genovese S, Miller R, Majumdar AP (2013) Auraptene and its effects on the re-emergence of colon cancer stem cells. Phytother Res 27:784–786
Charmforoshan E, Karimi E, Oskoueian E, Es-Haghi A, Iranshahi M (2019) Inhibition of human breast cancer cells (MCF-7 cell line) growth via cell proliferation, migration, and angiogenesis by auraptene of Ferula szowitsiana root extract. J Food Meas Charact 13:2644–2653
Moussavi M, Haddad F, Rassouli FB, Iranshahi M, Soleymanifard S (2017) Synergy between auraptene, ionizing radiation, and anticancer drugs in colon adenocarcinoma cells. Phytother Res 31:1369–1375
Hasegawa H, Yamada Y, Iha H, Tsukasaki K, Nagai K, Atogami S, Sugahara K, Tsuruda K, Ishizaki A, Kamihira S (2009) Activation of p53 by Nutlin-3a, an antagonist of MDM2, induces apoptosis and cellular senescence in adult T-cell leukemia cells. Leukemia 23:2090–2101
Basu A, Haldar S (1998) The relationship between BcI2, Bax and p53: consequences for cell cycle progression and cell death. Mol Hum Reprod 4:1099–1109
Saboor-Maleki S, Rassouli FB, Matin MM, Iranshahi M (2017) Auraptene attenuates malignant properties of esophageal stem-like cancer cells. Technol Cancer Res Treat 16:519–527
Mousavi SH, Davari A-S, Iranshahi M, Sabouri-Rad S, Najaran ZT (2015) Comparative analysis of the cytotoxic effect of 7-prenyloxycoumarin compounds and herniarin on MCF-7 cell line. Avicenna J phytomedicine 5:520
Moon JY, Kim H, Cho SK (2015) Auraptene, a major compound of supercritical fluid extract of phalsak (Citrus Hassaku Hort ex Tanaka), induces apoptosis through the suppression of mTOR pathways in human gastric cancer SNU-1 cells. Evidence-Based Complementary and Alternative Medicine 2015
Krishnan P, Kleiner-Hancock H (2012) Effects of auraptene on IGF-1 stimulated cell cycle progression in the human breast cancer cell line, MCF-7. International journal of breast cancer 2012
Lee JC, Shin EA, Kim B, Kim BI, Chitsazian-Yazdi M, Iranshahi M, Kim SH (2017) Auraptene induces apoptosis via myeloid cell leukemia 1‐mediated activation of caspases in PC3 and DU145 prostate cancer cells. Phytother Res 31:891–898
An J, Chervin A, Nie A, Ducoff H, Huang Z (2007) Overcoming the radioresistance of prostate cancer cells with a novel Bcl-2 inhibitor. Oncogene 26:652–661
Adamsen BL, Kravik L, De Angelis PM (2009) Cellular response to chemoradiotherapy, radiotherapy and chemotherapy in two colorectal cancer cell lines. Radiat Res 171:562–571
Drobnjak M, Osman I, Scher HI, Fazzari M, Cordon-Cardo C (2000) Overexpression of cyclin D1 is associated with metastatic prostate cancer to bone. Clin Cancer Res 6:1891–1895
Zhou P, Jiang W, Zhang Y, Kahn SM, Schieren I, Santella RM, Weinstein IB (1995) Antisense to cyclin D1 inhibits growth and reverses the transformed phenotype of human esophageal cancer cells. Oncogene 11:571–580
Arber N, Doki Y, Han EK, Sgambato A, Zhou P, Kim N-H, Delohery T, Klein MG, Holt PR, Weinstein IB (1997) Antisense to cyclin D1 inhibits the growth and tumorigenicity of human colon cancer cells. Cancer Res 57:1569–1574
Tashiro E, Tsuchiya A, Imoto M (2007) Functions of cyclin D1 as an oncogene and regulation of cyclin D1 expression. Cancer Sci 98:629–635
Sun Z, Yan B (2020) Multiple roles and regulatory mechanisms of the transcription factor GATA6 in human cancers. Clin Genet 97:64–72
Cai W-s, Shen F, Li J-l, Feng Z, Wang Y-c, Xiao H-q, Xu B (2014) Activated protease receptor-2 induces GATA6 expression to promote survival in irradiated colon cancer cells. Arch Biochem Biophys 555:28–32

Download PDF

Journal Publication

published 22 May, 2023

Read the published version in Molecular Biology Reports →

Editorial decision: Major Revisions Needed
15 Nov, 2022
Reviewers agreed at journal
23 Aug, 2022
Reviewers invited by journal
23 Aug, 2022
Editor assigned by journal
23 Aug, 2022
First submitted to journal
19 Aug, 2022

You are reading this latest preprint version

7-Geranyloxcycoumarin enhances radiosensitivity in human prostate cancer cells

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Synthesis of AUR

2.2. Cell culture

2.3. Cell viability assay

2.4. Flow cytometry for apoptosis detection

2.5. Real time PCR for gene expression evaluation

2.6. Statistical analysis

3. Results

3.1. AUR enhanced proliferation inhibitory effects of IR on PC3 cells

3.2. AUR combined with IR enhanced apoptosis induction

3.3. AUR and IR combinatorial effects on expression of apoptosis related genes

4. Discussion

5. Conclusion

Declarations

References

Status:

Journal Publication

Version 1