HMGB1/TLR4 Signaling Pathway Enhances Abdominal Aortic Aneurysm Progression in Mice by Upregulating Necroptosis

doi:10.21203/rs.3.rs-1982611/v1

Download PDF

Research Article

HMGB1/TLR4 Signaling Pathway Enhances Abdominal Aortic Aneurysm Progression in Mice by Upregulating Necroptosis

https://doi.org/10.21203/rs.3.rs-1982611/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 06 Feb, 2023

Read the published version in Inflammation Research →

You are reading this latest preprint version

Objective and design:

The age-associated increase of aseptic inflammation and necroptosis are closely related to the emergence of various age-associated diseases.

Methods

In this study, the role of HMGB1/TLR4-induced necroptosis in abdominal aortic aneurysm (AAA) formation was investigated. Firstly, the levels of sterile inflammatory mediators (HMGB1, TLR4) and necroptosis markers in the abdominal aorta of adult and old C57BL/6J mice were tested. We observed that sterile inflammatory mediators and necroptosis markers were greatly increased in old mice’s abdominal aorta. Then, using angiotensin II (Ang II)-induced AAA model of APOE^−/− mice, the models were treated with RIP1 inhibitor Necrostatin-1 (Nec-1), TLR4 inhibitor TAK-242, respectively.

Results

We found that HMGB1, TLR4, and necroptosis markers were elevated with the development of AAA in APOE^−/− mice. In addition, necroptosis inhibition by Nec-1 alleviated Ang II-induced AAA development, while the expressions of HMGB1/TLR4 declined. Notably, after blocking TLR4 by TAK-242, the expression of necroptosis markers decreased significantly, and the progression of AAA was also alleviated in APOE^−/− mice.

Conclusions

Our results indicate that HMGB1/TLR4-mediated necroptosis enhances AAA development in Ang II-induced AAA model of APOE^−/− mice and the possible therapeutic roles for TLR4 inhibition in AAA.

Abdominal aortic aneurysm

Necroptosis

HMGB1

Toll-like receptor 4

Angiotensin II

Abdominal aortic aneurysm (AAA) is a degenerative process of the abdominal aorta. The morbidity of AAA in individuals aged above 65 years is up to 5–10%, and rupture is a common cause of death [1, 2]. The mortality of ruptured AAA is 85–90% [3, 4]. Larger diameter aneurysms are more likely to rupture. Currently, open surgery and endovascular repair are still the effective methods to prevent aortic rupture [5]. None of the drugs can effectively limit the further expansion of small- and medium-sized AAA to fatal rupture [6].

Necroptosis is a procedural regulation process of necrosis, which has an important function in pathogenesis and progress of various cardiovascular diseases, including myocardial infarction, atherosclerosis, restenosis, and aneurysm, and it is also the reason for the depletion of aortic smooth muscle cells in the aneurysm [7–9]. Receptor-interacting protein kinase 1 (RIP1), Receptor-interacting protein kinase 3 (RIP3), and mixed lineage kinase domain-like protein (MLKL) are important signaling molecules of necroptosis [10]. The common cell membrane receptors that can initiate necroptosis include toll-like receptor 4 (TLR4), toll-like receptor 3 (TLR3), and tumor necrosis factor receptor 1 (TNFR1) [11]. Endogenous damage-associated molecular pattern molecules (DAMPs) can activated the cell membrane receptor-TLR4 [12]. Studies have shown that necroptosis can be triggered by DAMPs, including HMGB1 and S100 family [13, 14]. New evidence suggests that TLR4-mediated necroptosis has a significant function in inflammatory diseases [15, 16]. Thus far, it is still unclear whether HMGB1/TLR4-mediated necroptosis is involved in the occurrence of AAA.Therefore, the aim of this study is to examine the mechanism and role of HMGB1/TLR4-mediated necroptosis in Ang II-induced AAA model of APOE^−/− mice.

2.1. Mice

Male C57BL/6J mice divided into adult group (2 months) and aging group (18 months), male APOE^−/− mice (2 months) with a background of C57BL/6J mice, were bought from Beijing Charles River Company and raised in experimental animal center of Shandong Provincial Hospital. All animal experimental procedures were carried out following the National Institute of Health’s guidelines and were agreed with Shandong Provincial Hospital’s Committee of Animal Protection and Use.

2.2. Animal Model

All of the experimental mice were divided into two groups. Adult and old C57BL/6J mice were used to observe degeneration of the abdominal aorta and age-related changes in aseptic inflammatory mediators and necroptosis during aging. APOE^−/− mice were used to establish the experimental AAA model. The modeling method was as follows: Alzet osmotic pumps (Model 2004, Durect, CA, USA) were implanted subcutaneously in interscapular region to release 1.44 mg/kg/day Ang II (GL Biochem). Subcutaneous injection was continued for 28 days [17]. Mice were grouped into sham operation group (Saline), AAA group (Ang II), RIP1 inhibitor group (Ang II/Necrostatin-1), and TLR4 inhibitor group (Ang II/TAK-242) (n = 8 per group). RIP1 inhibitor Necrostatin-1 (3.2 mg/kg/day, i.p. [18]) or TLR4 inhibitor TAK-242 (0.3 mg/kg, i.p., twice a week [19]) was given for 28 days. Any animal that died before the end of the experiment was autopsied. After 28 days, the mice were killed for tissue harvesting and image acquisition.

2.3. Histology

Paraformaldehyde-fixed aortas were imbedded in Tissue-Tek O.C.T. Compound (Sakura Finetek, USA). Cryostat sections were cut in cross-sections (6 µm) and then dyed by hematoxylin and eosin (H&E) for analysis of the structural integrity or medial aortic wall cell density (in cells/mm²). Verhoeff’s Van Gieson (EVG) staining was performed for corruption of elastin. Cell density (cells/mm²) of aortic medial was measured by taking count of nucleus number and dividing it by total observed tissue area Volume fraction of elastin in aortic medial was measured as the ratio of the EVG stain area to total observed tissue area [20].

2.4. Determination of the Aortic Diameter

The abdominal aorta diameter between renal artery and superior mesenteric artery at 0, 7, 14, and 28 days after implantation of osmotic micropumps was examined using the VEVO2100 Ultrasound system (Visual Sonics Inc, Canada). All of the abdominal aortic diameters were independently measured by two researchers blinded to the group assignment. Aneurysm was defined as the aorta's maximal diameter increased beyond 50% of baseline diameter[21].

2.5. Western Blot Assay

Protein lysates from aortic tissues were extracted and protein concentrations were tested by BCA Protein Assay Kit (Solarbio, China). Proteins (20 µg per lane) were separated with SDS-PAGE and were transferred to PVDF membranes (Millipore, USA). Membranes were blocked for 1 hour in 5% skimmed milk and incubated overnight at 4°C with the antibodies as follows: TLR4 (1:500, ab13556, Abcam, USA), HMGB1 (1:1000, ab18256, Abcam, USA), RIP1 (1:1000, 3493, Cell Signaling, USA), RIP3 (1:1000, ab62344, Abcam, USA), MLKL (1:1000, NBP3-03885, Novus, USA), and β-actin (1:2000, E-AB-20058, Elabscience, China). Next, the membranes were rinsed in TBST and incubated with secondary antibody (horseradish peroxidase-(HRP-) conjugated goat anti-rabbit IgG, 1:5000, E-AB-1003, Elabscience, China) for 1 hour at room temperature. Signals were tested by enhanced chemiluminescence (WBKLS0100, Millipore, Germany) and exposed with Amersham Imager (Cytiva, USA). Protein strips were measured with ImageJ software.

2.6. Isolation of RNA and Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR)

Total RNA from aortic tissues was derived with RNA extraction kit (AG21017, China) and reverse-transcribed into cDNA with Evo M-MLV RT Mix Kit (AG11728, China). qRT-PCR analysis was executed with the SYBR Green Premix Pro Taq HS qPCR Kit (AG11701, China). The primers sequence is shown in Table 1.

2.7. Immunofluorescence Staining

Tissue sections were rinsed with PBS three times for 5 mins each. Nonspecific sites were enclosed by 10% donkey serum for 1 hour at room temperature. Then, the sections were incubated with the following primary antibodies overnight at 4°C: TLR4 (1:100, ab13556, Abcam, USA), HMGB1 (1:1000, ab18256, Abcam, USA), RIP1(1:200, 3493, Cell Signaling, USA), RIP3 (1:200, ab62344, Abcam, USA), and MLKL (1:100, NBP3-03885, Novus, USA). On the second day, arterial sections were rinsed with PBS three times for 5 mins each, and then incubated with the secondary antibody as follows: IFKine™ Green Donkey Anti-Rabbit IgG (1:200, A24221, Abbkine, China) or IFKine™ Red Donkey Anti-Goat IgG (1:200, A24431, Abbkine, China) for 1 hour at room temperature. Nuclei were counterstained by DAPI. Images were obtained by Olympus BX63 microscope (Olympus, Japan) and analyzed by ImageJ software.

2.8. Statistical Analysis

Data are shown as mean ± SD. Significant differences were ascertained by Student’s test or one-way ANOVA according to the data type. Statistically significant differences were considered as p < 0.05.

3.1. Aging Aortic Degenerative Changes

To determine the cell density, the aortas of adult and old mice were dyed by hematoxylin and eosin, and the nuclei number was counted. Compared with adult mice, the density of aortic middle layer cells in old mice decreased significantly (Fig. 1A). To evaluate the elastic structure of mice, EVG stain of aorta sections was executed. Compared with the adult group, the middle elastin volume fraction decreased in the old group (Fig. 1B).

3.2. Upregulation of HMGB1, TLR4, and Aggravated Necroptosis in the Aging Aorta

Protein or RNA was extracted from the aortic tissue and analyzed by Western blot or real-time polymerase chain reaction (RT-PCR). The mRNA and protein levels of HMGB1, TLR4, and necroptosis markers increased significantly in the aging aorta (Fig. 2A ~ D). To evaluate the expression levels of HMGB1, TLR4, and necroptosis markers in aging aorta, we stained the aorta of adult and old mice (Fig. 2E, F). The results of immunofluorescence approved that the expression levels of HMGB1, TLR4, and RIP3 increased in aging aortic tissues. The decrease in smooth muscle-specific α-SMA staining in aging aortic tissue reflected the loss of VSMCs and decrease in contractile proteins in these tissues.

3.3. Increased Expression of HMGB1, TLR4, and Elevated Necroptosis in the Experimental AAA Model

Subsequently, we established Ang II-induced AAA model of APOE^−/− mice. The levels of HMGB1, TLR4 and necroptosis markers in experimental AAA model were detected. The results of western blot showed that the levels of HMGB1, TLR4 and necroptosis markers in AAA group increased significantly compared with that in sham group (Fig. 3A, B). Similar outcomes were acquired by immunofluorescence assay (Fig. 3C, D). In summary, these results suggest that high expression of HMGB1, TLR4, and necroptosis markers may be associated with the progression of AAA.

3.4. Necroptosis or TLR4 Inhibition Prevents Experimental AAA Formation in Mice

To verify the relationship and mechanism of TLR4 and necroptosis in experimental AAA, APOE^−/− mice with AAA induced by Ang II were treated with necroptosis inhibitor Necrostatin-1 and TLR4 inhibitor TAK-242. Ultrasound examination was executed at specified time point to observe the change of luminal diameter and efficiency of modeling. The results showed that the lumen diameter in AAA group expanded significantly than that in sham group, and Necrostatin-1 or TAK-242 treatment significantly inhibited abdominal aortic dilatation. It indicated that inhibition of necroptosis or TLR4 could prevent AAA formation induced by Ang II (Fig. 4A ~ D). Meanwhile, we studied whether Necrostatin-1 or TAK-242 could inhibit aortic wall remodeling and elastin degradation in Ang II-induced APOE^−/− mice. Histological analysis showed that a relatively intact aorta structure and less fragmented elastic fibers in Necrostatin-1 or TAK-242 treated aortae, while the elastic fibers in the AAA group were fragmented and the direction was disordered (Fig. 4E).

3.5. Necroptosis or TLR4 Inhibition Decreases the Expressions of HMGB1 and TLR4, and Attenuates Necroptosis in Ang II-Induced AAA

As shown in Fig. 5, Protein or RNA was extracted from the aortic tissue and analyzed by Western blot or RT-PCR. In the Necrostatin-1 treated group, much lower expression and mRNA levels of HMGB1, TLR4, and necroptosis markers were detected in the aorta of APOE^−/− mice with AAA than in the untreated AAA group (Fig. 5A ~ C). IF staining also obtained similar results (Fig. 5D). The TAK-242-treated group also showed the same trend. On the whole, these results confirm that TLR4 inhibition reduced the inflammatory reaction and necroptosis in Ang II-induced AAA.

AAA, a degenerative lesion of aorta, is a frequent cardiovascular disease in senior citizen [22, 23]. Death from rupture is common. Clinically, AAA is repairable by endovascular techniques and open surgery [24]. Nevertheless, these two treatments are only applicable to patients with an AAA diameter of more than 5.5 cm [25]. If an AAA with a diameter of between 3 and 5.5 cm is left uncontrolled, it can lead to extensive dilatation of the abdominal aorta and ultimately rupture [26, 27]. Therefore, it is very important to explore the pathogenesis of AAA and identify new targets for the intervention of small and medium diameter AAA.

Aortic structural changes occur throughout one's life, but most symptoms occur after middle age [28, 29]. Vascular remodeling and medial layer degeneration are typical age-related aortic structural changes [30, 31]. The incidence of these pathological changes is significantly increased in the elderly population and shows a growing trend [32]. The aortic medial layer, composed of VSMCs, elastin and collagen concentric bands, is the most important degenerative reconstruction site for aneurysm formation [33, 34].Medial VSMC loss is the main pathological feature of AAA and has been observed in clinical pathology and mouse AAA model [8].

In this study, aortic degenerative changes occurred in old mice, and the density of mesothelial cells decreased, which conformed to the research by Wheeler et al [20]. In addition, the expression of aseptic inflammatory mediators and key necroptosis proteins in the aorta of aging mice increased. This phenomenon was consistent with the study by Aleah and Sathyaseelan et al [35, 36]. The same trend was also observed in the AAA of APOE^−/− mice induced by Ang II. Chronic aseptic inflammation that occurs with age is involved in the pathogenesis of various age-related diseases, including cardiovascular aging and related diseases, such as atherosclerosis and aneurysms [37]. Age-related aortic remodeling is the result of aseptic inflammation [38]. Age-related DAMP accumulation, which can trigger inflammation by binding to the cell surface receptors on innate immune cells, is an important trigger for inflammation [39, 40].

Toll-like receptors (TLRs) are the key transmembrane proteins that recognize extracellular antigen information and transmit it to the cells to initiate an inflammatory response [41, 42]. TLR4 can be activated by endogenous DAMPs, and it is one of the earliest and most studied members of the Toll-like family [12]. TLR4 and its ligand HMGB1 play an important role in promoting inflammation in aseptic inflammation. Their expression levels are positively correlated with age [43]. HMGB1 is mainly present in the nucleus under physiological conditions. When cells are stimulated or in a pathological condition, HMGB1 can be released outside the cells [44]. It has been reported that TLR4 deficiency can reduce the necroptosis of microglia and inhibit retinal inflammation [16]. Necroptosis is a highly regulated cell death pathway, which can be triggered by many different cell membrane receptors, including TLR4 [11]. These receptors lead to phosphorylation and activation of the necrotizing kinase RIPK3. RIPK3 activates MLKL through phosphorylation, causing conformational changes and activation. The activated MLKL is localized to the plasma membrane, causing changes in membrane permeability [45]. After plasma membrane disruption, HMGB1 in the nucleus is released into the cell. Necroptosis is also one of the ways to release DAMPs. This suggests that there might be some crosstalk between HMGB1/TLR4 and necroptosis, forming a vicious circle.

To confirm the relationship and mechanism between HMGB1/TLR4 pathway and necroptosis in APOE^−/− mice with AAA induced by Ang II, a selective TLR4 inhibitor TAK-242 and necroptosis inhibitor Necrostatin-1 were used in this study.TAK-242 can bind to TLR4’s intracellular domain of and inhibit its signal transduction [46]. Necrostatin-1 is a RIP1-targeted inhibitor of necroptosis, which can inhibit the signaling pathway of necroptosis and improve the death of necrotizing cells in the development of diseases [9]. It has been reported that RIP1 blockade by Necrostatin-1 prevents AAA formation of mice induced by Ang II [47]. This was also verified by our research. Meanwhile, Necrostatin-1 also reduced HMGB1 and TLR4 expression by inhibiting RIP1 signaling. Similarly, we noted inhibition of TLR4 signaling by TAK-242 downregulated HMGB1 expression. Notably, after blocking TLR4 by TAK-242, the expression of necroptosis markers decreased significantly and achieved the efficacy of Necrostatin-1 to block necroptosis. In summary, during the degenerative changes in the aging aorta, the expression of TLR4 on the surface of VSMCs and its extracellular ligand HMGB1 increased, thus initiating the necroptosis of VSMCs. After destruction of the plasma membrane, HMGB1 in the nucleus was released into the extracellular space to further actuated the necroptosis of VSMCs and form a positive feedback vicious cycle, which eventually led to the loss of VSMCs and decrease in elastin and collagen secreted by VSMCs; thus, forming an AAA (Fig. 6). In addition, inhibition of TLR4 prevented aortic degeneration and inflammation in APOE^−/− mice with AAA induced by Ang II, thus preventing experimental AAA formation.

Taken together, our research suggests that chronic low-grade sterile inflammation, which occurs with age, exacerbated necroptosis of VSMCs during aortic degenerative changes. Consistent with the other findings, the HMGB1/TLR4 pathway and necroptosis played important roles during mice AAA development induced by Ang II, providing more evidence for the underlying mechanism of AAA formation.TAK-242 alleviated the inflammatory reaction and necroptosis by inhibiting TLR4 signaling, and has a protective function against mice AAA induced by Ang II, providing further evidence for TLR4 as a potential therapeutic target of AAA.

Data availability statement

The authors will provide the raw data of this study unreservedly.

Ethics statement

All animal experimental procedures were agreed with Shandong Provincial Hospital’s Committee of Animal Protection and Use.

Author contributions

Shuai Bian and Le Yang contributed equally to this work and shared co-first authors. Shuai Bian and Le Yang carried out the experiments and drafted the article. Dongfang Zhao and Lizhi Lv collected and analyzed the data. Tiezheng Wang performed ultrasound examinations. Hai Yuan contributed to the conception and design of this study, executed article revision. All authors read and agreed with the final manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (NSFC) (Nos. 81970400).

J. Golledge, J. Muller, A. Daugherty, P. Norman, Abdominal aortic aneurysm: pathogenesis and implications for management, Arterioscler Thromb Vasc Biol 26(12) (2006) 2605-13.
T. Miyake, R. Morishita, Pharmacological treatment of abdominal aortic aneurysm, Cardiovasc Res 83(3) (2009) 436-43.
J.T. Powell, R.M. Greenhalgh, Clinical practice. Small abdominal aortic aneurysms, N Engl J Med 348(19) (2003) 1895-901.
K.C. Kent, Clinical practice. Abdominal aortic aneurysms, N Engl J Med 371(22) (2014) 2101-8.
J. Golledge, Abdominal aortic aneurysm: update on pathogenesis and medical treatments, Nat Rev Cardiol 16(4) (2019) 225-242.
M. Rouer, B.H. Xu, H.J. Xuan, H. Tanaka, N. Fujimura, K.J. Glover, Y. Furusho, M. Gerritsen, R.L. Dalman, Rapamycin limits the growth of established experimental abdominal aortic aneurysms, Eur J Vasc Endovasc Surg 47(5) (2014) 493-500.
T. Zhang, Y. Zhang, M. Cui, L. Jin, Y. Wang, F. Lv, Y. Liu, W. Zheng, H. Shang, J. Zhang, M. Zhang, H. Wu, J. Guo, X. Zhang, X. Hu, C.M. Cao, R.P. Xiao, CaMKII is a RIP3 substrate mediating ischemia- and oxidative stress-induced myocardial necroptosis, Nat Med 22(2) (2016) 175-82.
Q. Wang, Z. Liu, J. Ren, S. Morgan, C. Assa, B. Liu, Receptor-interacting protein kinase 3 contributes to abdominal aortic aneurysms via smooth muscle cell necrosis and inflammation, Circ Res 116(4) (2015) 600-11.
D. Karunakaran, M. Geoffrion, L. Wei, W. Gan, L. Richards, P. Shangari, E.M. DeKemp, R.A. Beanlands, L. Perisic, L. Maegdefessel, U. Hedin, S. Sad, L. Guo, F.D. Kolodgie, R. Virmani, T. Ruddy, K.J. Rayner, Targeting macrophage necroptosis for therapeutic and diagnostic interventions in atherosclerosis, Sci Adv 2(7) (2016) e1600224.
H. Wang, L. Sun, L. Su, J. Rizo, L. Liu, L.F. Wang, F.S. Wang, X. Wang, Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3, Mol Cell 54(1) (2014) 133-146.
S. He, Y. Liang, F. Shao, X. Wang, Toll-like receptors activate programmed necrosis in macrophages through a receptor-interacting kinase-3-mediated pathway, Proc Natl Acad Sci U S A 108(50) (2011) 20054-9.
H. Fang, B. Ang, X. Xu, X. Huang, Y. Wu, Y. Sun, W. Wang, N. Li, X. Cao, T. Wan, TLR4 is essential for dendritic cell activation and anti-tumor T-cell response enhancement by DAMPs released from chemically stressed cancer cells, Cell Mol Immunol 11(2) (2014) 150-9.
S.Y. Lin, S.Y. Hsieh, Y.T. Fan, W.C. Wei, P.W. Hsiao, D.H. Tsai, T.S. Wu, N.S. Yang, Necroptosis promotes autophagy-dependent upregulation of DAMP and results in immunosurveillance, Autophagy 14(5) (2018) 778-795.
L. Bai, M. Kong, Z. Duan, S. Liu, S. Zheng, Y. Chen, M2-like macrophages exert hepatoprotection in acute-on-chronic liver failure through inhibiting necroptosis-S100A9-necroinflammation axis, Cell Death Dis 12(1) (2021) 93.
Y.P. Hong, J. Yu, Y.R. Su, F.C. Mei, M. Li, K.L. Zhao, L. Zhao, W.H. Deng, C. Chen, W.X. Wang, High-Fat Diet Aggravates Acute Pancreatitis via TLR4-Mediated Necroptosis and Inflammation in Rats, Oxid Med Cell Longev 2020 (2020) 8172714.
Z. Huang, T. Zhou, X. Sun, Y. Zheng, B. Cheng, M. Li, X. Liu, C. He, Necroptosis in microglia contributes to neuroinflammation and retinal degeneration through TLR4 activation, Cell Death Differ 25(1) (2018) 180-189.
Z. Wang, J. Guo, X. Han, M. Xue, W. Wang, L. Mi, Y. Sheng, C. Ma, J. Wu, X. Wu, Metformin represses the pathophysiology of AAA by suppressing the activation of PI3K/AKT/mTOR/autophagy pathway in ApoE(-/-) mice, Cell Biosci 9 (2019) 68.
Q. Wang, T. Zhou, Z. Liu, J. Ren, N. Phan, K. Gupta, D.M. Stewart, S. Morgan, C. Assa, K.C. Kent, B. Liu, Inhibition of Receptor-Interacting Protein Kinase 1 with Necrostatin-1s ameliorates disease progression in elastase-induced mouse abdominal aortic aneurysm model, Sci Rep 7 (2017) 42159.
H.F. Gu, N. Li, Z.Q. Xu, L. Hu, H. Li, R.J. Zhang, R.M. Chen, X.L. Zheng, Y.L. Tang, D.F. Liao, Chronic Unpredictable Mild Stress Promotes Atherosclerosis via HMGB1/TLR4-Mediated Downregulation of PPARγ/LXRα/ABCA1 in ApoE(-/-) Mice, Front Physiol 10 (2019) 165.
J.B. Wheeler, R. Mukherjee, R.E. Stroud, J.A. Jones, J.S. Ikonomidis, Relation of murine thoracic aortic structural and cellular changes with aging to passive and active mechanical properties, J Am Heart Assoc 4(3) (2015) e001744.
K.W. Johnston, R.B. Rutherford, M.D. Tilson, D.M. Shah, L. Hollier, J.C. Stanley, Suggested standards for reporting on arterial aneurysms. Subcommittee on Reporting Standards for Arterial Aneurysms, Ad Hoc Committee on Reporting Standards, Society for Vascular Surgery and North American Chapter, International Society for Cardiovascular Surgery, J Vasc Surg 13(3) (1991) 452-8.
B.W. Ullery, R.L. Hallett, D. Fleischmann, Epidemiology and contemporary management of abdominal aortic aneurysms, Abdom Radiol (NY) 43(5) (2018) 1032-1043.
M. Ramella, P. Bernardi, L. Fusaro, M. Manfredi, F. Casella, C.M. Porta, L. Nicolai, E. Galeazzi, R. Boldorini, A.M. Settembrini, P. Settembrini, E. Marengo, M. Cannas, F. Boccafoschi, Relevance of inflammation and matrix remodeling in abdominal aortic aneurysm (AAA) and popliteal artery aneurysm (PAA) progression, Am J Transl Res 10(10) (2018) 3265-3275.
T.W. Tan, M. Eslami, D. Rybin, G. Doros, W.W. Zhang, A. Farber, Outcomes of endovascular and open surgical repair of ruptured abdominal aortic aneurysms in elderly patients, J Vasc Surg 66(1) (2017) 64-70.
R. Umebayashi, H.A. Uchida, J. Wada, Abdominal aortic aneurysm in aged population, Aging (Albany NY) 10(12) (2018) 3650-3651.
N. Sakalihasan, J.B. Michel, A. Katsargyris, H. Kuivaniemi, J.O. Defraigne, A. Nchimi, J.T. Powell, K. Yoshimura, R. Hultgren, Abdominal aortic aneurysms, Nat Rev Dis Primers 4(1) (2018) 34.
S.G. Thompson, M.J. Bown, M.J. Glover, E. Jones, K.L. Masconi, J.A. Michaels, J.T. Powell, P. Ulug, M.J. Sweeting, Screening women aged 65 years or over for abdominal aortic aneurysm: a modelling study and health economic evaluation, Health Technol Assess 22(43) (2018) 1-142.
H. Qiu, Y. Zhu, Z. Sun, J.P. Trzeciakowski, M. Gansner, C. Depre, R.R. Resuello, F.F. Natividad, W.C. Hunter, G.M. Genin, E.L. Elson, D.E. Vatner, G.A. Meininger, S.F. Vatner, Short communication: vascular smooth muscle cell stiffness as a mechanism for increased aortic stiffness with aging, Circ Res 107(5) (2010) 615-9.
J. Zhang, X. Zhao, D.E. Vatner, T. McNulty, S. Bishop, Z. Sun, Y.T. Shen, L. Chen, G.A. Meininger, S.F. Vatner, Extracellular Matrix Disarray as a Mechanism for Greater Abdominal Versus Thoracic Aortic Stiffness With Aging in Primates, Arterioscler Thromb Vasc Biol 36(4) (2016) 700-6.
L. Rodriguez-Menocal, M.H. Faridi, L. Martinez, L.A. Shehadeh, J.C. Duque, Y. Wei, A. Mesa, A. Pena, V. Gupta, S.M. Pham, R.I. Vazquez-Padron, Macrophage-derived IL-18 and increased fibrinogen deposition are age-related inflammatory signatures of vascular remodeling, Am J Physiol Heart Circ Physiol 306(5) (2014) H641-53.
P.T. Albini, A.M. Segura, G. Liu, C.G. Minard, J.S. Coselli, D.M. Milewicz, Y.H. Shen, S.A. LeMaire, Advanced atherosclerosis is associated with increased medial degeneration in sporadic ascending aortic aneurysms, ATHEROSCLEROSIS 232(2) (2014) 361-8.
M. Li, N.K. Fukagawa, Age-related changes in redox signaling and VSMC function, Antioxid Redox Signal 12(5) (2010) 641-55.
L. de Figueiredo Borges, R.G. Jaldin, R.R. Dias, N.A. Stolf, J.B. Michel, P.S. Gutierrez, Collagen is reduced and disrupted in human aneurysms and dissections of ascending aorta, Hum Pathol 39(3) (2008) 437-43.
M.E. Groeneveld, J.A. Struik, R.J.P. Musters, G.J. Tangelder, P. Koolwijk, H.W. Niessen, A.W.J. Hoksbergen, W. Wisselink, K.K. Yeung, The Potential Role of Neutrophil Gelatinase-Associated Lipocalin in the Development of Abdominal Aortic Aneurysms, Ann Vasc Surg 57 (2019) 210-219.
A.L. Brubaker, J.L. Palmer, E.J. Kovacs, Age-related Dysregulation of Inflammation and Innate Immunity: Lessons Learned from Rodent Models, Aging Dis 2(5) (2011) 346-60.
S.S. Deepa, A. Unnikrishnan, S. Matyi, N. Hadad, A. Richardson, Necroptosis increases with age and is reduced by dietary restriction, AGING CELL 17(4) (2018) e12770.
S.C. Gupta, A.B. Kunnumakkara, S. Aggarwal, B.B. Aggarwal, Inflammation, a Double-Edge Sword for Cancer and Other Age-Related Diseases, Front Immunol 9 (2018) 2160.
L. Joly, D. Mandry, A. Verger, C. Labat, G. Watfa, V. Roux, G. Karcher, P.Y. Marie, A. Benetos, Influence of Thoracic Aortic Inflammation and Calcifications on Arterial Stiffness and Cardiac Function in Older Subjects, J Nutr Health Aging 20(3) (2016) 347-54.
S. Wang, Y. Zhang, HMGB1 in inflammation and cancer, J Hematol Oncol 13(1) (2020) 116.
Y. Murakami, H. Matsumoto, M. Roh, A. Giani, K. Kataoka, Y. Morizane, M. Kayama, A. Thanos, S. Nakatake, S. Notomi, T. Hisatomi, Y. Ikeda, T. Ishibashi, K.M. Connor, J.W. Miller, D.G. Vavvas, Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsRNA-induced retinal degeneration, Cell Death Differ 21(2) (2014) 270-7.
B.A. Imhof, S. Jemelin, Y. Emre, Toll-like receptors elicit different recruitment kinetics of monocytes and neutrophils in mouse acute inflammation, Eur J Immunol 47(6) (2017) 1002-1008.
S. Elzinga, B.J. Murdock, K. Guo, J.M. Hayes, M.A. Tabbey, J. Hur, E.L. Feldman, Toll-like receptors and inflammation in metabolic neuropathy; a role in early versus late disease?, Exp Neurol 320 (2019) 112967.
V. Peek, E. Neumann, T. Inoue, S. Koenig, F.J. Pflieger, R. Gerstberger, J. Roth, K. Matsumura, C. Rummel, Age-Dependent Changes of Adipokine and Cytokine Secretion From Rat Adipose Tissue by Endogenous and Exogenous Toll-Like Receptor Agonists, Front Immunol 11 (2020) 1800.
S. He, J. Cheng, L. Sun, Y. Wang, C. Wang, X. Liu, Z. Zhang, M. Zhao, Y. Luo, L. Tian, C. Li, Q. Huang, HMGB1 released by irradiated tumor cells promotes living tumor cell proliferation via paracrine effect, Cell Death Dis 9(6) (2018) 648.
Y. Wang, M. Zhao, S. He, Y. Luo, Y. Zhao, J. Cheng, Y. Gong, J. Xie, Y. Wang, B. Hu, L. Tian, X. Liu, C. Li, Q. Huang, Necroptosis regulates tumor repopulation after radiotherapy via RIP1/RIP3/MLKL/JNK/IL8 pathway, J Exp Clin Cancer Res 38(1) (2019) 461.
N. Matsunaga, N. Tsuchimori, T. Matsumoto, M. Ii, TAK-242 (resatorvid), a small-molecule inhibitor of Toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules, Mol Pharmacol 79(1) (2011) 34-41.
T. Zhou, Q. Wang, N. Phan, J. Ren, H. Yang, C.C. Feldman, J.B. Feltenberger, Z. Ye, S.A. Wildman, W. Tang, B. Liu, Identification of a novel class of RIP1/RIP3 dual inhibitors that impede cell death and inflammation in mouse abdominal aortic aneurysm models, Cell Death Dis 10(3) (2019) 226.

Table 1 qRT-PCR primers used in this study

Gene	Forward sequence (5’-3’)	Reverse sequence (5’-3’)
TLR4	CATGGATCAGAAACTCAGCAAAGTC	CATGCCAGTCCTTGTCTTCA
HMGB1	TTTAGATAGCCCTGTCCTGGTGGTA	GTGCACCAACAAGAACCTGCTTTA
RIP1	GAAGACAGACCTAGACAGCGG	CCAGTAGCTTCACCACTCGAC
RIP3	GTGCTACCTACACAGCTTGAAC	CCCTCCCTGAAACGTGGAC
MLKL	ACTGTGAACTTGGAACCCTGAG	GGTGTAGCCTGTATAAGCCTCTG
β-actin	CATCCGTAAAGACCTCTATGCCAAC	ATGGAGCCACCGATCCACA

No competing interests reported.

Download PDF

Journal Publication

published 06 Feb, 2023

Read the published version in Inflammation Research →

Editorial decision: Major revision
01 Sep, 2022
Reviews received at journal
01 Sep, 2022
Reviewers agreed at journal
25 Aug, 2022
Reviewers invited by journal
25 Aug, 2022
Submission checks completed at journal
22 Aug, 2022
Editor assigned by journal
22 Aug, 2022
First submitted to journal
21 Aug, 2022

You are reading this latest preprint version

HMGB1/TLR4 Signaling Pathway Enhances Abdominal Aortic Aneurysm Progression in Mice by Upregulating Necroptosis

Status:

Journal Publication

Version 1

Abstract

Objective and design:

Methods

Results

Conclusions

Figures

1. Introduction

2. Materials And Methods

2.1. Mice

2.2. Animal Model

2.3. Histology

2.4. Determination of the Aortic Diameter

2.5. Western Blot Assay

2.6. Isolation of RNA and Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR)

2.7. Immunofluorescence Staining

2.8. Statistical Analysis

3. Results

3.1. Aging Aortic Degenerative Changes

3.2. Upregulation of HMGB1, TLR4, and Aggravated Necroptosis in the Aging Aorta

3.3. Increased Expression of HMGB1, TLR4, and Elevated Necroptosis in the Experimental AAA Model

3.4. Necroptosis or TLR4 Inhibition Prevents Experimental AAA Formation in Mice

4. Discussion

Declarations

References

Table 1

Additional Declarations

Status:

Journal Publication

Version 1