Mandarin fish were obtained from Chinese Perch Research Center of Huazhong Agricultural University (Wuhan, Hubei Province, China). Fish (50 ± 5 g) were maintained in the aquarium (12 tanks, 50 fish per tank) with continuous system of water filtration and aeration at constant temperature (25 ± 0.5 °C) and domesticated. Mandarin fish were fed with artificial diets (Table 6) and divided into two groups: fish did not eat artificial diets and fish ate artificial diets. The fish did not eat artificial diets during the first domestication process was then fed with live fish prey for three days, starved for two days and fed with artificial diets for one day, and then we selected the fish did not eat artificial diets during the second domestication process and repeated the domestication process for one more time. The fish ate artificial diets during the first domestication process was fed with live fish prey for one days and fed with artificial diets for three days, then we selected the fish ate artificial diets during the second domestication process and repeated the domestication process for one more time. Finally, the two groups were obtained, the fish did not eat artificial diets or ate artificial diets during all of the three domestication processes, named Group W (n=42) or X (n=24), respectively. Six fish were used for real-time quantitative PCR. Six fish were used for western blotting. Ten fish were used for metabolome, and three fish were used for transcriptome sequencing.
Table 6
Composition of artificial diets
Primers for real-time PCR
|
Sequences(5’-3’)
|
RPL13A-F
RPL13A-R
|
CACCCTATGACAAGAGGAAGC
TGTGCCAGACGCCCAAG
|
EZH1-F
EZH1-R
TFIIF-F
TFIIF-R
|
AAAAGATTGAGCAGCAGACA
GGAAGCCAAACTCCACTGTA
GTGCCCAAATACCTCTCTCAGC TCTATACCCTCAATCACAGTCAGC
|
Primers for BSP amplicon
|
Sequences(5’-3’)
|
BSP TFIIF-F
|
TTTAGGGTTTTGATTTTGGTTTTTT
|
BSP TFIIF-R
|
ACTAAATAAACAACTCTTCATTTTAC
|
Ingredients
|
%
|
White fish meal
|
71
|
Corn starch
|
8
|
Fish oil
|
10
|
Vitamin premix1
|
2
|
Mineral premix2
|
2
|
Microcrystalline cellulose
|
2
|
Carboxymethyl cellulose
|
2
|
Yeast extract powder
|
3
|
Note: 1. Vitamin premix (per kg of diet): vitamin B1 (thiamin), 30 mg; vitamin B2 (riboflavin), 60 mg; vitamin B6, 30 mg; vitamin B12, 0.22 mg; vitamin D3, 5 mg; vitamin E 160 mg; vitamin K3 50 mg; folic acid, 20 mg; biotin, 2.5 mg; pantothenic acid calcium, 100 mg; ascorbic acid (35%), 250 mg; niacinamide, 200 mg; powdered rice hulls, 999 mg. |
2. Mineral premix (per kg of diet): MnSO4, 10 mg; MgSO4, 10 mg; KCl, 95 mg; NaCl, 165 mg; ZnSO4, 20 mg; KI, 1 mg; CuSO4, 12.5 mg; FeSO4, 105 mg; Na2SeO3, 0.1 mg; Co, 1.5 mg. |
The experimental fish were anesthetized with MS-222 (200 mg/L) (Redmond, WA, USA) and sacrificed by decapitation according to the ethical guidelines of Huazhong Agricultural University. Immediately after the surgical resection, the liver tissue was frozen in liquid nitrogen and stored at -80 °C until used. The blood was drawn from the tail vein. The whole blood sample was separated with 4000 r/centrifuge for 10 min, collecting plasma and storing at -80 °C. The animal protocol was approved by the Institutional Animal Care and Use Ethics Committee of Huazhong Agricultural University (Wuhan, China).
RNA Isolation and Reverse Transcription
Total RNA was extracted using Trizol reagent (TaKaRa, Tokyo, Japan) following the manufacturer’s instructions. The extracted RNA was re-suspended in 30 μL RNase-free water and then quantified with a BioTek Synergy™2 Multi-detection Microplate Reader (BioTek Instruments, Winooski, VT) and agarose gel electrophoresis. One microgram of total RNA was synthesized to complementary DNA (cDNA) using Revert Aid™ Reverse Transcriptase (TaKaRa, Tokyo, Japan) according to the manufacturer’s instructions. The synthesized cDNA was stored at -20 °C.
Transcriptome Sequencing
Equal amount of total RNA from each group (three biological replicates for each group) were used to construct the libraries for transcriptome analysis using MGIEasy RNA kit following manufacturer's instructions (BGI, Wuhan, China). Purified Poly(A) mRNA was from total RNA via oligo-dT-attached magnetic beads. Paired-end cDNA libraries were sequenced using BGISEQ-500 system (BGI, Wuhan, China). SOAPnuke was used to perform Image deconvolution and base calling. Clean reads were obtained by removing adaptor reads and low-quality reads (Q ≤ 10), on which all following analysis were based. Transcriptome assembly was carried out with short reads assembling program Trinity with k-mer length 25 bp. The reads were mapped back to assembled contigs. By using the paired-end information, contigs can be detect from the same transcript as well as the distances between these contigs. We connected the contigs using N to represent unknown sequences between each pair of contigs, and then scaffolds were made. Paired-end reads were used again for gap filling of scaffolds to obtain sequences with least Ns and could not be extended on either end. Such sequences were defined as unigenes. To annotate the transcriptome, we performed the BLAST alignment between unigene and databases such as Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Ontology (GO), NR, NT, SwissProt, Pfam and KOG with Blast2GO, hmmscan and getorf software.
To estimate expression levels, the RNA-Seq reads generated were mapped to the unigenes using Bowtie2. Gene expression levels were measured by RSEM. We analyzed the differentially expressed genes used DEGseq method described before [31], and False Discovery Rate (FDR) ≤ 0.001 and Fold Change ≥ 2.00 as the threshold to judge the significance of gene expression difference. GO function and KEGG pathway analysis were then carried out in the differentially expressed genes.
Metabolome
Serum samples (40 µl, including QC samples) were added to new Eppendorf tubes with ice-cold methanol (120 µl), vortex mixed for 1min, placed in holding for 30min at -20 °C, and centrifuged at 4000 g for 20 min at 4 °C. 25 µl of supernatant and 225 µl 50% methanol were mixed. Then 20 µl of mixture from each sample were mixed as quality control samples, 60 µl of mixture was conducted as samples. All samples were stored at -80 °C (ten biological replicates for each group).
All samples were acquired by the LC-MS system followed machine orders. Firstly, all chromatographic separations were performed using an ultra performance liquid chromatography (UPLC) system (Waters, USA). An ACQUITY UPLC BEH C18 column (100mm*2.1mm, 1.7μm, Waters, USA) was used for the reversed phase separation. The column oven was maintained at 50 °C. The flow rate was 0.4 ml/min and the mobile phase consisted of solvent A (water + 0.1% formic acid) and solvent B (acetonitrile + 0.1% formic acid). Gradient elution conditions were set as follows: 0-2 min, 100% phase A; 2-11 min, 0% to 100% B; 11-13 min, 100% B; 13-15 min, 0% to 100% A. The injection volume for each sample was 10 μL.
A high-resolution tandem mass spectrometer SYNAPT G2 XS QTOF (Waters, USA) was used to detect metabolites eluted form the column. The Q-TOF was 6/13 operated in both positive and negative ion modes. For positive ion mode, the capillary and sampling cone voltages were set at 2 kV and 40 V, respectively. For negative ion mode, the capillary and sampling cone voltages were set at 1 kV and 40V, respectively. The mass spectrometry data were acquired in Centroid MSE mode. The TOF mass range was from 50 to 1200 Da and the scan time was 0.2 s. For the MS/MS detection, all precursors were fragmented using 20-40 eV, and the scan time was 0.2 s. During the acquisition, the LE signal was acquired every 3 s to calibrate the mass accuracy. Furthermore, in order to evaluate the stability of the LC-MS during the whole acquisition, a quality control sample (Pool of all samples) was acquired after every 10 samples.
Statistical analysis was performed as previous [32]. Putative metabolites were first derived by searching the exact molecular mass data from redundant m/z peaks against the online HMDB (http://www.hmdb.ca/), METLIN (http://metlin.scripps.edu/) and KEGG (www.genome.jp/kegg/) databases. A specific metabolite was sieved out when a match with a difference between observed and theoretical mass was less than 10 ppm. Then the metabolite molecular formula of matched metabolites was further identified by the isotopic distribution measurement.
Real-time Quantitative PCR
Primers were designed with Primer 5.0 software based on the sequences which was obtained from transcriptome sequencing data of mandarin fish, and synthesized by Sangon (Shanghai, China) (Table 5). Several housekeeping gene including beta-actin, b2m, rpl13a, and hmbs were selected according to the literature [33]. Rpl13a gene was more stable and amplified as the internal control. Real-time quantitative PCR was carried out with MyiQ™ 2 Two-Color Real-Time PCR Detection System (Bio-Rad, Hercules, USA). PCR was performed in a total volume of 20 μl containing 10 μl AceQ® qPCR SYBR® Green Master Mix (Vazyme, Piscataway, NJ, USA), 8.2 RNase Free H2O, 0.4 M of each primer and 1 µl cDNA. The PCR procedure parameters were 95 °C for 5 min, followed by 40 cycles of 10 sec at 95 °C, annealing temperature for 30 sec. Melt curve analysis was performed from 65 °C to 95 °C, gradually increasing 0.5 °C/6 sec, to verify the specificity. Reactions were performed in triplicate for each sample. Gene expression levels were quantified relative to the expression of rpl13a using the optimized comparative Ct (2-ΔΔCt) value method [34]. Data were presented as mean ± S.E.M with six biological replicates and three technical replicates.