Verification of the integration of the ZmMYB59 gene into the tobacco and rice genomes
The expression vector pCAMBIA3301-Bar-ZmMYB59 construct was transferred into immature embryos to gain transgenic tobacco and rice. The regeneration of somatic embryos and their conversion into plants was attempted to each transgenic line. The different stages of plant regeneration of stable transgenic lines were described in Fig. 1. T0 generation transgenic plants were continually self-pollinated until T2 generation. Then, to validate the presence of the ZmMYB59 gene, T2 generation transgenic tobacco and rice were tested by PCR amplification, wild-type was as negative control, ZmMYB59 gene was as positive control. PCR products were tested by agarose gel electrophoresis. In tobacco, the result of electrophoresis showed that 18 of 22 transgenic lines were consistent with the positive control (Additional file 1: Figure S1). In rice, the results suggested that 16 of 19 lines were successfully transformed (Additional file 1: Figure S2). During all electrophoretic bands, three over-expression lines were selected to be employed in this study (OE1, OE2, OE3 in tobacco, OE2, OE4, OE6 in rice), which was showed in Fig. 2a, 2b.
Effect of ZmMYB59 expression on seed germination
To reveal the effect of ZmMYB59 on seed germination, germination experiment was performed in both wild-type and three independent homozygous transgenic lines (Table 2). In T2 generation transgenic tobacco, germination rate, germination index, vigor index and hypocotyl length were significantly decreased by 25.0 ~ 50.9%, 34.5 ~ 54.4%, 57.5 ~ 88.3% and 21.9 ~ 31.2% compared to WT lines (Table 2, Fig. 3a). In T2 generation transgenic rice, germination rate, germination index, vigor index and mesocotyl length were significantly reduced by 39.1 ~ 53.8%, 51.4 ~ 71.4%, 52.5 ~ 74.0% and 28.3 ~ 41.5%, respectively (Table 2, Fig. 3b). The above results suggested that ZmMYB59 played a negative regulatory role in the process of seed germination. Meanwhile, it can be seen that the most affected lines by ZmMYB59 were OE2 of tobacco, OE2 of rice (Table 2). Therefore, the above two corresponding transgenic lines were screened out for follow-up experiments.
Table 1 The nucleotide sequences of the primer pairs used to identify the PCR products of expressed ZmMYB59 gene
primer
|
sequence(5'- 3')
|
Tm (℃)
|
Product size (bp)
|
ZmMYB59-F
|
ATTGAGCTCCATGCTCGGTG
|
60
|
580
|
ZmMYB59-R
|
TAGCTGAGTGGCCTGACCAA
|
60
|
Table 2
Measurement of phenotypic indexes of wild-type and ZmMYB59 transgenic plants
Species | Lines | Germination rate (%) | Germination index | Vigor index | Hypocotyl/Mesocotyl length (cm) |
Tobacco | WT | 91.7 ± 8.1 a | 2.61 ± 0.30 a | 105.94 ± 23.20 a | 0.32 ± 0.02 a |
OE1 | 51.0 ± 6.0 bc | 1.37 ± 0.18 b | 26.08 ± 5.38 bc | 0.23 ± 0.02 b |
OE2 | 45.0 ± 5.3 c | 1.19 ± 0.11 b | 12.42 ± 2.40 c | 0.22 ± 0.01 b |
OE3 | 68.8 ± 7.5 b | 1.71 ± 0.44 b | 45.05 ± 8.61 b | 0.25 ± 0.03 b |
Rice | WT | 58.0 ± 3.4 a | 1.40 ± 0.03 a | 40.04 ± 6.10 a | 0.53 ± 0.07 a |
OE2 | 26.8 ± 4.2 b | 0.40 ± 0.01 c | 10.43 ± 3.20 b | 0.31 ± 0.01 b |
OE4 | 35.3 ± 8.6 b | 0.68 ± 0.08 b | 19.01 ± 8.25 b | 0.38 ± 0.10 b |
OE6 | 28.7 ± 6.3 b | 0.49 ± 0.04 c | 13.85 ± 5.37 b | 0.33 ± 0.08 b |
Note: WT and OE represent wild-type and ZmMYB59 transgenic plants, respectively. Means with standard deviations that do not followed by the same lower case letter between OE and WT lines significantly differ by ANOVA analysis at 5% level of significance. |
Effect of ZmMYB59 expression on antioxidant capacity
To investigate whether ZmMYB59 expression decreases antioxidant capacity, the contents of malondialdehyde (MDA), proline content and the activities of CAT, POD, SOD and APX were measured (Table 3). Compared to WT lines, the MDA content of OE2 tobacco and OE2 rice was enhanced by 21.4% and 8.0%, respectively. However, there were no significant differences between transgenic and WT lines. Compared to WT lines, the proline content of OE2 tobacco and OE2 rice was significantly reduced by 60.5%, 10.9%, respectively. Moreover, in T2 generation transgenic tobacco of OE2, the activities of CAT, POD, SOD and APX were significantly decreased by 46.2%, 25.3%, 18.9%, 29.0%, respectively. In T2 generation transgenic rice of OE2, the above enzymatic activities were decreased by 12.8%, 19.4%, 43.5%, 59.8%, respectively. These result proposed that the ZmMYB59 significantly decreased antioxidant capacity of transgenic tobacco and rice, which was generally consistent with the results of germination experiment.
Table 3
Measurement of antioxidant capacity of wild-type and ZmMYB59 transgenic plants
Species | Lines | MDA (µmol/g) | Proline (µg/g) | CAT (U/g·min) | POD (U/g·min) | SOD (U/g) | APX (U/g·min) |
Tobacco | WT | 22.8 ± 2.0 a | 97.1 ± 14.0 a | 318.0 ± 39.0 a | 125.6 ± 8.0 a | 88.2 ± 10.0 a | 50.4 ± 9.0 a |
OE2 | 27.7 ± 3.0 a | 38.3 ± 10.0 b | 171.1 ± 9.0 b | 93.8 ± 6.0 b | 71.5 ± 3.0 b | 35.8 ± 4.0 b |
Rice | WT | 116.9 ± 7.2 a | 18.3 ± 0.4 a | 10.9 ± 0.2 a | 48.9 ± 3.6 a | 53.3 ± 1.4 a | 10.4 ± 0.3 a |
OE2 | 126.3 ± 1.6 a | 16.3 ± 0.3 b | 9.5 ± 0.1 b | 39.4 ± 2.2 a | 30.1 ± 2.5 b | 4.2 ± 0.1 b |
Note: WT and OE represent wild-type and ZmMYB59 transgenic plants, respectively. MDA, CAT, POD, SOD, APX represent malondialdehyde, catalase, peroxidase, superoxide dismutase, ascorbate peroxidase, respectively. Means with standard deviations that do not followed by the same lower case letter between OE and WT lines significantly differ by Student's t test at 5% level of significance. |
Effect of ZmMYB59 expression on cellular morphology
Considering that ZmMYB59 reduced hypocotyl/mesocotyl length, cellular morphology of hypocotyl/mesocotyl in tobacco and rice was observed in this experiment to determine whether and how MYB affects cell proliferation and elongation. This is indeed the case (Fig. 4, Table 4). In T2 generation transgenic tobacco of OE2, cell number and cell length of hypocotyl were significantly decreased by 22.2% and 42.7% compared to WT lines (Fig. 4a, 4b). In T2 generation transgenic rice of OE2, cell number and cell length of mesocotyl were significantly decreased by 23.8% and 17.5% (Fig. 4c, 4d). The above results suggested the decrease of hypocotyl/mesocotyl length caused by ZmMYB59 was attributed to the inhibition of cell growth including cell number and cell length.
Table 4
Measurement of cell length and cell number of wild-type and ZmMYB59 transgenic plants
Species | Lines | Cell number | Cell length (µm) |
Tobacco | WT | 18.0 ± 0.1 a | 103.8 ± 14.0 a |
OE2 | 14.0 ± 0.1 b | 59.5 ± 5.0 b |
Rice | WT | 22.0 ± 0.6 a | 242.1 ± 7.1 a |
OE2 | 15.8 ± 1.0 b | 199.6 ± 30.7 b |
Note: WT and OE represent wild-type and ZmMYB59 transgenic plants respectively. Means with standard deviations that do not followed by the same lower case letter between OE and WT lines significantly differ by Student's t test at 5% level of significance. |
Effect of ZmMYB59 expression on content of phytohormone
To investigate the influence of ZmMYB59 expression on endogenous phytohormones during seed germination, the contents of ABA, IAA, GA1, GA3, GA4, CTK in hypocotyl/mesocotyl were determined. In T2 generation transgenic tobacco of OE2, compared to WT lines, the contents of endogenous GA1, GA3, GA4, IAA, CTK were reduced by 39.2%, 29.4%, 15.4%, 7.5% and 44.8%, whereas the content of ABA was increased by 43.9% (Table 5). In T2 generation transgenic rice of OE2, the contents of endogenous GA1, GA3, GA4, IAA and CTK were decreased by 47.6%, 22.2%, 24.3%, 10.0% and 37.8%, whereas the content of ABA was increased by 26.9% (Table 5). Among them, the changes of endogenous GA1, CTK and ABA reached significant level while there were no significant changes in those of endogenous GA3, GA4 and IAA. These results indicated that the expression of ZmMYB59 might have contributed to the promotion of endogenous GA1 and CTK synthesis and the inhibition of endogenous ABA synthesis.
Table 5
Measurement of phytohormone contents in wild-type and ZmMYB59 transgenic lines
Species | Lines | GA1 (ng/g) | GA3 (ng/g) | GA4 (ng/g) | CTK (ng/g) | IAA (ng/g) | ABA (ng/g) |
Tobacco | WT | 0.166 ± 0.022 a | 0.187 ± 0.035 a | 0.123 ± 0.016 a | 18.544 ± 2.152 a | 1.657 ± 0.528 a | 4.832 ± 0.486 b |
OE2 | 0.101 ± 0.013 b | 0.131 ± 0.028 a | 0.104 ± 0.010 a | 10.234 ± 0.989 b | 1.532 ± 0.472 a | 6.951 ± 0.349 a |
Rice | WT | 0.187 ± 0.029 a | 0.202 ± 0.030 a | 0.169 ± 0.046 a | 45.142 ± 5.317 a | 1.914.±0.355 a | 7.235 ± 0.561 b |
OE2 | 0.098 ± 0.021 b | 0.157 ± 0.042 a | 0.128 ± 0.057 a | 28.085 ± 3.391 b | 1.722 ± 0.863 a | 9.179 ± 0.380 a |
Note: WT and OE represent wild-type and ZmMYB59 transgenic lines, respectively. GA, CTK, IAA, ABA represent gibberellin, cytokinin, indole-3-acetic acid, abscisic acid, respectively. Means with standard deviations that do not followed by the same lower case letter between OE and WT lines significantly differ by Student's t test at 5% level of significance. |