Animals
All mice were housed in individually ventilated cages (3-4 littermates per cage) at standard housing conditions (22°C, 12 h light/dark cycle), with ad libitum access to chow (KlibaNafag, diet #3436 and diet #3437) and water. Health status of all mouse lines was regularly monitored according to FELASA guidelines. All mouse lines were maintained on a C57BL/6J background: Pax7CreERT2 (Jackson labs stock no: 017763), RosamTmG (Jackson labs stock no: 007576) and RosaCAG-LSL-ntdTomato (Ai75D, Jackson labs stock no: 025106). RosamTmG and RosaCAG-LSL-ntdTomato mice were intercrossed with Pax7CreERT2 mice to generate Pax7CreERT2/+; RosamTmG/+ (Pax7mTmG/+) and Pax7CreERT2/+; RosaCAG-LSL-ntdTomato/+ (Pax7nTom/+). All mice used in this study were female. At the age of 15 weeks, mice received tamoxifen via intraperitoneal injection at a dose of 1.0 mg/day for 5 days to induce Cre-mediated recombination and a washout period of 7 days was allowed before experiments were initiated.
Experimental procedures
All animal procedures were approved by the Veterinary office of the Canton of Zürich (license nr. ZH254-16). Mice were individually housed in open cages equipped with a running wheel device (TSE Systems, Bad Homburg vor der Höhe, Germany) for the duration of the intervention. Non-running control mice were also singly housed in cages of equal dimensions, but without running wheels. The running wheel device continuously records wheel movements out of which total distance (km), speed (m.s-1), number of running bouts and resistance on the wheel (N) were extracted. Additionally, to increase the force needed to rotate the wheel, resistance (0-100%) can be added. To calculate total external work we used the equation where W is work, P is power, and t time. To calculate the Power of the wheel at each braking resistance we used the equation where f is the angular frequency of the wheel, and M is the torque at a given braking resistance. TSE Systems provided a torque braking resistance curve. Mice were randomized in three groups: sedentary controls (no running), voluntary low load endurance wheel running where there is no extra resistance on the wheel (VRun) and voluntary high load resistance wheel running where extra resistance is placed on the wheel (VResRun). A representation of the study design is shown in Figure 1A. Prior to the 8 weeks of voluntary wheel running, both groups VRun and VResRun were familiarized for 5 days to the running wheel without extra resistance. After familiarization, the VResRun group was subjected to a progressive weekly increase in resistance on the wheel: The load on the wheel was 50% in week 1, 60% in week 2, 70% in week 3, 72% in week 4, and 74% from week 5 to 8. The minimal distance which mice needed to run was set at 2km per night. In case a mouse did not reach 2km for 2 consecutive nights, resistance was slightly reduced for 3 nights after which it was raised again. All mice ran at 74% resistance during the last 2 weeks.
Sample Collection
Tissue collection was performed 24 h fter the last exercise session after a 4 h fast. Mice were anaesthetized using Ketamine (80-100 mg/kg), Xylazine (10-15 mg/kg) and Acepromazine (2-5 mg/kg) via intraperitoneal injection 5 min before sacrifice. The depth of anesthesia was confirmed by testing pedal withdrawal reflex. Subsequently, the m. soleus (SOL), m. plantaris (PLT), m. gastrocnemius (GAS), m. tibialis anterior (TA), and m.extensor digitorum longus (EDL) were harvested, weighed and frozen in OCT embedding matrix (CellPath) in liquid nitrogen-cooled isopentane for histochemical analysis or fixed in 4% PFA for single myofiber isolation. Tibia length was assessed by a digital caliper. After sample collection, animals were euthanized and major bleeding was induced to confirm death.
Immunofluorescence
Frozen sections (10µm) of muscle embedded in OCT of mid-belly level were made using a cryostat (Leica CM 1950) and collected on Superfrost Ultra Plus slides (Thermo Scientific, Zug, Switzerland). The following antibodies were used: anti-MyHC-I (1:50 dilution, BA-F8 from hybridoma, Iowa City, IA, USA), anti-MyHC-IIa (1:200 dilution, SC-71 from hybridoma), anti-MyHC-IIb (1:100 dilution, BF-F3 from hybridoma), anti-laminin (1:200 dilution, PA1-16730, ThermoFisher), anti-PCM1 (1:1000 dilution, HPA023370, Sigma, Buchs, Switzerland), Alexa Fluor 488 goat anti-mouse IgG2B (1:250 dilution, ThermoFisher), Alexa Fluor 350 goat anti-mouse IgG1 (1:250 dilution, A-21120, ThermoFisher), Alexa Fluor 568 goat anti-mouse IgM (1:250 dilution, A-21043, ThermoFisher), Alexa Fluor 647 goat anti-rabbit IgG (1:250 dilution, A-21244, ThermoFisher). Alexa Fluor 568 goat anti-mouse IgG1 (1:400 dilution, A-21124, ThermoFisher), Alexa Fluor 647 conjugated wheat germ agglutinin (WGA, 1:50 dilution, W32466, ThermoFisher).
Immunohistochemical muscle fiber staining was conducted as previously described [27]. In short, sections were dried and washed for 5 min in PBS supplemented with 0.05% Triton-X-100 (PBST) and subsequently blocked for 60 min in PBST + 10% goat serum (16210064, ThermoFisher). Afterwards a primary antibody cocktail diluted in PBST + 10% goat serum was applied for 120 min against MyHC-I, MyHC-IIa, MyHC-IIb and laminin. After washing 3 times for 5 min, a secondary antibody cocktail, diluted in PBST + 10% goat serum, was applied for 60 min. Slides were mounted after a 3 x 5 min wash and sealed with glass cover slips. For myonuclear staining, samples were stained with anti-PCM1 as previously described [28]. Slides were pre-incubated in 2% BSA in PBS. Sections were stained with a rabbit polyclonal antibody against PCM1 in staining solution (5% BSA in PBS, 0.2% Triton-X-100) overnight at 4°C. The next day, the sections were washed three times for 5 minutes in PBS and stained with an anti-rabbit secondary antibody in 2% BSA in PBS for 1 h. Sections were washed three times for 10 minutes with PBS. For detection of the fiber boundaries, the sections were stained with WGA in PBS for 30min. Nuclei were co-stained using Hoechst dye 33342 (dilution 1:5000, H3570, ThermoFisher).
Images from sections were captured at 10x using an epifluorescent microscope (Zeiss Axio observer Z.1, Zeiss, Oberkochen, Germany). Composite images were stitched together using the Tiles module in the ZEN 2011 imaging software (Zeiss). All images were captured at the same exposure time. Approximately 100 (SOL, PLT) and 200 (GAS) muscle fibers, divided in different regions over the whole muscle section, were analysed for PCM1+/Hoechst+ nuclei with Zen software (ZEN 2011 imaging software, Zeiss).
Satellite cell contribution to myofibers in Pax7mTmG/+ mice was quantified based on a previously described method of myofiber masking [29]. Tilescan images were processed using an Image-J plug-in to define myofiber cross-sectional area (CSA) [30], followed by a manual refinement of the CSA outlines. An overlay of those outlines on the corresponding mGFP image was performed, after which the data was compiled in Excel and a threshold was set for the mean gray value of mGFP. A frozen section isolated from a vehicle treated mouse (negative control sample) was used to determine the threshold and to ensure the elimination of autofluorescence. mGFP images were overlaid with the muscle fiber type staining to identify mGFP+ oxidative (MyHCI) and glycolytic (MyHCIIa, MyHCIIb and MyHCIIx) fibers.
Single myofiber isolation
For single myofiber analysis, the SOL from the Pax7nTom/+ mice was harvested, fixed in 4% paraformaldehyde/PBS for 1h at 4°C, and transferred to PBS containing 2% horse serum. To release individual myofibers, single fibers were mechanically teased apart, strained, and washed with PBS. Isolated single myofibers were stained with Hoechst for nuclear visualization and gently mounted on a glass coverslip. Images were captured at 10x using a confocal microscope (Olympus olympus fluoview FV 3000, Olympus, Hamburg, Germany). Eleven to sixteen fibers per mouse from random areas from the muscle were analyzed. Total number of nTom+ nuclei and Hoechst+ nuclei along 500 µm fiber length were quantified using a spot detection algorithm developed in Imaris (Bitplane). Myofiber volume was approximated as the volume of a cylinder using the average radius measured along the fiber length in Imaris. Fibers isolated from vehicle-treated mice were used to set a threshold to ensure the elimination of autofluorescence.
Cell culture
Reagents: Freshly isolated primary myoblasts were cultured in growth medium, which contained a 1:1 ratio DMEM (ThermoFisher Scientific, 12320032) and Ham’s F-10 nutrient mix (ThermoFisher Scientific, 22390058) supplemented 20% FBS (Thermo Scientific, 10270106) and 10 ng/ml basic-FGF (ThermoFisher Scientific, PHG0266). Cells were differentiated in low-serum differentiation medium (Thermo Scientific, 41965039), supplemented with 2% horse serum (Thermo Scientific, 16050-122). Cells were routinely cultured in 21% O2 and 5% CO2. Every other day, differentiation medium was changed until myotubes reached full differentiation. All media were supplemented with 100 units/ml penicillin and 100 μg/ml streptomycin.
Isolation of SCs/myoblasts: Isolation of SCs/myoblasts was done as previously described [31]. Briefly, muscle tissue was digested in Hank's Balanced Salt Solution (HBSS, Thermo Fisher, 24020117) supplemented with 1.5% bovine serum albumin (BSA) and 2 mg/mL collagenase type II (ThermoFisher Scientific, 17101015) for 1 h at 37 °C. After centrifugation, the cell pellet was then filtered using 100 and 40 µm cell strainers and a heterogeneous cell population was purified by FACS sorting or by serial preplating. For FACS, SCs were sorted based on positive alpha 7-integrin (1:100, R&D Systems FAB3518P) and absence of Sca1 (1:1000, Bio-Legend 122511), CD31 (1:1000, Bio-Legend, 102413), and CD45 (1:1000, Bio-Legend 103121).
Generation of nuclear H2B-GFP (H2B-nGFP) myoblasts: Lentivirus was generated with PEG-it Virus Precipitation Solution (System Biosciences, Palo Alto, CA, USA no LV810A-1) using a LV H2B-GFP plasmid (Addgene no 25999) in HEK 293 cells. Myoblasts were transfected with 20µl of concentrated lentivirus for 24h using growth medium supplemented with 4μg/ml polybrene transfection reagent (TR1003-G, Sigma-Aldrich).
Co-culturing experiments: nTom+ myoblasts, together with committed WT myoblasts were co-cultured at 1:4 ratio (nTom+/WT). nTom+ myoblasts were co-cultured with myoblasts stably expressing H2B-nGFP at a ratio of 1:1 ratio (nTom+/H2B-nGFP+). Two hours after seeding, growth medium was changed to differentiation medium. Every other day, differentiation medium was changed until myotubes reached full differentiation and immunofluorescent images were taken every 24h via an epifluorescent microscope, equiped with a cell incubator (Nikon eclipse Ti2, Nikon, Amstelveel, Netherlands). Fluorescent pictures were captured every 15 min to generate a time-lapse video (Windows movie maker, Windows, Redmond, WA, US).
SC fate tracing at the DNA level using RT-PCR for Cre-mediated recombination in bulk muscle and sorted myonuclei
To perform SC fate tracing at the DNA level, genomic DNA was isolated from muscle or myonuclei using QIAamp DNA Micro and Mini Kit (Qiagen, Hilden, Germany). Myonuclei were isolated as previously described [32]. Nuclei were isolated with EZ PREP buffer (Sigma, NUC-101). Frozen soleus muscles (10 mg) were homogenized using a glass dounce tissue grinder in 2 ml of ice-cold EZ PREP and incubated on ice for 5 min, with an additional 2 ml of ice-cold EZ PREP and filtered through a 100 µm cell strainer. Nuclei were centrifuged at 500 × g for 5 min at 4 °C, washed with 4 ml ice-cold EZ PREP and incubated on ice for 5 min. After centrifugation, the nuclei were stained for 45 min with an antibody against PCM-1 (1:1500, HPA023370, Sigma), followed by an Alexa647-anti-rabbit secondary antibody for 30min (1:1500) and Hoechst 33342 (1:5000), and filtered through a 35 µm cell strainer. Hoechst+ and Alexa647+ myonuclei were directly sorted into RLTplus buffer (Qiagen). A final amount of 10,000-20,000 nuclei was used for genomic DNA isolation. A SYBR Green-based master mix (ThermoFisher Scientific, A25778) was applied for RT-PCR analysis. Recombination rates were calculated from the relative expression of recombined levels normalized to an internal control. The delta–delta CT method was used to normalize the data. The percentage recombination was calculated relative to positive controls. To generate a positive control, we crossed HSACreERT2 mice [33] with RosamTmG mice to generate HSACreERT2/+;RosamTmG/+ mice. In these mice, tamoxifen injection leads to the excision of mTomato from the DNA in myonuclei, and the subsequent expression of mGFP. Additionally, we sorted SCs from Pax7nTom/+ mice. The following primers were used to detect recombination (see also Figure 5A and 5D): RosamTmG, recombined amplicon: Fw GGGCTCGACACTAGTGAACC Rv GGTGATGATCCGGAACCCTT, Internal control: Fw AGCGAACGGACAGGAGAATG, Rv ACTTGTGGCCGTTTACGTCG, RosaCAG-LSL-ntdTomato, recombined amplicon: Fw TTATTGTGCTGTCTCATCATTTTGG Rv CTTCGCGAGACCGGTAATCT, Internal control: Fw ctgttcctgtacggcatgg Rv ggcattaaagcagcgtatcc.
Grip strength
Grip strength of the limbs was measured using a force tension apparatus (grip strength meter, Bioseb, Vitrolles, France) after 8 weeks of voluntary wheel running or no running. Mice were lifted by the tail and were made to hold a metal grid with all limbs. Total-limb maximal grip strength was registered in gram during three consecutive attempts, and the result was set as the average of the attempts.
Ex vivo muscle force assay
The SOL was carefully dissected and placed in Krebs–Henseleit buffer (120 mM NaCl, 4.8 mM KCl, 25 mM NaHCO3, 2.5 mM CaCl2, 1.2 mM KH2PO4, 2 mM MgSO4) supplemented with 25 mM glucose at 37°C and bubbled with 95% O2–5% CO2 to stabilize the pH at 7.4. The distal tendon was securely connected to a fixed bottom plate, and the proximal tendon to the arm of a servomotor (800A in vitro muscle apparatus, Aurora Scientific). Muscle length was adjusted until a single stimulus pulse elicited maximum force during a twitch (optimal length, Lo) under isometric conditions. After 15min of equilibration, a fatigue protocol was started. To fatigue the muscle, tetanic contractions of 60 Hz were produced, once every 2 s, for a total of 300 s. Time-to-fatigue at 75%, an assessment for the time it takes for a muscle to fall to 75% of its initial force, was calculated for every mouse.
Statistical analysis
Statistical significance was determined by a one-way ANOVA with Tukey correction for multiple comparisons or two-way ANOVA with Bonferroni correction with Graphpad Prism 8.2. Data are presented as means ± SEM, and values of p < 0.05 were considered statistically significant. The degree of significance is depicted as follows: *p < 0.05, **p < 0.01, ***p < 0.001.