Complementary molecular tests: diagnosis of megaesophagus with conventional nonreactive or inconclusive serology for Chagas disease

doi:10.21203/rs.3.rs-1991832/v1

Download PDF

Research Article

Complementary molecular tests: diagnosis of megaesophagus with conventional nonreactive or inconclusive serology for Chagas disease

https://doi.org/10.21203/rs.3.rs-1991832/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The current laboratory diagnosis of chronic Chagas disease (CD) relies on two serological tests based on distinct principles (ELISA, HAI, or IFI), which may yield false-positive and false-negative results. Blood culture (BC) can also be used as a diagnostic method, but its sensitivity in the chronic phase is limited. To assist in the outcome of a possible diagnosis of CD in cases of adult patients in which serological methods have conflicting or inconclusive results, both conventional and quantitative molecular methods have been used, especially the polymerase chain reaction (PCR) technique. This study aimed to evaluate the performance of qualitative and quantitative molecular methods for diagnostic purposes in patients with megaesophagus and nonreactive or inconclusive conventional serology for CD.

Methods: This was a prospective cohort study of 26 participants with negative or inconclusive conventional serology for CD and 33 participants with positive serology who were treated at a referral center from 2010–2011. Peripheral blood samples were collected intravenously at the same time for serological (ELISA and IFI), BC and molecular tests such as qualitative PCR, targeting the Sat-DNA and kDNA of T. cruzi and quantitative PCR (qPCR).

Results: For the BC method, the results were negative in all cases in Group I and positive in five cases (21.73%) in Group II, with no statistically significant difference between the groups. For the molecular methods, positivity in relation to the kDNA target was 45.83% for Group I and 33.33% in Group II; for the Sat-DNA target, it was 76.29% in Group I and 63.63% in Group II, with a significant difference.

Conclusion: Molecular tests can be used in nonreactive or inconclusive serological results and can be useful to confirm Chagas disease in cases of megaesophagus and nonreactive or inconclusive conventional serology for CD.

Chagas disease

megaesophagus

nonreactive serology

molecular tests

Chagas disease (CD), or South American trypanosomiasis, is caused by the protozoan Trypanosoma cruzi (T. cruzi), first described in 1909 by Carlos Chagas (1). This disease is classified by the World Health Organization (WHO) as the third most neglected after malaria and schistosomiasis (2, 3). More than a century after its discovery, CD still affects 5–6 million individuals in several Latin American countries and is one of the main causes of sudden death, arrhythmias, and heart failure (4), persisting with high rates of morbidity and mortality (5, 6).

CD is an infectious condition that has two phases: acute and chronic. In the first weeks, the disease occurs in its acute form, causing fever, fatigue, and malaise, with potential severe clinical conditions of meningoencephalitis or myocarditis. However, in most cases, it is asymptomatic (6). In the chronic phase, decades after infection, individuals may develop complications resulting from direct injury of the parasite, inflammation, fibrosis of affected organs, or neurovegetative lesions. In 10% of infected persons, alterations occur in the digestive tract with megaesophagus or megacolon, constituting the clinical digestive form of CD (7). This group comprises approximately two million individuals in Brazil (8). Chronic CD also affects the heart in 30% of infected individuals.

Megaesophagus is the most frequent manifestation of the clinical digestive form of chronic CD. Its typical symptoms are dysphagia and regurgitation, similar to those that occur in idiopathic (primary) achalasia and other causes of esophageal dilatation, requiring etiological diagnosis capable of distinguishing between those situations (9, 10, 11).

Parasitological, serological and, more recently, molecular tests are used to determine the diagnosis of CD, with limitations inherent to each method (12). Direct and indirect parasitological tests (xenodiagnosis and blood culture) have high specificity but low sensitivity in the chronic phase of CD and are not commonly available for this diagnosis (13, 14). Serology is an eligible and available method for diagnosing CD, especially in the chronic phase, but it has limitations in sensitivity and specificity, and false-negative and false-positive results may occur (15, 16). This has been verified in cases of megaesophagus, in which the clinical and epidemiological markers are compatible with CD, yet the serological tests are permanently negative, making it difficult to differentiate it from other etiologies. In the 1990s, with the advent of molecular methods, polymerase chain reaction (PCR) started being used for the diagnosis of T. cruzi infection (17, 18) as the best option for this purpose. Qualitative PCR (qPCR) was used to define the etiology of T. cruzi in a group of individuals with megaesophagus and negative serology for CD, with DNA amplification detected by N-PCR in 76% of the samples, especially those with positive epidemiology for CD (18).

More recently, the molecular method has made it possible to quantify T. cruzi DNA by qPCR, indicating an advance in the diagnosis of CD in some situations, according to the stage of the disease and available protocols (19, 20). Sensitivity to identify parasite DNA in CD by qPCR ranges from 60 to 80% in the chronic phase and from 88 to 100% in the acute phase (21, 22).

Considering that megaesophagus is a clinical marker for CD, this study correlated the performance of PCR and qPCR molecular tests for the diagnosis of CD in individuals with megaesophagus and nonreactive or inconclusive serology for T. cruzi.

2.1 Study design

This was a prospective cohort study in patients with megaesophagus with nonreactive or inconclusive serology for CD monitored by the Study Group on Chagas Disease (GEDoCh), University of Campinas (UNICAMP) – Brazil. Following explanations, participants signed an informed consent form. The study was approved by the Research Ethics Committee of UNICAMP (process no. 779/2007). All procedures complied with the guidelines and standards for research with human beings, as provided in Resolution No. 466/2012 of the Brazilian National Health Council and the principles of the Declaration of Helsinki, to safeguard the rights and well-being of the participants.

2.2 Sampling

Group I (experimental group): 26 adult patients of both sexes, diagnosed with megaesophagus and with nonreactive or inconclusive serology for CD;

Group II (control group): 33 adult patients of both sexes, diagnosed with megaesophagus and with reactive and positive serology for CD.

2.3 Biological material

Peripheral blood samples were collected intravenously at the same time for serological, blood culture and molecular testing. For the serological tests, 4.0 ml of peripheral blood was collected in vacuum tubes with clot activator, which were processed in a clinical analysis laboratory at UNICAMP. The enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence (IFI) methods were performed following the guidelines of the II Brazilian Consensus on Chagas Disease (2), which recommends the performance of two tests with different methods for the diagnosis of CD.

For blood culture (BC), five vacuum tubes containing EDTA were collected, resulting in 20 ml of peripheral blood. These tubes were centrifuged at 3,500 rpm for 10 min at 4°C. Then, the plasma was discarded, and the remaining red blood cells and buffy coat were washed in liver infusion tryptose (LIT) culture medium and transferred to Falcon^® tubes. They were centrifuged again, and all new supernatant was transferred to a sixth Falcon^® tube. LIT was added to the remaining parts until the volume reached 10 ml. Therefore, six tubes of BC were obtained from each participant, which were kept in an oven at 28°C. The reading was performed by ordinary optical microscopy once a fortnight until positive results or 150 days of incubation had been reached.

Molecular testing involved the performance of qualitative PCR, targeting the Sat-DNA and kDNA of T. cruzi and quantitative PCR (qPCR). A 4.0 ml volume of peripheral blood was collected in a vacuum tube containing EDTA. For genetic material isolation, the blood sample was centrifuged at 3,500 rpm for 15 minutes at a temperature of 4°C, and a buffy coat was obtained. The High Pure PCR Template Preparation kit (Roche)^® was used, following the manufacturer’s recommendations. After extraction, the genetic material was stored at −20°C until use for the molecular reactions.

2.4 Gene amplification

The integrity of the extracted genetic material was verified by amplification of the human β-globin gene. For this amplification, 400 ng of DNA, 50 mM of KCl, 10 mM of Tris-HCl pH 8.4, 2.5 mM of MgCl2, 200 mM of dNTPs, 0.1 mM of each oligonucleotide and 2 U of Taq DNA polymerase were added to microcentrifuge tubes. P3/P5 oligonucleotides were used for the first reaction, and P5/109 was used for the second (Table 1). The reactions were carried out under the following conditions: 1st cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 55°C and 1 min at 72°C. The final extension was performed at 72°C for 7 min. Amplicons found were 365 base pairs (bp).

For amplification of the Sat-DNA gene (Nested-PCR), 1.0 μL of DNA, 50 mM of KCl, 10 mM of Tris-HCl pH 8.4, 2.5 mM of MgCl₂, 200 mM of dNTPs, 0.1 mM of each TCZ1/TCZ2 oligonucleotide and 2 U of Taq DNA polymerase were added to microcentrifuge tubes, up to a final volume of 20 μl. For the second reaction, 1.0 μl of the previously amplified product was used as a template, with alterations for the concentration of 2.8 mM MgCl₂ and for TCZ3/TCZ4 oligonucleotides. The amplicon was 149 bp (Table 1). The amplification cycles were differentiated for the two reactions. Both were preceded by initial denaturation at 94°C for 5 min, and the final extension was performed at 72°C for 7 min. In the first reaction, the first 5 cycles were 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min and 30 s. The next 25 cycles were 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min and 30 s. In the second reaction, 25 cycles were performed under the following conditions: 94°C for 40 s; 55°C for 40 s; and 72°C for 1 min.

For amplification of the kDNA gene (Nested-PCR), 1.0 μL of DNA, 50 mM of KCl, 10 mM of Tris-HCl pH 8.4, 4 mM of MgCl2, 200 mM of dNTPs, 0.1 mM of each S67/S35 oligonucleotide and 2 U of Taq DNA polymerase were added to microcentrifuge tubes for a final volume of 30 μl. For the second reaction, 1.0 μl of the previously product was amplified, and S35/S36 oligonucleotides were used (Table 1). The amplicon was 330 bp. The amplification cycles were differentiated for the two reactions. Both were preceded by initial denaturation at 94°C for 5 min, and the final extension was performed at 72°C for 7 min. In the first reaction, 35 cycles were used: 94°C for 1 min; 56°C for 1 min; and 72°C for 1 min. In the second reaction, 35 cycles were performed under the following conditions: denaturation: 94°C for 30 s; 63°C for 45 s; and 72°C for 1 min.

For absolute amplification (qPCR), the points of the standard curve were obtained from counting in a Neubauer chamber of trypomastigote forms of T. cruzi originating from BC, with the concentration adjusted to 10⁷ parasites/ml. A blood sample from an individual without CD was contaminated with the known concentration, and from this aliquot, gene isolation was performed with the High Pure PCR Template Preparation kit (Roche^®). Then, serial dilutions (10X) of the genetic material were made at concentrations from 10⁶ to 10⁻² parasites/ml. These diluted points were used in triplicate to build the standard curve of the qPCR.

For the real-time amplification reaction, TaqMan^® Universal Master Mix with UNG (Applied Biosystems) 1X, 500 nM of each oligonucleotide (Cruzi 1/Cruzi 2), 200 nM of the probe (Cruzi 3) and RNaseP (Applied Biosystems) 0.1X and 5 µL of DNA were added to a microcentrifuge tube for a final volume of 50 μl. All points used for building the standard curve (10⁶ to 10⁻² parasites/ml) were amplified in triplicate, and DNA from clinical samples was amplified in duplicate.

The qPCR was performed in Rotor-Gene 6000 (Corbett Life Science) equipment under the following conditions: first cycle of 2 min at 50°C, second cycle of 10 min at 95°C cycling (45 times): 15 s at 95°C and 60 s at 58°C. To avoid carryover contamination, the TaqMan^® Universal Master Mix kit containing AmpErase^® UNG was used. The recombinant UNG enzyme is capable of degrading preamplified DNA fragments, preventing their reamplification and consequent false-positive results. The human RNaseP gene was used as an internal control for the amplification reaction. The absence of contaminants in the reagents was ensured by the use of an NTC sample, which did not contain the target sequence. Real-time absolute quantification data were generated by Rotor-Gene 1.7.87 software.

Table 1. Nucleotide sequence of genes for each gene amplification.

Gene	Denomination	Nucleotide sequence	Identification
β-globin	P3 P5 109	5’AGACAGAGAAGACTCTTG 3’ 5’TCATTCGTCTGTTTCCCATTC3’ 5’CCCTTCCTATGACATGAACTTAACCAT 3’	PMID: 2999980
Sat-DNA	TCZ1 TCZ2 TCZ3 TCZ4	5’CGAGCTCTTGCCCACACGGGTGCT3’ 5’CCTCCAAGCAGCGGATAGTTCAGG3’ 5’TGCTGCA(G/C)TCGGCTGATCGTTTTCGA3’ 5’CA(A/G)G(C/G)TTGTTTGGTGTCCAGTGTTGTGA3’	PMID: 2504769 PMID: 8644910
kDNA	S67 S35 S36	5’TGGTTTTGGGAGGGG(C/G)(G/C)(T/G)TCAA(A/C)TTTT3’ 5’AGTACGTAGAG(T/G)GGGCATGTAATAAA3’ 5’GGGTTCGATTGGGGTTGGTGdT3’	PMID: 20169193 PMID: 2565018
qPCR	Cruzi 1 (forward) Cruzi 2 (reverse) Cruzi 3 (probe)	5′-AST CGG CTG ATC GTT TTC GA-3 ′ (S = G ou C) 5′-AAT TCC TCC AAG CAG CGG ATA-3 ′ 5′-6-FAM-CAC ACA CTG GAC ACC AA-BBQ quencher-3 '	PMC3019106

2.5. Statistics

A descriptive analysis was used with the presentation of frequency tables for categorical variables. To compare proportions, the chi-square test or Fisher’s exact test was used when necessary. To compare proportions evaluated by the two methods, McNemar’s test was used. As a measure of agreement between the methods, the kappa coefficient was applied. The magnitude of the coefficient is defined as follows: values greater than or equal to 0.75 indicate excellent agreement, values between 0.75 and 0.40 indicate good agreement and values below or equal to 0.40 indicate no agreement. The significance level adopted for the statistical tests was 5%.

3.1. Serology

The serological tests for CD confirmed the study groups, with nonreactive or inconclusive results for individuals in Group I and positive results for those in Group II.

3.2. Blood culture

In Group I, blood culture tests were performed in 24 patients (92.30%) and were negative in all cases (100%). In Group II, BC tests were performed in 23 patients (69.69%), being positive in five cases (21.73%) and negative in 18 (78.27%). The results showed a statistically significant difference (Table 2).

Table 2

Blood culture results for Groups I and II.
	Positive	Negative	Positivity ^&	NP *
Group I	0–0%	24–100%	0	2
Group II	5–21.73%**	18–78.26%	58	10

^** p < 0.05; ^& = means in days; * = No Procedure.

3.3. Qualitative molecular tests

In Groups I and II, β-globin was positive in all cases. Positivity for kDNA was 45.83% in Group I and 33.33% in Group II. Positivity for Sat-DNA was 76.29% in Group I and 63.63% in Group II. There was no statistical significance between the kDNA results for Groups I and II, the same being the case for the Sat-DNA results. Comparing the results of kDNA and Sat-DNA for Group I, there was greater positivity for the Sat-DNA target than for kDNA, the same occurring for Group II, with a statistically significant difference (Table 3).

Table 3

Conventional PCR results for Groups I and II.
Group	β-globin	kDNA			Sat-DNA
Group	Positive	Positive	Negative	NP*	Positive	Negative	NP*
I	26–100%	11–45.83%^**	13–54.16%	2	20–76.29%^**	6–23.07%	0
II	33–100%	9–33.33%^**	18–66.66%	6	21–63.63%^**	12–36.36%	0
* = No Procedure; ** = P < 0.05

3.4. Quantitative molecular tests

Graph 1 shows the amplification points used in the construction of the standard curve. The standard amplification curve presented parameters considered adequate for the reliability of the results. The efficiency obtained was 100% (ideal value between 95 and 100%), the slope was − 3.32 (ideal value = − 3.32), and R² was 0.98 (ideal value = 0.99). Linearity between points 10⁶ and 10⁰ parasites/ml resulted in a standard curve with seven points.

Graph 1. Standard curve for absolute quantification in parasites/ml.

In each reaction, patient samples were used in duplicate, in addition to an intermediate point of the standard curve and the negative control, which showed no amplification, ensuring that there was no contamination. Figure 2 shows some of the amplified samples. In each experiment, an intermediate point of the standard curve and NTC was included.

Graph 2. Absolute sample quantification and corresponding cycle thresholds.

For DNA amplification of blood samples from patients in Group I, the mean cycle threshold (Ct) observed was 38.85. No parasitic DNA was detected in five samples. The mean parasite load was 3.61 parasites/ml, and in only two samples, the quantification was above 1 parasite/ml of blood. For Group II, the mean Ct observed was 39.10. Table 4 shows the details. Detection was not possible in 13 samples. The mean Ct found for both groups was quite similar, indicating late amplification of the target sequence. There was statistical significance between Groups I and II (Table 4).

Table 4

qPCR results for Groups I and II.
Group	Detected	Undetected	Cycle Threshold	Mean concentration ^&	NP*
I	21–80.76%^**	5–19.23%	38.85	3.61	0
II	16–55.17%^**	13–44.82%	39.10	4.76	4
^& = parasite/ml; * = No Procedure; ** P < 0.05

Table 5 shows the correlation between BC and qualitative PCR for Sat-DNA and kDNA targets in quantity and percentage for both Groups I and II, based on qPCR.

Table 5. Correlation between qPCR and diagnostic methods for Groups I and II.

Group	qPCR	Sat-DNA	kDNA	BC
I	Detected (21–80.76%)	19–90.47%	17–80.95%	0–0%
I	Undetected (5–19.23%)	1–20%	2–40%	0–0%
II	Detected (16–55.17%)	9–56.25%	6–37.5%	4–25%
II	Undetected (13–44.82%)	10–76.62%	2–15.38%	1–7.69%
* In some samples, there was not enough material to carry out molecular tests.

Chagas disease (CD) causes heart failure, stroke, arrhythmia, sudden death and digestive problems and is still a public health problem, affecting 5–6 million people in Latin America (3). Despite advances in the control of vector and transfusion-transmitted CD, it is estimated that 13% of the population remains at risk of infection by T. cruzi in the 21 endemic countries of this region, with the largest number of cases found in Brazil, 42%, or approximately 1.2 million people (22). It is estimated that 7 to 10% of CD patients have megaesophagus, and seroprevalence in this population is 79% (15). Due to the complexity and clinical pleomorphism, some aspects of CD are not yet completely understood, including megaesophagus with nonreactive conventional serology for trypanosomiasis.

The patients included in this study had megaesophagus as a clinical marker, confirmed by radiological exams and positive epidemiology for CD, but with nonreactive or inconclusive conventional serology for trypanosomiasis, a distinctive condition compared with other megaesophagus etiologies, especially idiopathic achalasia. In these individuals (Group I), one cannot rule out CD as a megaesophagus etiology in view of the epidemiological, clinical, and radiological evidence suggestive of this disease. Indirect parasitological tests, such as xenodiagnosis and blood culture, could be used to elucidate the diagnosis. However, they are not practical to use due to poor availability, low sensitivity, difficult execution, and delayed results. Blood culture was used in this study for purposes of comparison with molecular tests, being positive in only five cases (21.73%) of individuals in Group II (Table 2). Blood culture was negative in all cases with megaesophagus and nonreactive or inconclusive serology for CD, not confirming Chagas disease in Group I individuals and thus prolonging diagnostic uncertainty (Table 2). Such low sensitivity of blood culture has been confirmed in the literature (23). Although they are not commonly used for CD diagnosis, indirect parasitological methods are able to detect T. cruzi parasitemia, with 100% specificity when positive, and serve as a confirmatory parameter for molecular tests, contributing to the diagnosis of cases in which conventional serology for CD is nonreactive or inconclusive (24).

The use of molecular biology techniques, started in the 1980s, led to significant advances in the diagnosis of parasitic and infectious diseases. A pioneering study in the use of PCR applied to the diagnosis of CD showed the amplification of a T. cruzi kDNA sequence by the qualitative method (25), and later, qPCR was described, making it possible to quantify the parasite load in peripheral blood samples (16). To date, qPCR has been used to confirm cases of CD reactivation and to monitor trypanosomicidal treatment to evaluate cure or therapeutic failure, in addition to the simple diagnosis of CD. It is more efficient, sensitive and reproducible than qualitative PCR to detect low parasite loads and may show equivalent levels of T. cruzi DNA below 1 parasite/ml (26, 27).

In this study, qualitative PCR and qPCR for T. cruzi were used in blood samples from individuals with megaesophagus and nonreactive or inconclusive conventional serology for CD, confirming the CD etiology of megaesophagus. Both Sat-DNA and k-DNA proved to be suitable targets for diagnostic purposes in the study groups when Sat-DNA was compared in Groups I and II, the same as kDNA, with no statistical significance (Table 3). However, when comparing the PCR results in Sat-DNa and k-DNA targets in Groups I and II, DNA identification was significantly higher when Sat-DNA was used (Table 3). This result is similar to what is found in the literature in studies that aimed to identify the most appropriate target for the amplification of parasite DNA, the most suitable being Sat-DNA (26). Thus, it is suggested that, in situations such as those of patients in Group I, qualitative PCR should target Sat-DNA to prove CD etiology.

The results showed the presence of T. cruzi DNA by qualitative PCR in most cases of the group of patients with megaesophagus and nonreactive or inconclusive conventional serology for CD, and it can be inferred that CD etiology was confirmed in these individuals, considering the positive epidemiology for CD and the clinical and radiological characteristics of megaesophagus. This would imply raising the possibility of underdiagnosis in situations of nonconfirmation of Chagas infection by conventional serological methods. Nevertheless, there was still a percentage of individuals in Group I without confirmation of CD etiology. As the same occurred for Group II, in which CD etiology was established by positive conventional serology, this could be a limitation of the molecular test. It is possible that false-negative qualitative PCR results were obtained, which could be explained by the low and intermittent parasitemia in the chronic phase of CD, as occurred for blood culture. However, it is not certain that there is no parasite DNA when PCR is negative, making it impossible to definitively exclude CD etiology of megaesophagus in these patients. Idiopathic achalasia persists among the other etiology possibilities for megaesophagus in individuals with negative PCR and nonreactive or inconclusive conventional serology for CD. The higher frequency of positive PCR in patients in Group I (Table 3) drew attention in the results, but without statistical significance between the groups.

The same DNA samples used for the qualitative tests were tested by the real-time absolute quantification method (qPCR). Optimization of the protocol in this study made it possible to obtain linearity with seven points on the qPCR standard curve (10⁶ to 10⁰ parasites/mL). Of the 26 samples quantified in Group I, only two were quantified above 1 parasite/ml of blood (Table 4). Low levels of parasitemia were expected, since this is a group of chronic patients with nonreactive or inconclusive conventional serology for CD. For the individuals in Group II, the mean parasite load was 5.06 parasites/ml. In a report in the literature, the mean in chronic patients with Chagas heart disease and positive conventional serology for CD was 0.1 parasite/ml (Moreira et al, 2013). The authors evaluated parasitemia in samples from 50 Brazilian patients, and in 31 of them (62%), T. cruzi Sat-DNA was detected by qPCR. In this study, a positivity of 55.17% was found in the group of chronic patients with positive conventional serology for CD and with digestive form (Table 4), therefore close to the result found in the literature, demonstrating the technical quality of the method used.

Although there was agreement between the two molecular methods and positive blood culture, this did not occur in cases in which the latter was negative. In cases where there was agreement between negative blood culture and the molecular tests did not detect parasite DNA, it was not possible to quantify the DNA of T. cruzi in these samples, even though the latter were repeated several times. This suggests a limitation of molecular methods or varying amounts of parasite DNA in the volume of collected sample. Contributing to the latter impression, it was observed that only one of the samples with positive blood culture was quantified above 1 parasite/mL, proving the low parasitemia found in the patients being studied. This also reinforces the hypothesis of inhomogeneity of the samples, with a greater volume of blood used for blood culture (30 ml) than for molecular tests. Although blood collection was performed at the same time for both methods, this is a possible explanation for the divergent results. This possibility has already been suggested in the literature (28).

Regarding specifically the use of molecular tests to elucidate the diagnosis of CD in cases of megaesophagus with nonreactive or inconclusive serology, both methods were equivalent (Tables 3 and 4). Thus, the criterion for using one or the other should take into account the availability and technical advantages inherent to each method. Thus, in the chronic phase of CD, qPCR presents the following possible advantages: a lower possibility of false positivity, quantification of parasite load and quicker results. However, qualitative PCR has a lower cost and performs satisfactorily for diagnostic purposes. It is important to point out that improvement of molecular tests and standardization and development of diagnostic kits for commercial use may have a positive impact on their use in the research environment and in healthcare services related to CD. Confirming the diagnosis of CD in cases of megaesophagus in which conventional serology is negative can better guide the clinical management of patients, positively impacting their quality of life.

In this study, it was shown that both qualitative and quantitative molecular tests can be useful for confirming Chagas disease in cases of megaesophagus and nonreactive or inconclusive conventional serology for CD.

Contribution

TBSP and EAA: Investigation, validation, writing – original draft, writing – review & editing;

AMB, PDA, LCM, JSM and SCBS: Investigation;

Competitive interests

The authors have declared that no competing interests exist.

Funding agency

FAPESP - Research Support Foundation of the State of São Paulo. Process: 08/55751-2

Data Availability

All relevant data are within the paper.

Acknowledgments

We would like to acknowledge Irene Albino Luciano Corrêa, Administrative Assistant, for her contribution in obtaining the data herein.

Chagas, Carlos. Molestia de Carlos Chagas ou thyreoidite parasitaria: nova doença humana transmitida pelo barbeiro (Conorhinus megistus). Conferência realizada perante a Associação Medico Cirúrgica de Minas Gerais. 1911;(20). http://www.bvschagas.coc.fiocruz.br/cgi-bin/wxis.exe/iah/chagas-pi/?IsisScript=iah.xis& lang=pt&base=BVChagas- PI&nextAction = lnk&exprSearch = Barbeiro$&label = Barbeiros
Benziger CP, do Carmo GAL, Ribeiro ALP. Chagas Cardiomyopathy: Clinical Presentation and Management in the Americas. Cardiol Clin. 2017 Feb;35(1):31–47. doi: 10.1016/j.ccl.2016.08.013. PMID: 27886788.
Dias JC, Ramos AN Jr, Gontijo ED, Luquetti A, Shikanai-Yasuda MA, Coura JR, Torres RM, Melo JR, Almeida EA, Oliveira W Jr, Silveira AC, Rezende JM, Pinto FS, Ferreira AW, Rassi A, Fragata AA Filho, Sousa AS, Correia D, Jansen AM, Andrade GM, Britto CF, Pinto AY, Rassi A Jr, Campos DE, Abad-Franch F, Santos SE, Chiari E, Hasslocher-Moreno AM, Moreira EF, Marques DS, Silva EL, Marin-Neto JA, Galvão LM, Xavier SS, Valente SA, Carvalho NB, Cardoso AV, Silva RA, Costa VM, Vivaldini SM, Oliveira SM, Valente VD, Lima MM, Alves RV. 2 nd Brazilian Consensus on Chagas Disease, 2015. Rev Soc Bras Med Trop. 2016 Dec;49Suppl 1(Suppl 1):3–60. doi10.1590/0037-8682-0505-2016. Erratum in: Rev Soc Bras Med Trop. 2017 Jan-Feb;50(1):149. PMID: 27982292.
Morillo CA, Marin-Neto JA, Avezum A, Sosa-Estani S, Rassi A Jr, Rosas F, Villena E, Quiroz R, Bonilla R, Britto C, Guhl F, Velazquez E, Bonilla L, Meeks B, Rao-Melacini P, Pogue J, Mattos A, Lazdins J, Rassi A, Connolly SJ, Yusuf S; BENEFIT Investigators. Randomized Trial of Benznidazole for Chronic Chagas' Cardiomyopathy. N Engl J Med. 2015 Oct;373(14):1295 – 306. doi: 10.1056/NEJMoa1507574. Epub 2015 Sep 1. PMID: 26323937.
Martins-Melo FR, Lima Mda S, Ramos AN Jr, Alencar CH, Heukelbach J. Prevalence of Chagas disease in pregnant women and congenital transmission of Trypanosoma cruzi in Brazil: a systematic review and meta-analysis. Trop Med Int Health. 2014 Aug;19(8):943 – 57. doi: 10.1111/tmi.12328. Epub 2014 May 10. PMID: 24815954.
Bern C. Chagas' Disease. N Engl J Med. 2015 Jul 30;373(5):456 – 66. doi: 10.1056/NEJMra1410150. PMID: 26222561.
Salvador F, Treviño B, Sulleiro E, Pou D, Sánchez-Montalvá A, Cabezos J, Soriano A, Serre N, Gómez I Prat J, Pahissa A, Molina I. Trypanosoma cruzi infection in a non-endemic country: epidemiological and clinical profile. Clin Microbiol Infect. 2014 Jul;20(7):706–12. doi: 10.1111/1469-0691.12443. Epub 2013 Dec 12. PMID: 24329884.
Rassi A Jr, Rassi A, Marin-Neto JA. Chagas disease. Lancet. 2010 Apr 17;375(9723):1388 – 402. doi: 10.1016/S0140-6736(10)60061-X. PMID: 20399979.
Borges Migliavaca C, Stein C, Colpani V, René Pinto de Sousa Miguel S, Nascimento Cruz L, Oliveira Dantas R, Falavigna M. Isosorbide and nifedipine for Chagas' megaesophagus: A systematic review and meta-analysis. PLoS Negl Trop Dis. 2018 Sep 28;12(9):e0006836. doi: 10.1371/journal.pntd.0006836. PMID: 30265663; PMCID: PMC6179300.
Dantas RO. Comparison between idiopathic achalasia and achalasia caused by Chagas' disease: a review on the publications about the subject]. Arq Gastroenterol. 2003 Apr-Jun;40(2):126–30. Portuguese. doi: 10.1590/s0004-28032003000200012. Epub 2004 Jan 16. PMID: 14762484.
Herbella FA, Oliveira DR, Del Grande JC. Are idiopathic and Chagasic achalasia two different diseases? Dig Dis Sci. 2004 Mar;49(3):353 – 60. doi: 10.1023/b:ddas.0000020486.71719.62. PMID: 15139481.
Schijman AG. Molecular diagnosis of Trypanosoma cruzi. Acta Trop. 2018 Aug;184:59–66. doi: 10.1016/j.actatropica.2018.02.019. Epub 2018 Feb 21. PMID: 29476727.
Junqueira AC, Chiari E, Wincker P. Comparison of the polymerase chain reaction with two classical parasitological methods for the diagnosis of Chagas disease in an endemic region of north-eastern Brazil. Trans R Soc Trop Med Hyg. 1996 Mar-Apr;90(2):129 – 32. doi: 10.1016/s0035-9203(96)90111-x. PMID: 8761570.
Britto C, Cardoso MA, Ravel C, Santoro A, Pereira JB, Coura JR, Morel CM, Wincker P. Trypanosoma cruzi: parasite detection and strain discrimination in chronic chagasic patients from northeastern Brazil using PCR amplification of kinetoplast DNA and nonradioactive hybridization. Exp Parasitol. 1995 Dec;81(4):462 – 71. doi: 10.1006/expr.1995.1139. PMID: 8542987.
Batista AM, Aguiar C, Almeida EA, Guariento ME, Wanderley JS, Costa SC. Evidence of Chagas disease in seronegative Brazilian patients with megaesophagus. Int J Infect Dis. 2010 Nov;14(11):e974-7. doi: 10.1016/j.ijid.2010.05.017. Epub 2010 Sep 15. PMID: 20833571.
Pane S, Giancola ML, Piselli P, Corpolongo A, Repetto E, Bellagamba R, Cimaglia C, Carrara S, Ghirga P, Oliva A, Bevilacqua N, Al Rousan A, Nisii C, Ippolito G, Nicastri E. Serological evaluation for Chagas disease in migrants from Latin American countries resident in Rome, Italy. BMC Infect Dis. 2018 May 8;18(1):212. doi: 10.1186/s12879-018-3118-5. PMID: 29739357; PMCID: PMC5941372.
Moser DR, Kirchhoff LV, Donelson JE. Detection of Trypanosoma cruzi by DNA amplification using the polymerase chain reaction. J Clin Microbiol. 1989 Jul;27(7):1477–82. doi: 10.1128/jcm.27.7.1477-1482.1989. PMID: 2504769; PMCID: PMC267598.
Piron M, Fisa R, Casamitjana N, López-Chejade P, Puig L, Vergés M, Gascón J, Gómez i Prat J, Portús M, Sauleda S. Development of a real-time PCR assay for Trypanosoma cruzi detection in blood samples. Acta Trop. 2007 Sep;103(3):195–200. doi: 10.1016/j.actatropica.2007.05.019. Epub 2007 Jun 23. PMID: 17662227.
Pinazo MJ, Cañas E, Elizalde JI, García M, Gascón J, Gimeno F, Gomez J, Guhl F, Ortiz V, Posada Ede J, Puente S, Rezende J, Salas J, Saravia J, Torrico F, Torrus D, Treviño B. Diagnosis, management and treatment of chronic Chagas' gastrointestinal disease in areas where Trypanosoma cruzi infection is not endemic. Gastroenterol Hepatol. 2010 Mar;33(3):191–200. doi: 10.1016/j.gastrohep.2009.07.009. Epub 2009 Oct 17. PMID: 19837482.
Hernández C, Cucunubá Z, Flórez C, Olivera M, Valencia-Hernandez CA, Zambrano P, León C, Ramírez JD. Correction: Molecular Diagnosis of Chagas Disease in Colombia: Parasitic Loads and Discrete Typing Units in Patients from Acute and Chronic Phases. PLoS Negl Trop Dis. 2016 Oct 28;10(10):e0005112. doi: 10.1371/journal.pntd.0005112. Erratum for: PLoS Negl Trop Dis. 2016 Sep 20;10(9):e0004997. PMID: 27792732; PMCID: PMC5085027.
Ramírez JC, Cura CI, da Cruz Moreira O, Lages-Silva E, Juiz N, Velázquez E, Ramírez JD, Alberti A, Pavia P, Flores-Chávez MD, Muñoz-Calderón A, Pérez-Morales D, Santalla J, Marcos da Matta Guedes P, Peneau J, Marcet P, Padilla C, Cruz-Robles D, Valencia E, Crisante GE, Greif G, Zulantay I, Costales JA, Alvarez-Martínez M, Martínez NE, Villarroel R, Villarroel S, Sánchez Z, Bisio M, Parrado R, Maria da Cunha Galvão L, Jácome da Câmara AC, Espinoza B, Alarcón de Noya B, Puerta C, Riarte A, Diosque P, Sosa-Estani S, Guhl F, Ribeiro I, Aznar C, Britto C, Yadón ZE, Schijman AG. Analytical Validation of Quantitative Real-Time PCR Methods for Quantification of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients. J Mol Diagn. 2015 Sep;17(5):605 – 15. doi: 10.1016/j.jmoldx.2015.04.010. PMID: 26320872; PMCID: PMC4698797.
Chagas disease in Latin America: an epidemiological update based on 2010 estimates. Wkly Epidemiol Rec. 2015 Feb 6;90(6):33–43. English, French. PMID: 25671846.
Portela-Lindoso AA, Shikanai-Yasuda MA. Chronic Chagas' disease: from xenodiagnosis and hemoculture to polymerase chain reaction. Rev Saude Publica. 2003 Feb;37(1):107 – 15. Portuguese. doi: 10.1590/s0034-89102003000100016. PMID: 12488927.
Ostermayer AL, Passos AD, Silveira AC, Ferreira AW, Macedo V, Prata AR. The national survey of seroprevalence for evaluation of the control of Chagas disease in Brazil (2001–2008). Rev Soc Bras Med Trop. 2011;44 Suppl 2:108 – 21. Portuguese. doi: 10.1590/s0037-86822011000800015. PMID: 21584364.
Sturm NR, Degrave W, Morel C, Simpson L. Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: use in diagnosis of Chagas' disease. Mol Biochem Parasitol. 1989 Mar 15;33(3):205 – 14. doi: 10.1016/0166-6851(89)90082-0. PMID: 2565018.
Moreira OC, Ramírez JD, Velázquez E, Melo MF, Lima-Ferreira C, Guhl F, Sosa-Estani S, Marin-Neto JA, Morillo CA, Britto C. Towards the establishment of a consensus real-time qPCR to monitor Trypanosoma cruzi parasitemia in patients with chronic Chagas disease cardiomyopathy: a substudy from the BENEFIT trial. Acta Trop. 2013 Jan;125(1):23–31. doi: 10.1016/j.actatropica.2012.08.020. Epub 2012 Sep 12. PMID: 22982466.
Ramírez JC, Cura CI, da Cruz Moreira O, Lages-Silva E, Juiz N, Velázquez E, Ramírez JD, Alberti A, Pavia P, Flores-Chávez MD, Muñoz-Calderón A, Pérez-Morales D, Santalla J, Marcos da Matta Guedes P, Peneau J, Marcet P, Padilla C, Cruz-Robles D, Valencia E, Crisante GE, Greif G, Zulantay I, Costales JA, Alvarez-Martínez M, Martínez NE, Villarroel R, Villarroel S, Sánchez Z, Bisio M, Parrado R, Maria da Cunha Galvão L, Jácome da Câmara AC, Espinoza B, Alarcón de Noya B, Puerta C, Riarte A, Diosque P, Sosa-Estani S, Guhl F, Ribeiro I, Aznar C, Britto C, Yadón ZE, Schijman AG. Analytical Validation of Quantitative Real-Time PCR Methods for Quantification of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients. J Mol Diagn. 2015 Sep;17(5):605 – 15. doi: 10.1016/j.jmoldx.2015.04.010. PMID: 26320872; PMCID: PMC4698797.
Minter-Goedbloed E, Minter DM, Marshall TF. Quantitative comparison between xenodiagnosis and haemoculture in the detection of Trypanosoma (Schizotrypanum) cruzi in experimental and natural chronic infections. Trans R Soc Trop Med Hyg. 1978;72(3):217 – 25. doi: 10.1016/0035-9203(78)90196-7. PMID: 97813.

Graphs 1 & 2 are available in the Supplementary Files section.

No competing interests reported.

Graph1.png
Graph 1. Standard curve for absolute quantification in parasites/ml.

Graph2.png

Graph 2. Absolute sample quantification and corresponding cycle thresholds.<br>

Download PDF

Version 1

posted

You are reading this latest preprint version

Complementary molecular tests: diagnosis of megaesophagus with conventional nonreactive or inconclusive serology for Chagas disease

Status:

Version 1

Abstract

1. Introduction

2. Materials And Methods

3. Results

3.1. Serology

3.2. Blood culture

3.3. Qualitative molecular tests

3.4. Quantitative molecular tests

4. Discussion

5. Conclusion

Declarations

References

Graphs

Additional Declarations

Supplementary Files

Status:

Version 1