Enhanced Enzyme Activity of Thermoalkaliphilic Laccase (CtLac) of Caldalkalibacillus thermarum Strain TA2.A1 by Random and Site-directed Mutagenesis and Its Application to Lignin Degradation

doi:10.21203/rs.3.rs-1993592/v1

Download PDF

Research Article

Enhanced Enzyme Activity of Thermoalkaliphilic Laccase (CtLac) of Caldalkalibacillus thermarum Strain TA2.A1 by Random and Site-directed Mutagenesis and Its Application to Lignin Degradation

https://doi.org/10.21203/rs.3.rs-1993592/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Thermoalkaliphilic laccase, CtLac, has advantageous properties such as high enzyme activity and stability at 70℃ and pH 8.0 in the presence of organic solvents and surfactants, which confers a potential industrial application. Moreover, CtLac depolymerized lignin and produced high-value benzaldehyde chemicals such as vanillin. In the present study, the directed evolution approach using the combination of random and site-directed mutagenesis was performed to enhance the laccase activity of CtLac. Two methods of spectrophotometric assay and real-time oxygen measurement were employed for comparing and evaluating laccase activity among mutants.

Results: Random mutagenesis was carried out by error-prone PCR to introduce 6-8 mutations per 1000 bps of CtLac coding gene. Among the 1,300 tested transformants, RM484 with higher laccase activity was selected, and V243 was targeted for site-directed mutagenesis. V243D showed 35% and 25% higher laccase activity than wild-type CtLac from the spectrophotometric assay and the oxygen consumption measurement, respectively. Besides, V243D showed higher catalytic efficiency with the decreased K_m and the increased k_cat value than wild-type CtLac. Furthermore, V243D showed the enhanced oxidative degradation of lignin under the optimal enzymatic conditions, 70℃ and pH 8.0, with 10% higher GGGE oxidation and 50-95% increased high-value aldehyde production than wild-type CtLac.

Conclusions: CtLac was engineered for improved laccase activity through the directed evolution approach involving random and site-directed mutagenesis in the lack of protein structural information. Considering the limitation of the spectrophotometric assay, the real-time measurement of oxygen consumption could be a more accurate method to evaluate oxidation of laccase activity in mutagenesis research.

Thermoalkaliphilic laccase

Random mutagenesis

Oxygen consumption

Vanillin

Lignin degradation

Laccase is an oxidoreductase belonging to multi-copper-containing oxidases, and it has been considered a “green” catalyst due to its catalytic characteristics. It catalyzes single-electron oxidation of substrates to produce corresponding reactive radicals, which can undergo oxidative coupling and further polymerization or depolymerization reactions [1]. The catalytic reaction of laccase is assisted by a cluster of the four-copper network, namely T1, T2, and T3, where the catalytic reactions such as substrate oxidation, electron transfer, and oxygen reduction take place in [1, 2]. During the overall reactions of laccase, oxygen takes electrons as the final electron acceptor and is reduced to water while the active site copper is oxidized; therefore, water is produced as only a byproduct of the enzyme reaction. Besides, laccase has broad substrate spectra ranging from simple phenolic and non-phenolic compounds to complex aromatic polymers such as lignin [3, 4]. These make laccase attractive and different from other oxidase enzymes in industrial applications, which need co-factor such as NADH and metal ions.

Indeed, laccase has been used in diverse industrial fields such as food, textile, organic synthesis, and bioremediation [2, 3, 5]. Significantly, laccase has been paid attention to the denim bleaching process in the textile industry as an eco-friendly alternative to harmful chemicals such as sodium hypochlorite [6]. According to the demands, various commercial products based on laccase with the help of redox mediators have been produced by global industries in Denmark, the U.S.A., India, and Hong Kong, which are generally used for the bleaching of indigo dyes in denim textiles [6]. In addition, laccase could be applied to lignin polymerization and depolymerization to get lignin-based phenolic compounds [4, 7].

Lignin is heterogeneous, branched, and amorphous aromatic polymer composed of three phenylpropanoid subunits (p-coumaryl-, coniferyl-, sinapyl alcohol) with various C-O and C-C linkages such as β-aryl ether, phenylcoumaran, and pinoresinol [8, 9]. Furthermore, lignin is the second most abundant natural biopolymer on Earth, followed by cellulose. Therefore, it would be a renewable substitute for fossil-based resources [4]. There have been many attempts to depolymerize lignin through physical, chemical, catalytic, biological, and enzymatic strategies [10-13]. Among these various methods, ligninolytic enzymes like laccase enable lignin depolymerization to be performed under much milder reaction conditions in eco-friendly manners compared to other treatments.

There are two strategies to tailor biocatalyst to improve enzyme properties: rational and directed evolutionary-designed mutagenesis. During the rational design, a specific amino acid is targeted based on the protein’s structure, and it is substituted with the desired amino acid through site-directed mutagenesis to tailor desired enzyme properties. The rational design mutagenesis mostly requires the accessibility of the protein structure and the relationships between sequence, structure, and function of the enzyme [14] Therefore, it is a very informative-intensive approach. In addition, it could be possible to predict specific amino acids to be replaced using molecular modeling programs if the structure of a homologous enzyme is known in the public database. On the other hand, the directed evolution approach needs no information on protein structure but considerable efforts in screening thousands of colonies after error-prone PCR [15]. It involves random mutagenesis to construct mutant libraries, which are tested to select improved mutants. Therefore, the screening method is a crucial step in differentiating and selecting the best one among numerous mutants in the directed evolution approach.

Numerous attempts have been made to engineer laccase enzyme for enhanced enzyme capabilities such as catalytic efficiency and enzyme stability via rational and/or directed evolutionary-designed mutagenesis [15-18]. Primarily, it has been mainly focused on the engineering of fungal-origin laccase due to its limited activities, such as low pH dependence (2.0-4.0) [19]. For example, the catalytic property of fungal laccase from Trametes versicolor was improved by site-directed mutagenesis, which showed a 3-fold increase of k_cat than the wild-type and the shift of optimal pH from 3.4 to 4.8 [18]. In addition, the fungal laccase from Basidiomycete was engineered to have an increased redox potential of T1 copper binding site and thermal and acidic pH stability by the combination of computer-guided rational and directed evolutionary-designed mutagenesis [20].

The industrial application of enzymes needs robust characteristics with high enzyme activity and stability under harsh operational conditions such as high temperature and pH [15]. Therefore, bacterial laccase with a high resistance toward broad ranges of temperatures and pH would be more advantageous in industrial applications. CtLac, a novel laccase from thermoalkaliphilic bacterium Caldalkalibacillus thermarum strain TA2.A1, was characterized well in our previous study [21]. It has the optimal laccase activity at 70℃ and pH 8.0 in the presence of 2,6-dimethoxyphenol (2,6-DMP) as a substrate. Interestingly, it was highly thermostable at 60-80℃ and retained more than 80% of enzyme activity for 24 h of reaction [21]. Besides, CtLac has a high tolerance to a high concentration of organic solvents, halides, and surfactants. Moreover, it depolymerized lignin by releasing high-value benzaldehyde chemicals such as vanillin [22].

In the present study, we induced directed evolution of CtLac using the combination of random and site-directed mutagenesis to enhance laccase activity. Two methods, spectrophotometric assay and real-time oxygen measurement, were employed for the

screening of mutants and comparing the enhanced laccase activity with wild-type CtLac. A mutant with a higher laccase activity was obtained and applied to degrade the lignin model compound and rice straw as representative lignocellulosic biomass abundant in agriculture. The present study found a critical amino acid responsible for enhanced enzyme activity of CtLac in the absence of the protein structure information and further potential use for the higher production of high-value phenolic compounds from lignin.

Construction and screening of CtLac mutants with enhanced laccase activity from random mutagenesis

A random mutagenesis library was constructed by error-prone PCR using GeneMorph Ⅱ EZClone Domain Mutagenesis Kit. Reaction conditions were set to introduce 6-8 mutations per 1000 bps of CtLac coding gene. A total of 1,300 transformants was randomly picked, and their laccase activities were examined using a resting cell assay in 96-well plates. Among the tested transformants, one transformant named RM484 showed a 30% increase in laccase activity than wild-type CtLac, and was selected for further experiments. The sequence of RM484 has two mutations at V243D and I468V among 516 amino acids of wild-type CtLac (Fig. S1). Considering isoleucine and valine are categorized into the same amino acid group due to their similar structures with a hydrophobic side chain, I468V was not considered a significant mutation point affecting the enzyme activity. Therefore, valine at the 243 position was assumed to be an essential factor influencing the enhanced laccase activity, and finally, it was selected as the target amino acid for site-directed mutagenesis.

Comparison of laccase activity among CtLac V243 mutants from site-directed mutagenesis based on the spectrophotometric assay and the real-time oxygen measurement at 25℃

pECtLac was used as a template to get substitutions at the position of V243; consequently, nineteen mutants were obtained from the site-directed mutagenesis. The laccase activity of the mutants was compared based on the spectrophotometric assay and the real-time oxygen measurement during the enzyme reaction at 25℃ and pH 8.0. The overall trends of increase or decrease in the product concentration and the oxygen consumption by CtLac V243 mutants were similar in both measurements (Fig. 1). Concentration of the oxidized product from 2,6-DMP by wild-type CtLac was 4.8 μM at 25℃ and pH 8.0. (Fig. 1a). The substitution of V243 by aspartic acid (D) showed 35% enhanced enzyme activity than wild-type CtLac under the spectrophotometric assay. The other substitutions showed varied enzyme activities. Specifically, six substitutions, including serine (S), threonine (T), asparagine (N), cysteine (C), glycine (G), proline (P), showed about 10% decreased enzyme activity than wild-type CtLac under the spectrophotometric assay (Fig. 1a). In addition, ten substituents including arginine (R), histidine (H), glutamic acid (E), glutamine (Q), alanine (A), isoleucine (I), leucine (L), phenylalanine (F), tyrosine (Y), tryptophan (W) showed about 20-40% decreased enzyme activity than wild-type CtLac. Remarkably, substitutions of V243 by lysine (K) or methionine (M) showed highly decreased laccase activity to 18.3% and 17.0%, respectively, compared to wild-type CtLac.

Oxygen consumption was evaluated by the real-time measurement of the dissolved oxygen in the reaction mixture during the enzyme reaction. The initial dissolved oxygen value of the reaction mixture was stabilized for 3 min and was around 295-310 μM (Fig. S2). After stabilizing the dissolved oxygen value, each enzyme was added to the reaction mixture. A bumping line was observed while the needle-type optical oxygensensor was dipping into the reaction mixture through Teflon-lined rubber septa. This might be from the insertion of oxygen in the enzyme solution into the reaction mixture. It was commonly observed in all reactions within 5 μM; therefore, it was considered the initial dissolved oxygen concentration. Only V243D showed 25% higher enzyme activity among the mutants than wild-type CtLac (Fig. 1b).

It was found that there was considerable overestimation in the laccase activity from the result of the spectrophotometric assay. For example, six substitutions, including S, T, N, C, G, and P, exhibited only 10% decreased enzyme activity than wild-type CtLac from the spectrophotometric assay. However, they showed 18~38% decreased enzyme activity from the real-time oxygen measurement. This indicates one of the limitations of the spectrophotometric assay in evaluating oxidase enzyme activity, even though the assay method is simple and easy to perform. During the spectrophotometric assay, the result values could have interfered from various factors such as a limit of detection of substrates or products, a need for absorbance at a particular wavelength, and unintended side products by enzyme reactions [23].

During the laccase catalysis of 2,6-DMP, it undergoes single-electron oxidation and transforms to 2,6-dimethoxy-phenoxy radical species. Once the unpaired electron resonates with p-radical species in the benzene ring, the consecutive dimeric or polymeric reaction will be undergone non-specifically. There have been reported several dimeric compounds resulted from 2,6-dimethoxy-phenoxy radicals such as 3,3′,5,5′-tetramethoxydiphenoquinone, 3,3′,5,5′-tetramethoxybiphenyl-4,4′-diol, and 4-(2,6-dimethoxy-phenoxy)-2,6-dimethoxyphenol from 2,6-DMP by laccase-catalyzed reaction [24-26]. In addition, polymeric oxidative products such as C₁-C₁biphenyl polymer or C₁-O-C₁ biphenyl ether polymers could be produced from consecutive radical-driven reactions [25]. However, the spectrophotometric assay generally targets to detect only 3,3′,5,5′-tetramethoxydiphenoquinone because of the absorbance of quinone-based structure at 468 nm. In other words, the spectrophotometric assay absorbs all types of quinone-based products from the non-specific reaction of radicals during the enzyme reaction, which could make an inconclusive result in the evaluation and comparison of the enzyme activity.

Furthermore, the spectrophotometric assay to measure the oxidized products from laccase activity could be influenced by assay conditions like pH and the reaction time. For example, phenolic compounds such as 2,6-DMP and caffeic acid show an increase in auto-oxidation above pH 8.5, while non-phenolic compounds such as 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) and syringaldazine (SGZ) exhibit no auto-oxidation at a pH range of 2.6-8.0 [27]. Therefore, selecting optimal substrates is very important to determine laccase activity using the spectrophotometric assay.

Meanwhile, the measurement of oxygen consumption during the laccase reaction circumvents these drawbacks from the spectrophotometric assay. Laccase catalyzes single-electron oxidation of substrate and transfers four electrons to one molecule of oxygen which is reduced to two molecules of water. Therefore, comparing oxygen consumption might be an obvious criterion for evaluating enzyme activity. For example, it could be applied to develop a laccase-mediator-system (LMS) to improve the low redox potential of laccase itself [28-30]. Euring et al. evaluated the performance of different natural mediators in enzymatic oxidation of lignin by comparing oxygen consumption rates in different LMS [29]. It found that the mediator, 2,6-DMP, significantly enhanced the oxidation of lignosulfonate and Indulin AT with a more decrease in oxygen saturation. On the other hand, oxygen consumption of LMS with the help of ABTS was faster than that of 1-hydroxy-benzotriazole (HBT) supported-LMS in the oxidation of guaiacylglycerol-β-guaiacyl ether (GGGE) [30]. More interestingly, these LMS resulted in different oxidation pathways: HBT-LMS led to the extensive polymerization of GGGE; however, ABTS-LMS directly oxidized GGGE by both laccase and ABTS radical cations, making a stable product instead of further polymerization. These implied that the detection of the specific oxidized product by laccase reaction would not be a direct way to evaluate the enzyme activity. Furthermore, it would be very hard to predict various polymerized products in cases of complex substrates like lignin.

The measurement of oxygen consumption during the laccase reaction could be a more accurate method to evaluate and compare the enzyme activity among mutants than the spectrophotometric assay, especially in mutagenesis research. Moreover, the oxygen consumption measurement could be applied to other oxidases and oxygenase enzymes.

Comparison of biochemical characterization of purified CtLac V243 mutants with wild-type CtLac based on the spectrophotometric assay

Among nineteen V243 mutants, V243D was selected as the best mutant due to its highest laccase activity based on both the spectrophotometric assay and real-time oxygen measurement (Fig. 1). Therefore, its biochemical characterization was compared with wild-type CtLac and a mutant V243M, which showed the least laccase activity. The biochemical characterization of the selected V243D and V243M was carried out only based on the spectrophotometric assay because the needle-type optical fiber oxygen sensor has a limit to temperature ranges up to 50℃. V243D showed 16-42% enhanced laccase activity than wild-type CtLac in the tested ranges of temperatures from 20℃ to 90℃ (Fig. 2a). However, the laccase activity of V243D was not affected significantly by the change in pH except for pH 8.0 (Fig. 2b). Especially, V243D showed the most enhanced laccase activity at 70℃ and pH 8.0 by producing 25.3 μM of the oxidized product of 2,6-DMP, while wild-type CtLac produced 19.1 μM. Thus, we assumed that the condition of 70℃ and pH 8.0 is the optimal reaction condition for the enzymes V243D and wild-type CtLac. On the other hand, V243M showed about 80-90% decreased enzyme activity compared to wild-type CtLac, even at the optimal enzyme conditions, 70℃ and pH 8.0.

From the screening of mutants with the enhanced laccase activity based on the spectrophotometric assay and the real-time oxygen consumption measurement, two mutants V243K and V243M showed significantly decreased laccase activity compared to wild-type CtLac (Fig. 1). In the case of V243K, the substitution of Val to Lys might reduce the solubility of the protein because inclusion body was observed in the cell lysis step of the crude laccase enzyme preparation (data not shown). It might infer that V243K could not induce the appropriate conformational change of the enzyme, resulting in the significant loss of enzyme activity.

Meanwhile, the decrease in the laccase activity of V243M might be from the copper binding issue to the T1 copper binding site of laccase or the vicinity of the catalytic coppers. This could be deduced from the color difference of E. coli (pECtLac-V243M) cell pellet. To be specific, the color of the cell pellets of E. coli (pECtLac) and E. coli (pECtLac-V243D) turned greenish during the protein overexpression in the presence of CuCl₂; however, the color of the cell pellet of E. coli (pECtLac-V243M) remained yellowish (Fig. S3). The green color might be from the coordination of Cu²⁺ in the Type 1 site of laccase, which is the characteristic adsorption of the oxidized Cu²⁺ state at 600 nm [31]. Therefore, there are possibilities that the substitution of Val to Met might affect Cu binding activity of wild-type CtLac. In other words, V243D might induce favorable conformational changes in the enzyme’s active site than wild-type CtLac because, generally, the catalytic efficiency of laccase is proportional to the redox potential of type 1 copper. Although this deduction might be imperfect without the exact protein structure of wild-type CtLac, it could consider Val at 243 position of CtLac to be one of the key amino acids contributing to the enzyme’s catalytic efficiency due to a noticeable difference among the mutants. Although it is necessary to predict critical residues of CtLac by using protein structure data of other laccases available from protein data bank (PDB), we found the low amino acid sequence (< 30%) with that of previously known structure for bacterial laccase [32]. Therefore, further study is needed based on the protein structural data of wild-type CtLac and the mutants to prove the abovementioned assumption.

Comparison of kinetic parameters of CtLac V243 mutants with wild-type CtLac based on the spectrophotometric assay and the real-time oxygen consumption measurement at 25℃ and pH 8.0

Kinetic parameters of V243D and V243M were investigated based on the spectrophotometric assay and the real-time oxygen consumption measurement with the different concentrations of 2,6-DMP. The data were analyzed using Michaelis-Menten equation by non-linear regression and compared with wild-type CtLac. From the spectrophotometric assay, V243D exhibited K_m and k_cat of 137.2 μM and 2.7 s^-1 at 25℃ and pH 8.0, respectively, which was 12.7% lower and 145.5% higher than those of wild-type CtLac (Table 1a). The k_cat/K_m value of V243D was determined to be 0.02 s^-1μM^-1, which was about 2.9-fold larger in catalytic efficiency than wild-type CtLac. Especially, the specific activity of 10 μg purified V243D in the presence of 500 μM 2,6-DMP at 25℃ and pH 8.0 was 347.7±16.2 μmol/min/mg, which was 2.3-fold higher than that of wild-type CtLac. However, V243M showed K_m and k_cat of 674.2 μM and 0.1 s^-1 at 25℃ and pH 8.0, respectively, which was 329.0% higher and 91.0% decreased values of wild-type CtLac.

Kinetic parameters of the mutants and wild-type CtLac were also obtained from the oxygen consumption measurement (Table 1b). The initial dissolved oxygen concentration in the reaction mixture containing different concentrations of 2,6-DMP was equilibrated as described above (Fig. S4). V243D exhibited K_m(O2) and k_cat(O2) values of 332.3 μM and 4.2 s^-1, respectively, which were 33.1% lower and 20.0% higher than those of wild-type CtLac at 25℃ and pH 8.0 (Table 1b). However, V243M showed K_m(O2) and k_cat(O2)of 87.7 μM and 0.7 s^-1 at 25℃ and pH 8.0, respectively, which was 82.4% lower and 80.0% decreased values of wild-type CtLac. There was a distinct difference between the oxygen consumption rate (μM O₂/min) among wild-type CtLac, V243D, and V243M in the presence of 500 μM 2,6-DMP at 25℃ and pH 8.0, following the order V243D > wild-type CtLac > V243M with the values of 4.2, 2.4, and 0.6 (Fig. 3).

Comparison of kinetic parameters of CtLac V243 mutants with wild-type CtLac based on the spectrophotometric assay under the optimal enzyme conditions at 70℃ and pH 8.0

As investigated in our previous study, CtLac showed the highest laccase activity at a high temperature of 70℃ and pH 8.0 because it originated from thermoalkaliphilic bacterium, Caldalkalibacillus thermarum strain TA2.A1 [21]. In other words, the absolute concentrations of the oxidized product from wild-type CtLac and V243 mutants were substantially higher at 70℃ than those at 25℃ (Fig. S5 and Fig. 1b). Therefore, the investigation of kinetic parameters of V243D and V243M was additionally carried out at 70℃ and pH 8.0 to compare with those of wild-type CtLac. Notably, V243D showed 127.3 μM and 15.3 s^-1 for K_m and k_cat values, respectively, which was 13.6% lower and 19.5% higher than wild-type CtLac (Table 2). Moreover, the k_cat/K_m value of V243D was 0.12 s^-1μM^-1 which was 1.4-fold larger in catalysis efficiency compared to wild-type CtLac. Moreover, the specific activity of 10 μg purified enzyme in the presence of 500 uM 2,6-DMP at 70℃ and pH 8.0 was 2141.8 μmol/min/mg, which was 1.1 fold higher than that of wild-type CtLac. However, V243M showed K_m and k_cat of 1127 μM and 1.5 s^-1 at 70℃ and pH 8.0, respectively, which was 665.1% higher and 88.3% decreased values of wild-type CtLac.

The mutation at the V243 position of wild-type CtLac affected laccase activity by resulting in changes in the kinetics parameters. Especially, V243D showed improved enzyme activity with the decreased K_m and increased k_cat. Thus, our results could provide a path to improve catalytic activity of CtLac with further investigation of molecular structure. Indeed, most investigations on mutagenesis to enhance enzyme activity have been performed between well-known laccases with high amino acid identities, such as Bacillus licheniformis and Bacillus subtilis [33-35].

In the present study, we performed random and site-directed mutagenesis and compared enzyme activity using the spectrophotometric assay and the real-time oxygen measurement to select the best mutant with enhanced enzyme activity, although there were no references in the protein structures. Therefore, this atypical trial could be applied as a more powerful tool to evaluate and broaden the range of novel oxidase enzymes.

Enhancement of oxidative degradation of lignin model compound and rice straw using V243D at 70℃ and pH 8.0

Enhancement of lignin degradation by V243D was determined using GGGE and rice straw. Purified V243D and V243M were treated on each substrate at 70℃ and pH 8.0, and the enzymatic activity on the oxidative lignin degradation was compared with that of wild-type CtLac. After 6 h of the enzymatic treatment, 10% higher GGGE oxidation was observed in V243D than wild-type CtLac, while V243M slightly oxidized GGGE (Fig. 4a). The m/z value of the product was 637.2 of deprotonated ion in the negative ionization mode [M-H]^-, which was expected as a dimer form of GGGE (Fig. 4b). In addition, the collision-induced dissociation (CID) fragmentation patterns of the product from GGGE by V243D treatment was exactly matched with the results of wild-type CtLac in our previous report [21]. Briefly, there were typical neutral losses of 15 Da (CH₃•, methyl radical), 18 Da (H₂O, water), 30 Da (CH₂O, formaldehyde), 48 Da (H₂O+CH₂O), and 124 Da (C₇H₈O₂, guaiacol) among fragment ions, which are well known as the characteristic fragmentations from β-aryl ether linkage, which account for more than 50% of inter-unit linkage found in all types of lignin [36, 37]. The m/z values of major fragment ions were 589.1, 541.1, 483.1, 435.1, 329.1, which indicated [M-H-H₂O-CH₂O]^-, [M-H-2H₂O-2CH₂O]^-, [M-H-guaiacol-CH₂O]^-, [M-H-2guaiacol-CH₂O]^-(Fig. 4b). These m/z fragment patterns were exactly matched with our previous results of CtLac treatment on GGGE [21], in other words, GGGE might be transformed to C₅-C₅ biphenyl tetramer by the initial enzymatic oxidation and radical-radical coupling (Fig. 4c). Considering V243D has lower K_m and higher k_cat value than wild-type CtLac, it might enhance oxidation activity on GGGE than wild-type CtLac.

Furthermore, V243D and V243M were treated on rice straw, representative lignocellulosic biomass, and the production of lignin-derived monomers was compared with wild-type CtLac. The six lignin-derived monomers were detected at m/z values of (a) 167.03, (b) 195.06, (c) 121.02, (d) 163.03, (e) 151.03, (f) 181.05 and identified as vanillic acid, homosyringaldehyde, p-hydroxybenzaldehyde, p-coumaric acid, vanillin, and syringaldehyde, respectively (Fig. 5). The lignin monomers were quantified using the peak area of extracted ion chromatogram (EIC) of compounds. The peak area was used to calculate the concentration of the compounds as compared to the EIC of authentic vanillin (0-200 μM). The above six lignin-derived compounds commonly have a phenolic group that is deprotonated in negative ionization mode. Therefore, the compounds’ concentrations could be calculated from this calibration curve, even in a lack of authentic chemicals such as homosyringaldehyde.

Specifically, the concentration of homosyringaldehyde, p-hydroxybenzaldehyde, and vanillin was 17.8 μM, 91.7 μM, and 98.0 μM, respectively, after 3 h of V243D treatment (Table 3). On the other hand, wild-type CtLac produced less concentration of compounds as 13.8 μM, 74.2 μM, and 90.2 μM than V243D. Significantly, vanillin was still increased at 6 h of enzyme treatment, even though homosyringaldehyde and p-hydroxybenzaldehyde were decreased due to possible employment in the laccase activity as mediators. On the other hand, V243M produced similar concentrations of these benzaldehyde compounds to the control sample containing only rice straw without enzymes, which meant no significant effect of V243M on the release of lignin monomers due to its low enzyme activity. The total concentration of lignin-derived monomer from rice straw was around 265 μM after V243D treatment, which was higher than wild-type CtLac. Consequently, V243D produced much more high-value benzaldehyde compounds from rice-straw than wild-type CtLac.

It can be assumed that the action of CtLac on the rice straw would be different from that on simple phenolic compounds such as 2,6-DMP and GGGE. CtLac could oxidize 2,6-DMP by directly abstracting single-electron from this phenolic substrate, resulting in phenoxyl radicals and sequential radical coupling. However, CtLac could not directly abstract electrons from the non-phenolic group of lignin due to its intrinsic low redox potential of laccase than the non-phenolics [38]. As proposed in our previous study, it can be overcome by the action of lignin-derived monomers from rice straw as natural mediators in CtLac-driven biodegradation of terminal β-O-4 type bond in rice straw [22]. These mediators oxidized by CtLac might abstract electrons from the C₁ carbon of β-O-4 type lignin, and the C₁ radical-driven cleavage of C_α-C_β bond produced benzaldehyde such as vanillin. Based on this proposed mechanism, V243D could oxidize a larger amount of lignin-derived monomers than wild-type CtLac, resulting in much-oxidized mediators with faster oxygen consumption during the enzyme treatment. Consequently, V243D could foster the production of much high-value benzaldehyde chemicals such as p-hydroxybenzaldehyde and vanillin than wild-type CtLac.

In the present study, we performed two-step mutagenesis involving random mutagenesis followed by site-directed mutagenesis to obtain engineered laccase (CtLac) mutant with enhanced catalytic efficiency. Two methods were employed to compare the laccase activity among the mutants, the spectrophotometric assay and the real-time oxygen measurement. V243D showed 35% enhanced laccase activity than wild-type CtLac under the spectrophotometric assay. However, it exhibited only 25% higher enzyme activity than wild-type CtLac from the oxygen consumption measurement. The real-time measurement of oxygen consumption could be a more accurate method to evaluate oxidase activity in mutagenesis research, considering the limitation of the spectrophotometric assay. V243D showed higher catalytic efficiency with the decreased K_m and the increased k_cat value than wild-type CtLac. Moreover, it showed the enhanced oxidative degradation of lignin under the optimal enzymatic conditions, 70℃ and pH 8.0, with 10% higher GGGE oxidation and 50-95% increased high-value aldehyde production than wild-type CtLac. Therefore, it could consider Val at the 243 position of CtLac as one of the critical amino acids contributing to the catalytic efficiency of the enzyme, although the protein structure information of CtLac is absent.

Chemicals and E. coli strains

2,6-DMP and GGGE were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.) and TCI chemicals (Tokyo, Japan). All organic solvents (acetonitrile, ethanol, ethyl acetate, methanol) were of high-purity HPLC grade and purchased from ThermoFisher Scientific (Waltham, MA, U.S.A.). E. coli strain XL10-Gold (Tet^rΔ (mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac Hte [F′ proAB lacI^qZΔM15 Tn10 (Tet^r) Amy Cam^r]) and E. coli strain BL21(DE3) (F^- dcm ompT hsdS(r_B^- m_B^-) gal λ(DE3)) were purchased from Agilent Technology (Santa Clara, CA, U.S.A.). E. coli strain DH5α (fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) was purchased from New England Biolabs (Ipswich, MA, U.S.A.).

Library construction by random mutagenesis

Recombinant plasmid pECtLac was constructed in our previous study and used as a template for random mutagenesis [21]. Error-prone PCR was performed to introduce random mutations into CtLac within the pECtLac plasmid at low mutation frequency using GeneMorph Ⅱ EZClone Domain Mutagenesis Kit according to the manufacturer’s protocol (Agilent Technology). The following primers were used for PCR: Lac-F 5′ACGTACATATGAAACGGATTTTAACACTAGTTCTTC3′ and Lac-R 5′GATACCTCGAGTTATTCAGGTTTGTTCGGGATG3′. The restriction sites of NdeⅠ and XhoⅠ are underlined, and the stop codon is indicated in bold letters. The PCR conditions were followed by segment 1 (95℃ for 2 min), 30 cycles of segment 2 (95℃ for 30 sec, 53 ℃ for 30 sec, 72℃ for 1 min 30 sec), and segment 3 (72℃ for 10 min). The resulting PCR products were used as megaprimers in EZClone reaction for the ligation with pET28a(+). E. coli strain XL10-Gold was transformed with the resulting plasmids. Plasmid library was prepared from the obtained transformants and re-transformed into expression host E. coli strain BL21(DE3) followed by protein induction and laccase activity screening using 2,6-DMP as a substrate.

Library screening

Individual clones of E. coli strain BL21(DE3) carrying mutated plasmid were randomly picked and grown overnight in 3 mL of LB broth supplemented with 50 μg/mL kanamycin at 37℃ and 200 rpm. One percent of the culture was transferred to 3 mL of fresh LB broth and grown at 37℃ and 180 rpm to OD₆₀₀0.6, followed by protein induction with 100 μM of isopropyl β-D-thiogalactopyranoside (IPTG) and 250 μM of CuCl₂. Expression of the protein was performed at 20℃ and 120 rpm for 4 hours, followed by 16 hours of static incubation. After the IPTG induction, 250 μL of the individual culture was transferred into a 96-well plate, and the OD₆₀₀ value was measured using Multiskan^TM FC Microplate Photometer (ThermoFisher Scientific). The 96-well plate was centrifuged at 3,500xg for 10 min using a centrifuge (HERMLE Labortechnik GmbH, Z400, Wehingen, Germany) to get cells for resting cell assay. Next, the cell pellets were re-suspended with 250 μL of 50 mM citrate phosphate buffer (pH 8.0) supplemented with 1 mM CuCl₂. The resting cell assay was performed by adding 0.5 mM of 2,6-DMP as a substrate into each well and incubating at 70℃ for 2 min to compare laccase activity among mutants. A control experiment with E. coli strain BL21(DE3) harboring pECtLac was run simultaneously under the same assay conditions. The mutants with the enhanced laccase activity were subjected to nucleotide sequencing at Macrogen Inc. (Seoul, Republic of Korea) to confirm changed amino acids. Finally, the best one was selected for further site-directed mutagenesis experiments.

Site-directed mutagenesis

Site-directed mutagenesis was performed at the position of V243 of wild-type CtLac using Q5^® Site-Directed Mutagenesis Kit according to the manufacturer’s protocol (New England). Substitution of V243 was introduced using primer sets listed in Table S1. The PCR conditions were followed by initial denaturation (98℃ for 30 sec), 25 cycles of annealing (98℃ for 10 sec, 59-65℃ for 15 sec, and 72℃ for 3 min 30 sec), and final extension (72℃ for 10 min). The resulting PCR products were treated with kinase, ligase, and DpnⅠ at room temperature for 15 min. E. coli strain DH5α was transformed with the resulting plasmids. Nineteen pECtLac plasmids substituted with the desired amino acids at the V243 position were obtained through nucleotide sequencing, and their laccase activities were compared through spectrophotometric assay and oxygen consumption measurement.

Expression and purification of enzymes

The nineteen pECtLac mutants were separately cloned in E. coli strain BL21(DE3) for protein expression. E. coli strain BL21(DE3) harboring plasmid with each CtLac V243 mutant was grown, and the protein expression was performed as described in the above section. After the protein induction, cells were harvested by centrifuged at 10,000xg for 15 min and washed twice with minimal salts basal (MSB) medium for protein purification. Cell lysis was carried out using BugBuster protein extraction reagent according to the manufacturer’s protocol (Merck Millipore, Burlington, MA, U.S.A.). The lysate was cleared by centrifugation and filtration using a 0.2 μm membrane filter (Advantec MFS Inc., Dublin, CA, U.S.A.) and used as a crude laccase enzyme source or further purified to homogeneity using the His-Trap affinity chromatography. The lysate was applied to His-Trap HP column (GE Healthcare, Chicago, IL, U.S.A.) and eluted with a linear gradient of imidazole from 0 to 250 mM buffered 20 mM Tris-HCl (pH 8.0). A fraction containing the laccase was desalted using a desalting column (GE Healthcare), and then concentrated using Amicon Ultra Centrifugal Filter (Merck Millipore) to get concentrated high-purity protein for further experiments. The protein concentration was determined by Pierce BCA protein assay kit (ThermoFisher Scientific).

Laccase activity assay

Spectrophotometric assay

Laccase activity of CtLac V243 mutants was determined by measuring absorbance at 468 nm of the oxidized product from 2,6-DMP [39]. The lysate of all CtLac V243 mutants from the site-directed mutation was reacted with 0.5 mM 2,6-DMP in 50 mM citrate phosphate buffer containing 1 mM CuCl₂ (pH 8.0) at 25℃ to compare laccase activities among the mutants. The concentration of the oxidized product of 2,6-DMP was calculated according to Beer-Lambert law by considering the absorbance at 468 nm, the molar extinction coefficient (ε=49.6 mM^-1cm^-1), and path length [40]. The results selected the mutant with the highest laccase activity, and the laccase activity was compared with wild-type CtLac using the purified protein.

Real-time oxygen measurement

The laccase activity of CtLac V243 mutants was determined by measuring oxygen consumption during the oxidation of 2,6-DMP at 25℃. The real-time dissolved oxygen concentration in the reaction mixture was measured using an OXY-1 ST trace transmitter with a needle-type oxygen microsensor (NHT-PSt7, PreSens-Precision Sensing GmbH, Regensburg, Germany). Reaction mixture was 5 mL of 50 mM citrate phosphate buffer containing 0.5 mM 2,6-DMP and 1 mM CuCl₂ (pH 8.0) in 15 mL serum bottle sealed with Teflon-lined rubber septa and aluminum caps. The needle-type optical sensor was dipped in the reaction mixture by penetrating the septa and measured dissolved oxygen in real-time during the whole reaction. The initial dissolved oxygen concentration of the reaction mixture was equilibrated by waiting for a few minutes after injecting the needle-type sensor. Once the real-time dissolved concentration was stable, each purified enzyme was added to the reaction mixture. The reaction mixture was continuously stirred on a magnetic plate to promote enzyme activity.

Biochemical characterization of the selected CtLac V243 mutants

Effects of different temperatures (20-90℃) and pH (3.0-8.0) on the laccase activity of CtLac V243 mutants were compared with wild-type CtLac. The mutants’ kinetic parameters (K_m, k_cat, and k_cat/K_m) were determined using different concentrations of 2,6-DMP (100-1000 μM) through the spectrophotometric assay and the real-time oxygen consumption measurement at 25℃. These parameters were compared with those of wild-type CtLac. In addition, the kinetic study of the enzymes at 70℃ was performed based on the spectrophotometric assay. The data were analyzed using GraphPad Prism 9 (GraphPad Software Inc., CA, U.S.A.) with the Michaelis-Menten equation by non-linear regression.

Oxidative degradation of lignin model compound GGGE and rice straw using wild-type CtLac and the selected CtLac V243 mutants

To compare enzyme activity between wild-type CtLac and the selected CtLac V243 mutants on the degradation of lignin model compound, each purified enzyme was treated with GGGE. 10 μg of the purified enzyme was reacted with 0.5 mM GGGE in 50 mM citrate phosphate buffer containing 1 mM CuCl₂ (pH 8.0) at 70℃ and 120 rpm for 12 h. The reaction mixture was extracted with five volumes of ethyl acetate to analyze the residual GGGE and its product by the laccase activity, and the organic phase was evaporated using a speedvac vacuum concentrator (ThermoFisher Scientific). The residue was dissolved in high-purity HPLC grade methanol and followed by filtering with polyvinylidene fluoride (PVDF) syringe filter (Whatman-GE Healthcares, Pittsburgh, PA, U.S.A.) before ultra-performance liquid chromatography-quadrupole-time-of-flight-tandem mass spectrometry (UPLC-Q-TOF-MS/MS) analysis (ImpactⅡ Q-TOF system, Bruker, Billerica, MA, U.S.A.).

Rice straw was selected as representative lignocellulosic biomass, an abundant byproduct in the agricultural environment. The preparation of rice straw was carried out as the protocol in our previous study [22]. Briefly, rice straw collected from a local farm was rinsed with tap water to remove organic matters such as soil, and then it was cut into 5 cm lengths and milled to approximate 4 mm size. After repeated autoclaving at 121℃ for 1 h and washing with sterile deionized water, the rice straw was dried in an oven at 70℃ for 2 days. 10 μg of the purified enzyme was reacted with 2% (w/v) of the rice straw in 20 mL of 50 mM citrate phosphate buffer containing 1 mM CuCl₂ (pH 8.0) at 70℃ for 6 h. At 3 and 6 h of reaction, the sample was taken and extracted with five volumes of ethyl acetate to extract lignin monomers released from the rice straw by the enzyme treatment. The organic phase was evaporated, and the residue was dissolved in high-purity 40% aqueous acetonitrile, and followed by filtering with PVDF syringe filter before UPLC-Q-TOF-MS analysis.

Analytical methods

After the enzyme treatment, the products from GGGE or rice straw were analyzed using UPLC-Q-TOF-MS/MS. UPLC was equipped with a photodiode array detector and a reverse-phase C18 column (Bruker, Intensity Solo 2 C18, 100 x 2.0 mm, 2.0 μm in particle size). The mobile phase was composed of deionized water containing 0.1% formic acid (solvent A) and acetonitrile containing 0.1% formic acid (solvent B). UPLC was operated in a linear gradient for solvent B 10-55% for 0-15 min, 55-100% for 15-17 min, 100% for 17-20 min, with subsequent equilibrium at 10% for 5 min. The column temperature was 40℃, and the injection volume was 3 μL. MS conditions were as follows: negative ionization mode, mass range m/z 50-1500, capillary voltage 4500 V, nebulizer 1.2 bar, dry gas flow rate 10.0 L/min, dry temperature 200℃. For CID-MS/MS, the collision energy was set to 5-15 eV.

Identification of oxidative products from GGGE and lignin-derived monomers from rice straw

The oxidative product from GGGE after treatment of CtLac wild-type and CtLac V243 mutants was identified based on CID fragmentation patterns from LC-MS/MS analysis [21]. Briefly, the typical neutral loss (m/z) in the fragments could be from functional groups of phenolic compounds such as methyl radical and formaldehyde. Similarly, the identification of lignin-derived monomers by the enzyme treatments was carried out based on UV-HPLC-MS/MS-based method developed in our previous study [22]. The quantification of the lignin-derived monomers in the reaction mixture was performed by calculating the peak area of EIC of each compound from a calibration curve of authentic vanillin of EIC.

2,6-dimethoxyphenol (2,6-DMP); 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS); syringaldazine (SGZ); laccase-mediator-system (LMS); 1-hydroxy-benzotriazole supported (HBT); guaiacylglycerol-β-guaiacyl ether (GGGE); protein data bank (PDB); collision-induced dissociation (CID); extracted ion chromatogram (EIC); isopropyl β-D-thiogalactopyranoside (IPTG); minimal salts basal (MSB); polyvinylidene fluoride (PVDF); ultra-performance liquid chromatography-quadrupole-time-of-flight-tandem mass spectrometry (UPLC-Q-TOF-MS/MS)

Ethics approval and consent to participate

No applicable

Consent to publication

No applicable

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Competing interests

The authors declare no conflict of interest.

Funding

No applicable

Authors’ contributions

YY carried out the experiments, data analysis, and drafted the manuscript. SG reviewed the manuscript to improve the quality of the draft. HGH directed all procedures of experiments and critically reviewed the manuscript to improve the quality of the draft. All authors read and approved the final manuscript.

Authors’ information

School of Earth Sciences and Environmental Engineering, Gwangju Institute of Science and Technology (GIST), Gwangju 61005, Republic of Korea

Youri Yang, Ph.D ([email protected])

Sunil Ghatge, Ph.D ([email protected])

Hor-Gil Hur, Professor ([email protected])

Correspondence to Hor-Gil Hur

Acknowledgements

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2020R1I1A1A01071523)

Riva S. Laccases: blue enzymes for green chemistry. Trends Biotechnol. 2006; 24:219-226.
Yang J, Li W, Ng TB, Deng X, Lin J, Ye X. Laccases: production, expression regulation, and applications in pharmaceutical biodegradation. Front. Microbiol. 2017;8:832.
Arregui L, Ayala M, Gómez-Gil X, Gutiérrez-Soto G, Hernández-Luna CE, Herrera de los Santos M, Levin L, Rojo-Domínguez A, Romero-Martínez D, Saparrat MCN, Trujillo-Roldán MA, Valdez-Cruz NA. Laccases: structure, function, and potential application in water bioremediation. Microb. Cell Factories. 2019;18:200.
Agustin MB, de Carvalho DM, Lahtinen MH, Hilden K, Lundell T, Mikkonen KS. Laccase as a tool in building advanced lignin-based materials. ChemSusChem. 2021; 14:4615-4635.
Senthivelan T, Kanagaraj J, Panda RC. Recent trends in fungal laccase for various industrial applications: an eco-friendly approach-a review. Biotechnol. Bioprocess Eng. 2016;21:19-38.
Rodríguez-Couto S, Lardizabal PdM. Laccases for denim bleaching: an eco-friendly alternative. The Open Textile Journal. 2012;5:1-7.
Munk L, Sitarz AK, Kalyani DC, Mikkelsen JD, Meyer AS. Can laccases catalyze bond cleavage in lignin? Biotechnol. Adv. 2015;33:13-24.
Roth S, Spiess AC. Laccases for biorefinery applications: a critical review on challenges and perspectives. Bioprocess Biosyst. Eng. 2015;38:2285-2313.
Behling R, Valange S, Chatel G. Heterogeneous catalytic oxidation for lignin valorization into valuable chemicals: what results? what limitations? what trends? Green Chem. 2016;18:1839-1854.
Abdelaziz OY, Brink DP, Prothmann J, Ravi K, Sun M, García-Hidalgo J, Sandahl M, Hulteberg CP, Turner C, Lidén G, Gorwa-Grauslund MF. Biological valorization of low molecular weight lignin. Biotechnol. Adv. 2016;34:1318-1346.
Patwardhan PR, Brown RC, Shanks BH. Understanding the fast pyrolysis of lignin. ChemSusChem. 2011;4:1629-1636.
Katahira R, Mittal A, McKinney K, Chen X, Tucker MP, Johnson DK, Beckham GT. Base-catalyzed depolymerization of biorefinery lignins. ACS Sustain. Chem. Eng. 2016;4:1474-1486.
Xu R, Zhang K, Liu P, Han H, Zhao S, Kakade A, Khan A, Du D, Li X. Lignin depolymerization and utilization by bacteria. Bioresour. Technol. 2018;269:557-566.
Bornscheuer UT, Pohl M. Improved biocatalysts by directed evolution and rational protein design. Curr. Opin. Chem. Biol. 2001;5:137-143.
Pardo I, Camarero S. Laccase engineering by rational and evolutionary design. Cell. Mol. Life Sci. 2015;72:897-910.
Zhang J, Ma F, Zhang X, Geng A. Directed evolution of a homodimeric laccase from Cerrena unicolor BBP6 by random mutagenesis and in vivo assembly. Int. J. Mol. Sci. 2018;19:2989.
Chen Y, Luo Q, Zhou W, Xie Z, Cai YJ, Liao XR, Guan ZB. Improving the catalytic efficiency of Bacillus pumilus CotA-laccase by site-directed mutagenesis. Appl. Microbiol. Biotechnol. 2017;101:1935-1944.
Madzak C, Mimmi MC, Caminade E, Brault A, Baumberger S, Briozzo P, Mougin C, Jolivalt C. Shifting the optimal pH of activity for a laccase from the fungus Trametes versicolor by structure-based mutagenesis. Protein Eng. Des. Sel. 2006;19:77-84.
Torres-Salas P, Mate DM, Ghazi I, Plou FJ, Ballesteros AO, Alcalde M. Widening the pH activity profile of a fungal laccase by directed evolution. Chembiochem. 2013;14:934-937.
Mateljak I, Monza E, Lucas MF, Guallar V, Aleksejeva O, Ludwig R, Leech D, Shleev S, Alcalde M. Increasing redox potential, redox mediator activity, and stability in a fungal laccase by computer-guided mutagenesis and directed evolution. ACS Catal. 2019;9:4561-4572.
Ghatge S, Yang Y, Song W-Y, Kim T-Y, Hur H-G. A novel laccase from thermoalkaliphilic bacterium Caldalkalibacillus thermarum strain TA2.A1 able to catalyze dimerization of a lignin model compound. Appl. Microbiol. Biotechnol. 2018;102:4075-4086.
Yang Y, Song W-Y, Hur H-G, Kim T-Y, Ghatge S. Thermoalkaliphilic laccase treatment for enhanced production of high-value benzaldehyde chemicals from lignin. Int. J. Biol. Macromol. 2019;124:200-208.
Demarche P, Junghanns C, Ardao I, Agathos SN. Dynamic measurement of oxidase activity based on oxygen consumption in open systems. Eng. Life Sci. 2015;15:804-814.
Schirmann JG, Dekker RFH, Borsato D, Barbosa-Dekker AM. Selective control for the laccase-catalyzed synthesis of dimers from 2,6-dimethoxyphenol: optimization of 3,3’,5,5’-tetramethoxy-biphenyl-4,4’-diol synthesis using factorial design, and evaluation of its antioxidant action in biodiesel. Appl. Catal. A-Gen. 2018;555:88-97.
Wan Y, Du Y, Miyakoshi T. Enzymatic catalysis of 2,6-dimethoxyphenol by laccases and products characterization in organic solutions. Sci. China, Ser. B: Chem. 2008; 51:669-676.
Kallio JP, Auer S, Jänis J, Andberg M, Kruus K, Rouvinen J, Koivula A, Hakulinen N. Structure-function studies of a Melanocarpus albomyces Laccase suggest a pathway for oxidation of phenolic compounds. J. Mol. Biol. 2009;392:895-909.
Brander S, Mikkelsen JD, Kepp KP. Characterization of an alkali- and halide-resistant laccase expressed in E. coli: CotA from Bacillus clausii. PLoS One. 2014;9:e99402.
Alexander Kirsch KO, Markus Euring. Oxygen consumption of laccase-mediator-systems (LMS). J. Mater. Sci. Res. 2015;4:49-58.
Euring M, Ostendorf K, Rühl M, Kües U. Enzymatic oxidation of Ca-lignosulfonate and kraft lignin in different lignin-laccase-mediator-systems and MDF Production. Front. Bioeng. Biotechnol. 2022;9:788622-788622.
Hilgers R, Vincken J-P, Gruppen H, Kabel MA. Laccase/mediator systems: their reactivity toward phenolic lignin structures. ACS Sustain. Chem. Eng. 2018;6:2037-2046.
Christopher LP, Yao B, Ji Y. Lignin biodegradation with laccase-mediator systems. Front. Energy Res. 2014;2:12.
Xie T, Liu Z, Wang G. Structural insight into the allosteric coupling of Cu1 site and trinuclear Cu cluster in CotA caccase. ChemBioChem. 2018;19:1502-1506.
Wang J, Lu L, Feng F. Combined strategies for improving production of a thermo-alkali stable laccase in Pichia pastoris. Electron. J. Biotechnol. 2017;28:7-13.
Bu T, Yang R, Zhang Y, Cai Y, Tang Z, Li C, Wu Q, Chen H. Improving decolorization of dyes by laccase from Bacillus licheniformis by random and site-directed mutagenesis. PeerJ. 2020;8:e10267.
Mollania N, Khajeh K, Ranjbar B, Hosseinkhani S. Enhancement of a bacterial laccase thermostability through directed mutagenesis of a surface loop. Enzyme Microb. Technol. 2011;49:446-452.
Morreel K, Dima O, Kim H, Lu F, Niculaes C, Vanholme R, Dauwe R, Goeminne G, Inzé D, Messens E, Ralph J, Boerjan W. Mass spectrometry-based sequencing of lignin oligomers. Plant Physiol. 2010;153:1464-1478.
Zakzeski J, Bruijnincx PCA, Jongerius AL, Weckhuysen BM. The catalytic valorization of lignin for the production of renewable chemicals. Chem. Rev. 2010; 110:3552-3599.
Rodríguez Couto S, Toca Herrera JL. Industrial and biotechnological applications of laccases: a review. Biotechnol. Adv. 2006;24:500-513.
Edens WA, Goins TQ, Dooley D, Henson JM. Purification and characterization of a secreted laccase of Gaeumannomyces graminis var. tritici. Appl. Environ. Microbiol. 1999;65:3071-3074.
Islam MS, Harnett CK. Miniaturized systems for evaluating enzyme activity in polymeric membrane bioreactors. Eng. Life Sci. 2019;19:749-758.

Table 1 Kinetic parameters of wild-type CtLac (WT), V243D, and V243M for the oxidation of different concentrations of 2,6-DMP ranging from 100 to 1000 μM using (a) the spectrophotometric assay and (b) the oxygen consumption measurement at 25℃ and pH 8.0.

a	Construct	K_m (μM)	k_cat (s^-1)	k_cat/K_m (s^-1μM^-1)
	WT	157.2	1.1	0.007
	V243D	137.2	2.7	0.020
	V243M	674.2	0.1	0.0001

b	Construct	K_m(O2) (μM)	k_cat(O2) (s^-1)	k_cat(O2)/K_m(O2) (s^-1μM^-1)
	WT	497.0	3.5	0.007
	V243D	332.3	4.2	0.013
	V243M	87.7	0.7	0.007

Table 2 Kinetic parameters of wild-type CtLac (WT), V243D, and V243M for the oxidation of different concentrations of 2,6-DMP ranging from 100 to1000 μM using the spectrophotometric assay at 70℃ and pH 8.0.

Construct	K_m (μM)	k_cat (s^-1)	k_cat/K_m (s^-1μM^-1)
WT	147.3	12.8	0.087
V243D	127.3	15.3	0.120
V243M	1127	1.5	0.0013

Table 3 Quantification of lignin-derived monomers from rice straw after treatment of purified wild-type CtLac (WT), V243D, and V243M.

No.	Compound	m/z	Concentration of lignin-derived monomers produced after enzyme treatment (μM)^a
			3 h				6 h
			Control^b	WT	V243D	V243M	Control	WT	V243D	V243M
a	Vanillic acid	167.03	10.4 ± 0.9	7.0 ± 0.0	7.5 ± 0.3	9.9 ± 0.2	11.0 ± 0.4	8.3 ± 0.6	9.0 ± 0.6	9.9 ± 0.3
b	Homosyringaldehyde	195.06	11.6 ± 1.4	13.8 ± 1.1	17.8 ± 0.3	11.6 ± 0.3	6.8 ± 0.9	8.2 ± 0.5	8.8 ± 0.3	6.9 ± 0.7
c	p-Hydroxybenzaldehyde	121.02	61.1 ± 1.4	74.2 ± 5.3	91.7 ± 1.0	59.0 ± 4.5	46.5 ± 1.0	56.2 ± 0.0	60.3 ± 3.8	47.5 ± 3.4
d	p-Coumaric acid	163.03	89.7 ± 6.4	90.2 ± 7.2	98.0 ± 3.6	95.0 ± 2.1	135.2 ± 1.5	121.0 ± 7.5	134.4 ± 1.3	141.9 ± 4.0
e	Vanillin	151.03	10.3 ± 0.3	20.7 ± 0.0	21.0 ± 0.3	10.2 ± 0.8	10.8 ± 2.9	23.4 ± 1.0	25.0 ± 0.6	11.2 ± 0.4
f	Syringaldehyde	181.05	30.9 ± 2.4	28.4 ± 0.4	29.3 ± 0.5	29.0 ± 0.4	25.7 ± 2.8	28.2 ± 1.2	27.6 ± 0.9	28.7 ± 1.2
Total concentration of lignin- derived monomer (μM)^c			214 ± 2.8	243.3 ± 2.5	265.4 ± 4.9	214.7 ± 5.2	235.9 ± 0.1	245.4 ± 7.6	265.1 ± 4.6	246.1 ± 0.2

^a Concentration was calculated from EIC peak areas based on the calibration curves using authentic vanillin.

^b Control sample contained only rice straw without enzymes and reacted under the same experimental conditions with enzyme treatments.

^cTotal concentration of lignin-derived monomers from rice straw after the treatments (μM).

No competing interests reported.

Supplementaryfile.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Enhanced Enzyme Activity of Thermoalkaliphilic Laccase (CtLac) of Caldalkalibacillus thermarum Strain TA2.A1 by Random and Site-directed Mutagenesis and Its Application to Lignin Degradation

Status:

Version 1

Abstract

Figures

Background

Results and discussion

Conclusions

Materials and methods

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1