Development of chloroplast derived SSR markers for genus Allium and their characterization in the allies for genetic improvement of alliums

doi:10.21203/rs.3.rs-1997305/v1

Download PDF

Research Article

Development of chloroplast derived SSR markers for genus Allium and their characterization in the allies for genetic improvement of alliums

https://doi.org/10.21203/rs.3.rs-1997305/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Nov, 2023

Read the published version in South African Journal of Botany →

Version 1

posted

You are reading this latest preprint version

Alliums are the most popular for their culinary usage and nutraceutical benefits. Their productions are greatly affected by the multiple biotic and abiotic stresses. Poor characterizations of genetic resources are the major bottleneck in genetic improvement of alliums. Chloroplast derived simple sequence repeat (cpSSR) have recently gained much popularity due to their maternal inheritance and low recombination along with their hypervariable nature. In this study, 22 chloroplast-derived SSR markers were produced from chloroplast genomes of A. cepa and A. sativum. Repeat comparison revealed tri nucleotide repeats were in higher proportion (50%) compared to other repeat motifs. The number of alleles ranged from 2 to 4, heterozygosity from 0.009 to 0.540, and PIC from 0.007 to 0.427. The polymorphism survey and clustering of twenty-two cpSSR markers of twenty-five alliums, lead to three groups (groups I, II, and III), indicated the usefulness of these cpSSR markers. This demonstrated that cultivated A. cepa and A. sativum belong to different groups II than most wild alliums, confirming the usefulness of the AccpSSR and AscpSSR markers that will allow introduction of desirable biotic and abiotic tolerance traits from various wild alliums to selected cultivated alliums. In addition, these cpSSRs were validated in 79 alliums, divided them into three groups using Jaccard dissimilarity and Bayesian model-based structure analysis. Subsequent clustering allowed us to identify diverse alliums, for constructing core collection of germplasm resource. The study will be useful for molecular breeding and genomic selection based crop improvement.

Allium cepa

Allium sativum

Ac_cpSSR

As_cpSSR

wild alliums

cpSSR

Onion and garlic are commercially important crops because of their culinary value around the world and their secondary metabolites, quercetine, and allicin in onion and garlic, respectively (Jones et al. 2004; Jayaswall et al. 2019a,2019b) which are used for a variety of health advantages around the world. Nonetheless, the adverse effects of climate change as well as biotic factors are diminishing onion and garlic yields. Through molecular breeding, numerous features such as high total soluble content, drought and water logging tolerance, and resistance to various disease and pest, could be introgressed to popular cultivars to obtain the superior cultivars of onion (Ghodke et al. 2020; Jayaswall et al.2021; Singh etal.2020; DC et al.2021).

Different morphological and biochemical markers were used to characterize and identify resistance sources for biotic and abiotic stresses, but these were not adequate due to environmental influences (Scholten et al. 2016; Kim et al.2021). Various genetic markers like RFLPs, RAPDs, ISSRs, SSRs, ILPs, and SNPs were employed in genotyping of alliums (McCallum et al. 2008). Furthermore, SSRs are recommended for gene mapping, gene introgression, diversity and variability studies due to co-dominance, multi-allelic, hyper-variable, and chromosomal specific placement nature (Avise et al.1995 ; Doebley1992). These nuclear genome-derived markers, however, not conserved, are unable to identify maternally inherited relationships across cultivars, which is critical for understanding lineage and selection of multiple sources of resistance to different stresses. Furthermore, owing of their remarkable degree of sequence advancement, which prevents comparisons between sequences and allele sizes, the nuclear genome-based markers were less effective for identifying evolutionary relationships among alliums (Sharma et al. 2020a; Sharma et al.2020b). Chloroplast SSRs markers (cpSSRs) obtained from the chloroplast genome, on the other hand, have a number of advantages over nuclear genome-derived molecular markers, since these show maternal inheritance. This is due to the fact that SSR loci in the nuclear genome are predominantly distributed throughout the noncoding sections of the genome and have more sequence variants than the coding areas of the chloroplast genome, which have a low evolutionary frequency with negligible recombination rate (McCauley 1995; Provan et al. 1998). The constant nature of gene order in chloroplasts, the widespread availability of cpSSR primers, and the lack of nuclear recombination have made chloroplast genomic resources a useful tool for plant evolutionary investigations (Olmstead and Palmer 1994).The cpSSR markers of one species, are cross-transferable to other species of same family (Sharma et al. 2020b). As a result, cpSSR markers are being used widely to identify and characterize genetic links across closely related species and identification of resistance sources. Since, the chloroplast genomes are conserved, thus cpSSR markers can be used to identify historical bottlenecks and genetic drift effects in alliums (McCauley 1995). It has long been acknowledged that the mechanisms of evolution associated with domestication of diverse wild plants relatives has resulted in decrease of genetic variation in the genomes (Tanksley and McCouch et al. 1997). The loss of chloroplast genomic diversity in several cultivated crops has been matched by loss of nuclear diversity, as demonstrated by a variety of nuclear SSR markers (Russell et al. 2000).However, unlike conventional nuclear-based markers, the characteristic of these different conserved cpSSR molecular markers allows for a better understanding of evolutionary relationships among cultivated and wild alliums.

The chloroplast genomes of onion and garlic were recently sequenced by using various sequencing technologies (Von Kohn et al. 2013; Filyushin et al. 2016) that provides an opportunity for the development of cpSSR markers resources in onion and garlic. Previously, Jayaswall et al. (2021) mined 15 cpSSR markers from Allium paradoxum for genotyping 18 alliums. Therefore, to understand the polymorphism and cross-transferabilities of cultivated alliums derived 22 novel cpSSR markers in 25 diverse alliums and to decipher genetic diversity and population structure of 79 alliums in this study, chloroplast genome sequence of A.cepa(onion)and A. sativum(garlic)were used to develop cpSSR markers. The identified all 22 polymorphic and cross-transferable cpSSR markers could be used to expedite introgression of biotic and abiotic stress tolerance traits to elite cultivars of alliums, development of DNA barcodes, understand evolutionary relationships andidentification of progenitors of cultivated species.

SSR mining from chloroplasts

SSRs were identified using MISA software upon downloading the entire chloroplast genome of Allium cepa (NC_024813; Von Kohn et al. 2013) and Allium sativum (KX_683282; Filyushin et al. 2016) from NCBI. SSRs were discovered using a cut-off value of six for di-nucleotide, four for tri-nucleotide, and three for tetra-, penta-, and hexa-nucleotide repeats, while mono-nucleotides were not included in this study. SSRs were classified as perfect (without interrupting nucleotides) or compound SSRs(SSRs separated by 100bp non-repetitive sequence).Using Batch-Primer-3 v1.0, primers were created from the regions flanking SSRs (You et al. 2008). The following parameters were utilized to create cpSSR primers: (1) primer length of 17 to 22 bp, (2) Amplicon length of 100–300 bp, (3) Melting temperature (Tm) of 50°C to 70°C and (4) 40–70% of GC content (Table 2). Primers were designated as AccpSSR (Allium cepa L. chloroplast simple sequence repeats) and AscpSSR (Allium sativum L. chloroplast simple sequence repeats).

Isolation of DNA and polymorphism investigation

For marker validation, the leaf samples from 104 allium genotypes were collected from the experimental field of ICAR-DOGR,Pune,India.The genomic DNA was isolated from the collected leaf samples (Table 1a and 1b) following the method described by Murray and Thompson 1980. The quality of the isolated genomic DNA was confirmed using the lambda uncut marker (Fermentas) on 1% agarose gel, and the DNA quantity was determined using the NanoDrop 2000 (Thermo Scientific, USA). The PCR amplification efficiency of developed cpSSR markers was tested with 25 ng template DNA in a volume of 20 µL reaction mixture as previously described (Bhandawat et al. 2015).The PCR program comprised of a denaturation phase at 94°C for 4 minutes, followed by for 35 cycles of three step: 94°C for one minute, with an optimized annealing temperature of primer (as given in Table 2) for 1 minute, and 72°C for 1 minute, this was followed by a final extension at 72°C for 5 minutes in I-Cycler PCR (Bio-Rad).The PCR products were separated using 3 % Agarose gel.Amplicon sizes were measured against standard 1 kb Plus DNA ladder (O'Gene Ruler).

Markers scoring and data analysis

The presence (1) and absence (0) of bands amplified in alliums were recorded based on AccpSSR and AscpSSR marker profiles. Monomorphic markers produced the same size pieces throughout all alliums, but polymorphic markers produced wide-range fragments. In alliums, cross-transferred cpSSR marker amplicons were scored, and a UPGMA dendrogram was drawn using DARwin6 based on Jaccard's dissimilarity coefficient (Perrier and Jacquemoud-Collet 2006).PopGene32 (Yeh et al. 1999) and Gene Calc (Bikowski and Miks. 2018) were used to calculate the heterozygosity and polymorphism information content (PIC) (Table-2). The STRUCTURE software v2.3.3 was used to disclose the genetic structure of 79 alliums (Pritchard et al. 2000; Falush et al. 2007).

Result and discussion

SSR repeats form a large component of complex genome, playing key functions in controlling gene interaction and genome packing. In the past, these repeats were regarded as "junk" DNA and were mostly utilized to uncover evolutionary relationships and identify changes in plant populations (Li et al.2002). SSRs found in the genome of chloroplast are conserved as compare to the nuclear genome (Sharma et al. 2020b).As a result, these cpSSRs are thought to be important regulators of genome evolution, and are responsible for structural and functional variability of nuclear genome. Many chloroplast genes regulate the transcription of various nuclear genes, and play important role in withstanding various biotic and abiotic stresses (Jayaswall et al.2016 and Wang et al.2016). The widely consumed vegetables Allium cepa and Allium sativum, which are grown all over the world, had seen an increase in the production and productivity.But various biotic and abiotic stresses are reducing yield of cultivated alliums (Choi et al. 2020).Therefore, introgression of many desirable genes/traits/QTLs controlling adverse effect of various biotic and abiotic stresses is need of the hour.Despite this, no cpSSR maker resources of Allium cepa and Allium sativum have been reported yet except our previous study where we mined 15cpSSR markers from Allium paradoxum (Jayaswall et al. 2021).In alliums, cpSSR markers may be utilized for genetic identification, characterization, and introgression of desirable traits through linked molecular markers (Parida et al.2010).Therefore, finding functionally appropriate and validated polymorphic-cross transferrable cpSSR markers will help in evolutionary studies and trait introgression (Sharma et al. 2020b).

Mining of chloroplast genome and development of cpSSR markers

Mining of essential markers and genomic sequence of a crop by using digital public sequence databases is a fast and cost-effective approach. Chloroplasts play important role in the regulation of nuclear genes and different other biological processes such as evolutionary processes and pathways. Based on specified criteria, a total of twenty-two cpSSRs were mined and tested for amplification success in 25 alliums. Previously, 15 cpSSR were identified in the wild allium species (Jayaswall et al. 2021), but the current study represents the first report of development of chloroplast SSR markers in cultivated alliums i.e.,Allium cepa and Allium sativum.In comparison to other types of chloroplast dwelling SSR repeats; Allium cepa and Allium sativum mainly include tri-nucleotide repeats (50%) (Table-2). This prevalence of tri-nucleotide repeats could be related to genomic selection against frameshift mutations in the coding genes which is similar to the protein coding regions of the genome(Varshney et al. 2005, Metzgar et al. 2000).

Scoring and data analysis

All the 22 cpSSRs developed from Allium cepa and Allium sativum were amplified in at least one of the 25 allium individuals. The observed amplicon size of few cpSSR was more than expected which could be due the presence of intron within the amplified region, while few cpSSRs did not amplified at all which might be due to disruption of primer annealing site as observed previously (Bhandawat et al. 2015; Bhandawatet al. 2019).In contrast to nuclear genome- derived markers (Sharma et al. 2020b), the cross-transferability of cpSSR primers was found to be greater in the current investigation due to the conserved nature of sequences in chloroplast genome. In our previous study at cpSSR markers,where we had mined 15 Allium paradoxum cpSSR markers(Jayaswall et al.2021),100 % cross transferability was reported similar to the present study. Jayaswall et al. 2022 has reported 86.2 % cross-transferability by using the potential of AcPIP markers in onion. Allele number ranged from 2 to 4 which is lower to those found in our previous study of cpSSR of Allium paradoxum(Jayaswall et al.2021,) but similar to Ziziphus cpSSR markers (Huang et al. 2015). Compared to cpSSR, higher number of alleles were reported using genomic and EST-SSRs which could be due to higher sequence conservation in chloroplast genome (Ricciardi et al. 2020; Baldwin et al. 2012). In our previous work on Allium paradoxum cpSSRs, where PIC value ranged from 0.09 to 0.68 and heterozygosity from 0.104 to 0.733(Jayaswall et al. 2021) whereas in the present study, comparatively lower PIC (0.007 to 0.427) and heterozygosity (0.009 to 0.540)(Table 2) is observed that might be due to reduction in genetic diversity, during the process of domestication and selection of cultivated Alliums. Though, among 22 cpSSRs, 11 markers showed PIC range 0.408 to 0.534, which indicates higher polymorphism and suitability for genotypic study.

Taxon analysis and understanding of genetic relationship among wild and cultivated alliums

Plant molecular breeding requires the identification of genetic variability in crops, and an understanding of population structure aids in the selection of elite diversified germplasm (Chakraborty et al. 2016). The goal of a population structure study was to figure out the heterogeneity or variation in the target allium population for mapping genes and dissecting significant features (Wei et al. 2006).Twenty-five alliums (17 wild alliums and 8 cultivated Allium cepa and Allium sativum) were chosen for cross-transferability and polymorphism investigations using 22 cpSSR markers.Wild alliums were found to be exceedingly variable in terms of shape, anatomy, and genetic organization ( Kik C. 2002, Nanda et al. 2016).Distance based clustering using twenty-two cpSSR markers, partitioned the twenty-five alliums into 2 groups with one outgroup. Allium tuberosum, A.hookeriThw.,A.fistulosum L., A. ladebouramun, A.senescens L., A.ampeloprasum L., A.altaicum Pall. Rottler ex. Spreng.,A.hookeriThw., A. fistulosum L., A.fistulosum L., A. fistulosum L., A. fistulosum L., A.chinense G. Don, A. macranthum Baker, A.ascalonicum L,A. carolinianum DC. and A.prezwalskianumwere clustered under group I with sub-grouping.Group II includes A.cepa L. var. Yellow Globe, A. cepa L. var. Bhima Super, A. cepa L. var. BhimaShweta, A.chinense G. Don,A.sativum L. var. CITHGo1,A. sativum L. var. Bhima Purple and A. sativum L. var. BhimaOmkarand,A.sativum L. var. G282and A.cepa L. var. Bhima Shakti. A. (Fig. 1).These groupings demonstrate that cultivated A. cepa and A. sativum are in groups II, but most wild alliums fall under groups I and III, confirming the originality and usefulness of these cpSSR markers.

Further, we have genotyped the 79 genotypes of alliums by these 22 polymorphic and cross-transferable cpSSR markers in order to validate and better understanding of the structure of wild allium. The genetic structure and grouping of 79 alliums had been confirmed using Bayesian model-based structure (Fig-3) and Jaccard dissimilarity-based NJ tree (Fig-2). Based on the genotypic databy these 22 cpSSR markers, 79 alliums have been divided into three groups (1,2&3).Group 1 includes A. macranthum Baker, A. chinense G. Don, A. prezwalskianum, A. schoenoprasumL., and A. cepaL.Group 2 includes A. tuberosumRottler ex. Spreng, A. hookeriThw.,A. altaicumPall., A. fragrans Vent., A. fistulosumL., and A. cepavar.aggregatumG.Don. Due to the limited number of markers and their heterogeneous nature in terms of appearance and genetic structure, A.fistulosum L. fits into groups 1 and 2. Furthermore, Allium altaicum Pall belongs to groups 1 and 3 (Fig-2).The genetic classification of alliums (Fig-2) allows us to identify specific alliums to construct core collections (Birky1988). Using these molecular markers, various biotic and abiotic stress resistant genes might be introduced into premier cultivars of A.cepa.The characteristics of chloroplast genome such as lack of recombination and generally uniparental inheritance, makes chloroplast SSR markers suitable to understand plant evolution, population genetics, phylogeny, synteny, and domestication (Sharma et al. 2020a).

The findings imply that A. Cepa which fall into group II, could be exploited as an elite cultivar for introgression of desirable traits from donor wild alliums. Diverse wild alliums have resistance genes for various biotic and abiotic stresses (Nanda et al. 2016). As a result, information about the relatedness of various allium species within and between groups I, II, and III is drawn in a dendrogram, providing a wonderful opportunity to bring various desirable agronomical traits through marker assisted selection (Nanda et al., 2016, Birky 1998). Characterization of these different alliums will aid in breeding, conservation, and development of climate resilient alliums in the future.

Chloroplast derived SSRs alter the activity and function of other chloroplastic genes due to their variable repeat length, and also influence the expression of nuclear genes, resulting phenotypic variation in alliums. Till date, in best of my knowledge, no cpSSRmarker resources of A.cepa and A. sativum containing diverse regulatory genes have been mined. As a result, the mining of a collection of 22 new chloroplast-derived microsatellite markers, as well as the experimental validation of all 22 possible polymorphic cpSSR markers, reveals their functional significance in A.cepa and A.sativum.Further,use of these novel polymorphic-cross-transferable cpSSR markers to characterize the diversity and population structure of 79 alliums reveals that they could be of potential use for molecular breeding studies in alliums on a larger scale.

Conflict of interest statement

Authors declared no Conflict of interest statement.

Avise JC and Ferguson MM (1995). Molecular markers, natural history and evolution. Syst. Biol. 44(1): 117-119

Baldwin S, Pither-Joyce M, Wright K, Chen L, McCallum J.(2012) Development of robust genomic simple sequence repeat markers for estimation of genetic diversity within and among bulb onion (Allium cepa L.) populations. Mol. Breed.,30(3):1401-1411

Birky CW (1988) Evolution and population genetics of organelle genes: mechanisms and models. In Plant Evolutionary Biology (Gottlieb, L.D. and Jain, S.K., eds), pp. 23–53, Chapman &Hall

Bhandawat A, Sharma V, Singh P, Seth R, Nag A, Kaur J, Sharma RK (2019)
Discovery and Utilization of EST-SSR marker resource for genetic diversity and population structure analyses of a subtropical bamboo, Dendrocalamus hamiltonii.
Biochem. Genet.57 (5): 652–672

Bhandawat A, Sharma V, Sharma H, Sood A, Sharma RK (2015) Development and crosstransferability of functionally relevant microsatellite markers in Dendrocalamus latiflorus and related bamboo species. J. Genet.: 94(1), 48-55.

Bińkowski J, Miks S (2018). Gene-Calc [Computer software]. Available from: www.gene-calc.pl

Choi Y, Kim S, LeeJ( 2020) Construction of an onion (Allium cepa L.) genetic linkage map using genotyping-by-sequencing analysis with a reference gene set and identification of QTLs controlling anthocyanin synthesis and content. Plants 9(5):616.

Chakraborty D, Wang T. Andre K, Konnert M, Lexer MJ, MatullaC, Schueler S,
2016). Adapting Douglas-fir forestry in Central Europe: evaluation, application, and
uncertainty analysis of a genetically based model. Eur. J. Forest Res. 135 (5):
919–936

DC M, Jayaswall K, Kumar A, (2021) Variability and genetic diversity among selfed lines (S1) of onion (Allium cepa L.). Indian J. Tradit. Knowl. .20(2):563-568

Doebley J (1992) Molecular systematics and crop evolution.Molecular systematics of plants (202-222).Springer, Boston, MA.

Falush D, Stephens M, Pritchard JK (2007) Inference of population structure using
multilocus genotype data: dominant markers and null alleles. Mol. Ecol. Notes 7 (4):
574–578.

Filyushin MA, Beletsky AV, Mazur AM, Kochieva EZ ( 2016)The complete plastid genome sequence of garlic Allium sativum L. , Mitochondrial DNA B: Resour. 1(1):831-832.

Ghodke P, Khandagale K, Thangasamy A, Kulkarni A, Narwade N, Shirsat D, Randive P, Roylawar P, Singh I, Gawande SJ, Mahajan V, (2020) Comparative transcriptome analyses in contrasting onion (Allium cepa L.) genotypes for drought stress. PLoS One,15(8): p.e0237457

Huang J, Yang X, Zhang C, Yin X, Liu S, LiX ( 2015) Development of chloroplast microsatellite markers and analysis of chloroplast diversity in Chinese jujube (Ziziphus jujuba Mill.) and wild jujube (Ziziphus acidojujuba Mill.). PLoS One10(9):0134519.

Jayaswall K, Bhandawat A, Sharma H, Yadav VK, Mahajan V, Singh M (2019a) Characterization of Allium germplasms for conservation and sustainable management using SSR markers.Indian J. Tradit. Knowl. 18(1): 193-199

Jones MG, Hughes J, Tregova A, Milne J, Tomsett AB, Collin HA(2004) Biosynthesis of the flavour precursors of onion and garlic. J. Exp. Bot.55(404):1903-1918

Jayaswall K, Sharma H, Bhandawat A, Sagar R, Yadav VK, Sharma V, Mahajan V, Roy J, Singh M (2019b) Development of intron length polymorphic (ILP) markers in onion (Allium cepa L.), and their cross-species transferability in garlic (A. sativum L.) and wild relatives. Genet. Resour. Crop Evol. 66(7): 1379-1388

Jayaswall K, Mahajan P, Singh G, Parmar R, Seth R, Raina A, Swarnkar MK, Singh AK, Shankar R, Sharma RK (2016) Transcriptome analysis reveals candidate genes involved in blister blight defense in tea (Camellia sinensis (L) Kuntze). Sci. 6(1): 1-14

Jayaswall K, Sharma H, Bhandawat A, Sagar R, Jayaswal D, Kumar A, Chaturvedi P, Mahajan V, Kumar S, Singh M (2021) Chloroplast derived SSRs reveals genetic relationships in domesticated alliums and wild relatives. Genet. Resour. Crop Evol. 1-10.doi.org/10.1007/s10722-021-01235-z

Jayaswall K, Sagar R, Jayaswal D, Kumar A, Singh SP, Seth R, Sharma H, Mahajan V, Kumar S, Singh M (2002) Identification and characterization of Allium cepa potential intron polymorphism markers.6b8d73b1-8cc6-453c-acf2-9daab11748ac.pdf (researchsquare.com)

Kim SJ, Park JS, Park T, Lee HM, Choi JR, Park YD (2021) Development of molecular markers associated with resistance to gray mold disease in onion (Allium cepa L.) through RAPD-PCR and transcriptome analysis. Horticulturae 7(11):436

Kik C (2002) Exploitation of wild relatives for the breeding of cultivated Allium species. Allium Crop Science: Recent advances. CAB International, Wallingford, UK,81-100.

Li YC, KorolAB, Fahima T, Beiles A, Nevo E ( 2002) Microsatellites: genomic distribution, putative functions and mutational mechanisms a review. Mol.11(12),;2453-2465.

Metzgar D, Bytof J, Wills C (2000) Selection against frameshift mutations limits microsatellite expansion in coding DNA. Genome Res 10 (1): 72–80.

McCauley DE (1995) The use of chloroplast DNA polymorphism in studies of gene flow in plants. rends Ecol. Evol. 10(5)198-202.

McCallum J, Thomson S, Pither-Joyce M, Kenel F, Clarke A, Havey MJ (2008) Genetic diversity analysis and single-nucleotide polymorphism marker development in cultivated bulb onion based on expressed sequence tag–simple sequence repeat markers. Journal of the American Society for Hortic. Sci. 133(6),:810-818

Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res.8(19): 4321-4326.

Nanda S, Chand SK, Mandal P, TripathyP, Joshi RK (2016)Identification of novel source of resistance and differential response of Allium genotypes to purple blotch pathogen, Alternaria porri (Ellis) Ciferri. Plant Pathol J 32(6): 519

Olmstead RG, Palmer JD (1994) Chloroplast DNA systematics: a review of methods and data analysis. Am. J. Bot. 81(9):1205-1224.

Provan J, Soranzo N, Wilson NJ, McNicol JW, Forrest GI, Cottrell J, Powell W (1998) Gene–pool variation in Caledonian and European Scots pine (Pinus sylvestris L.) revealed by chloroplast simple–sequence repeats. Proceedings of the Royal Society of London. Series B: Biol. sci. 265(1407): 1697-1705

Parida SK, Pandit A, Gaikwad K, et al. (2010) Functionally relevant microsatellites in sugarcaneunigenes.BMC Plant Biol. 10: 251

Perrier X, Jacquemoud-Collet JP ( 2006) DARwin software http://DARwin.cirad. fr.

Pritchard JK, Stephens M, Rosenberg NA, Donnelly P (2000) Association mapping
in structured populations. Am. J. Human Genetics 67 (1): 170–181

Russell JR, Ellis RP, Thomas WT, Waugh R, Provan J, Booth A, Fuller J, Lawrence P, Young G, Powell W (2000)A retrospective analysis of spring barley germplasm development from foundation genotypes' to currently successful cultivars. Mol. Breed. 6(6): 553-568

Ricciardi L, MazzeoR, Marcotrigiano AR, Rainaldi G, IovienoP, Zonno V, Pavan S, Lotti C, (2020) Assessment of genetic diversity of the “acquaviva red onion”(Allium cepa L.) apulian landrace. Plants9(2):260.

Scholten OE, van Kaauwen MP, Shahin A, Hendrickx PM, Keizer LC, Burger K, van Heusden AW, van der Linden CG, Vosman B (2016) SNP-markers in Allium species to facilitate introgression breeding in onion. BMC Plant Biol. 16(1): pp.1-10.

Singh PR, Mahajan V, Verma A, Sagar R, Jayaswall K, Shukla N, Gedam P, Singh M.(2020) Identification and characterization of white onion (Allium cepa L.) genotypes for high total soluble solid content through molecular markers. Genet. Resour. Crop Evol. 68(3):957-967.

Sharma H, Bhandawat A, Rahim MS, Kumar P, Choudhoury MP, Roy J (2020a) Novel intron length polymorphic (ILP) markers from starch biosynthesis genes reveal genetic relationships in Indian wheat varieties and related species. Mol. Biol. Rep.47(5): 3485-3500

Sharma H, Hyvönen J, Poczai P (2020b) Development of chloroplast microsatellite markers for giant ragweed (Ambrosia trifida). Appl. Plant Sci.8(1):11313

Tanksley SD,McCouch SR(1997)Seed banks and molecular maps: unlocking genetic potential from the wild. science 277(5329): 1063-1066

Thiel., Michalek W, Varshney R, Graner A (2003)Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet.106(3):411-422

You FM, Huo N, Gu YQ, Luo MC, Ma Y, Hane D, Lazo GR, Dvorak J, Anderson OD (2008) BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinform.9(1): 1-13.

Varshney RK, Graner A, Sorrells ME (2005) Genic microsatellite markers in plants:
features and applications. Trends Biotechnol 23 (1): 48–55

Von Kohn C, Kiełkowska A, Havey MJ (2013)Sequencing and annotation of the chloroplast DNAs and identification of polymorphisms distinguishing normal male-fertile and male-sterile cytoplasms of onion.Genome 56(12):737-742

Yeh FC, Yang RC, Boyle T (1999) POPGENE version1. 32, Microsoft window-base software for population genetic analysis: a quick user’s guide. University of Alberta.Center for International Forestry Research, Alberta, Canada.

Wei X, Jackson PA, McIntyre CL, Aitken KS, Croft B (2006) Associations between
DNA markers and resistance to diseases in sugarcane and effects of population substructure. Theor. Appl. Genet. 114 (1): 155–164.

Wang L, Kim C, Xu X, Piskurewicz U, Dogra V, Singh S, Apel K (2016)Singlet oxygen-and EXECUTER1-mediated signaling is initiated in grana margins and depends on the protease FtsH2. Proc Natl Acad Sci India Sect B Biol Sci113(26):E3792-E3800.

Table 1a. Description of the samples used for the characterization of chloroplast simple sequence repeat markers (cpSSR).

S.No.	Variety/Accession number	Code	Collection source	Status	Short name
1	Allium altaicum Pall.	CGN-14769	CGN, Netherland	Wild alliums	AaltaP-14769
2	Allium fistulosum L.	-	AVRDC, Taiwan	Wild alliums	AfistAKO-17
3	Allium senescens L.	EC-328503	-	Wild alliums	Ascen-328503
4	Allium fistulosum L.	All-646	Germany	Wild alliums	AfistulAll-646
5	Allium ladebouramun	EC-328491	Russia	Wild alliums	Aladeb-328491
6	Allium macranthum Baker	NMK-3244	Upper Sobansiri, Arunanchal Pradesh,India	Wild alliums	Amacran-3244
7	Allium chinense G. Don	NMK-3247	West Siyang, Arunanchal Pradesh,India	Wild alliums	Achine-3247
8	Allium angulosum L.	EC-328486	-	Wild alliums	Aangul-328486
9	Allium ampeloprasum L.	NMK-3211	West Kameng, Arunanchal Pradesh	Wild alliums	Aampel-3211
10	Allium Hookeri Thw	NG-3155	North East region,India	Wild alliums	Ahook-3155
11	Allium macranthum Baker	NMK-3240	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	Amacran-3240
12	Allium prezwalskianum	MMK-115	ICAR-DOGR, Pune	Wild alliums	Aprezwals1-115
13	Allium carolinianum DC.	MMK-135	ICAR-DOGR, Pune	Wild alliums	Acarol-135
14	Allium prezwalskianum	MMK-112	ICAR-DOGR, Pune	Wild alliums	Aprezwals-112
15	Allium ascalonicum L.	-	Srinagar (J&K)	Wild alliums	AascalPRAN-1
16	Allium tuberosum Rottler ex. Spreng.	CGN-16418	-	Wild alliums	Atuber-16418F
17	Allium chinense G. Don	NG-3165	ICAR-DOGR, Pune	Wild alliums	Achine-3165
18	Allium cepa L. var. Bhima Shakti	IC 572769	ICAR-DOGR, Pune	Red onion variety	B.Shakti
19	Allium cepa L. var. Bhima Super	IC 561259	ICAR-DOGR, Pune	Red onion variety	B.Super
20	Allium cepa L. var. Bhima Shweta	IC 572761	ICAR-DOGR, Pune	Red onion variety	B.Shweta
21	Allium cepa L. var. Yellow globe	-	ICAR-DOGR, Pune	Red onion variety	Yellow glove
22	Allium sativum L. var. Bhima Purple	IC 570742	ICAR-DOGR, Pune	Garlic variety	B.Purple
23	Allium sativum L. var. Bhima Omkar	IC 569789	ICAR-DOGR, Pune	Garlic variety	B.Omkar
24	Allium sativum L. var. G282	-	ICAR-DOGR, Pune	Garlic variety	G282
25	Allium sativum L. var. CITHGo1	-	ICAR-DOGR, Pune	Garlic variety	CITHGo1

Table 1b. Details of wild alliums used for genetic diversity in present study.

S.No.	Species	Code	Collection source	Status	Short name
1	Allium altaicum Pall.	CGN-23934	Netherland	Wild alliums	1AaltaP-23934
2	Allium altaicum Pall.	CGN-14770	Netherland	Wild alliums	2AaltaP-14770
3	Allium altaicum Pall.	All-284	Germany	Wild alliums	3AaltaPAll-284
4	Allium altaicum Pall.	EC-328485	-	Wild alliums	4AaltaP-328485
5	Allium fistulosum L.	EC-461748	-	Wild alliums	5AKO-50
6	Allium cepa x A. fistulosum	CGN-18761	-	Wild alliums	6AcXAfistBB-18761
7	Allium cepa Shakespeare	EC-609516	-	Wild alliums	7AcShake-609516
8	Allium cepa var. aggregatum G.Don.	-	Manipur,India	Wild alliums	8AcVagg-3MT
9	Allium cepa var. aggregatum G.Don.	-	Manipur, India	Wild alliums	9AcVagg-4ET
10	Allium cepa var. aggregatum G.Don.	-	Manipur, India	Wild alliums	10AcVagg-5
11	Allium fistulosum L.	-	-	Wild alliums	11AKO-3
12	Allium fistulosum L.	-	AVRDC Taiwan	Wild alliums	12Afistul
13	Allium fistulosum L.	NIC-23426	-	Wild alliums	13Afistul-23426
14	Allium fistulosum L.	NIC-20221	-	Wild alliums	14Afistul-20221
15	Allium fistulosum L.	EC-321643-1	-	Wild alliums	15Afistul-321643-1
16	Allium fistulosum L.	EC-321643-2	-	Wild alliums	16Afistu-321643-2
17	Allium fistulosum L.	CGN-16418	-	Wild alliums	17Afistul-16418
18	Allium fistulosum L.	NGB-14619	Sweden (Nordic Genetic Resource Center, Nordgen)	Wild alliums	18Afistul-14619
19	Allium fistulosum L.	EC-609483	NBPGR, New Delhi,India	Wild alliums	19AfistuBGAN-609483
20	Allium fistulosum L.	-	-	Wild alliums	20Afistul
21	Allium fistulosum L.	All-750	Georgia, Germany	Wild alliums	21AfistulAll-750
22	Allium fistulosum L.	-	ICAR-DOGR, Pune,India	Wild alliums	22Afistulop
23	Allium fragrans Vent.	IC-383446	NBPGR, New Delhi,India	Wild alliums	23Afragr-383446
24	Allium chinense G. Don	-	Arunanchal Pradesh,India	Wild alliums	24AchinCW
25	Allium macranthum Baker	NMK-3244	Upper Sobansiri, Arunanchal Pradesh,India	Wild alliums	25Amacran-3244
26	Allium hookeri Thw.	NMK-3235	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	26Ahook-3235
27	Allium schoenoprasum L.	NGB-9969	Denmark	Wild alliums	27Aschoen-9969NF
28	Allium schoenoprasum L.	NGB-14574	-	Wild alliums	28Aschoen-14574
29	Allium macranthum Baker	NMK-3216	East Kameng, Arunanchal Pradesh,India	Wild alliums	29Amacran-3216
30	Allium macranthum Baker	NMK-3242	Upper Sobansiri, Arunanchal Pradesh,India	Wild alliums	30Amacran-3242
31	Allium macranthum Baker	NMK-3248	West Siyang,India	Wild alliums	31Amacran-3248
32	Allium macranthum Baker	NMK-3236	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	32Amacran-3236
33	Allium macranthum Baker	NMK-3229	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	33Amacran-3229
34	Allium macranthum Baker	NMK-3232	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	34Amacran-3232
35	Allium macranthum Baker	NMK-3233	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	35Amacran-3233
36	Allium macranthum Baker	NMK-3237	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	36Amacran-3237
37	Allium macranthum Baker	NMK-3238	Lower Sobansiri, Arunanchal Pradesh,India	Wild alliums	37Amacran-3238
38	Allium macranthum Baker	NMK-3243	Upper Sobansiri, Arunanchal Pradesh	Wild alliums	38Amacran-3243
39	Allium macranthum Baker	NMK-3245	Upper Sobansiri, Arunanchal Pradesh,India	Wild alliums	39Amacran-3245
40	Allium macranthum Baker	NMK-3246	Upper Sobansiri, Arunanchal Pradesh,India	Wild alliums	40Amacran-3246
41	Allium macranthum Baker	NMK-3227	-	Wild alliums	41Amacran-3227
42	Allium schoenoprasum L.	NGB-9969	Denmark	Wild alliums	42Aschoen-9969F
43	Allium macranthum	NMK-125	-	Wild alliums	43Amacran-125
44	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune,India	Wild alliums	44MKG-80
45	Allium prezwalskianum	MMK-122	ICAR-DOGR, Pune,India	Wild alliums	45Aprezwals-122
46	Allium prezwalskianum	MMK-110	ICAR-DOGR, Pune,India	Wild alliums	46Aprezwals-110
47	Allium prezwalskianum	MMK-114	ICAR-DOGR, Pune,India	Wild alliums	47Aprezwals-114
48	Allium prezwalskianum	MMK-115	ICAR-DOGR, Pune,India	Wild alliums	48Aprezwals2-115
49	Allium prezwalskianum	MMK-117	ICAR-DOGR, Pune,India	Wild alliums	49Aprezwals-117
50	Allium prezwalskianum	MMK-119	ICAR-DOGR, Pune,India	Wild alliums	50Aprezwals-119
51	Allium prezwalskianum	MMK-120	ICAR-DOGR, Pune,India	Wild alliums	51Aprezwals-120
52	Allium prezwalskianum	MMK-121	ICAR-DOGR, Pune,India	Wild alliums	52Aprezwals-121
53	Allium chinense G. Don	MMK-130	-	Wild alliums	53Achinen-130
54	Allium ascalonicum L.	-	Srinagar , ,India	Wild alliums	54AascalPRAN-2
55	Allium tuberosum Rottler ex. Spreng.	CGN-15749	Netherland	Wild alliums	55AtuberBK-15749F
56	Allium tuberosum Rottler ex. Spreng.	CGN-15749	Netherland	Wild alliums	56AtuberBK-15749NF
57	Allium tuberosum Rottler ex. Spreng.	CGN-16418	-	Wild alliums	57Atuber-16418NF
58	Allium tuberosum Rottler ex. Spreng.	CGN-16373	-	Wild alliums	58AtuberRK-16373F
59	Allium tuberosum Rottler ex. Spreng.	CGN-16373	-	Wild alliums	59AtuberRK-16373NF
60	Allium tuberosum Rottler ex. Spreng.	CGN-16412	-	Wild alliums	60Atuber-16412
61	Allium tuberosum Rottler ex. Spreng.	All-1587	-	Wild alliums	61AtuberAll-1587NF
62	Allium tuberosum Rottler ex. Spreng.	Zimmu	Coimbatore, India	Wild alliums	62AtuberZimmu
63	Allium tuberosum Rottler ex. Spreng.	-	-	Wild alliums	63MKG-84
64	Allium tuberosum Rottler ex. Spreng.	NMK-3214	East Kameng, Arunanchal Pradesh, ,India	Wild alliums	64Atuber-3214F
65	Allium tuberosum Rottler ex. Spreng.	NMK-3214	East Kameng, Arunanchal Pradesh, ,India	Wild alliums	65Atuber-3214NF
66	Allium tuberosum Rottler ex. Spreng.	IC-353524	ICAR-DOGR, Pune, ,India	Wild alliums	66Atuber-353524F
67	Allium tuberosum Rottler ex. Spreng.	NG-3183	ICAR-DOGR, Pune, ,India	Wild alliums	67Atuber-3183NF
68	Allium tuberosum Rottler ex. Spreng.	NMK-3219	East Kameng, Arunanchal Pradesh, ,India	Wild alliums	68Atuber-3219F
69	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune, ,India	Wild alliums	69MKG-83NF
70	Allium tuberosum Rottler ex. Spreng.	EG-607483	ICAR-DOGR, Pune, ,India	Wild alliums	70Atuber-607483F
71	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune, ,India	Wild alliums	71MKG-84NF
72	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune, ,India	Wild alliums	72MKG-85NF
73	Allium tuberosum Rottler ex. Spreng.	MMK-3207	ICAR-DOGR, Pune, ,India	Wild alliums	73Atuber-3207NF
74	Allium tuberosum Rottler ex. Spreng.	MMK-3228	ICAR-DOGR, Pune, ,India	Wild alliums	74Atuber-3228
75	Allium tuberosum Rottler ex. Spreng.	MMK-3229	ICAR-DOGR, Pune, ,India	Wild alliums	75Atuber-3229
76	Allium tuberosum Rottler ex. Spreng.	MMK-3231	Lower Sobansiri, Arunanchal Pradesh, ,India	Wild alliums	76Atuber-3231
77	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune, ,India	Wild alliums	77JG/AKG-15
78	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune,India	Wild alliums	78Atuber_a
79	Allium tuberosum Rottler ex. Spreng.	-	ICAR-DOGR, Pune, ,India	Wild alliums	79Atuber_b

Table 2. Primer sequences and amplification characteristics of 22 novel chloroplast based microsatellites identified in current study.

S.No.	Marker Name	Forward Primer Sequence (5'–3')	Reverse Primer Sequence (5'–3')	Ta	Position	Repeat motif	Na	Allele size range	Ho	PIC
1	Ac_cpSSR4	CCTACGAATAGAACATGACCA	GTCGAAGGGAGTTTCGTAAT	50.58	trnS-UGA IGS	(TA)₆	3	170-200	0.423	0.376
2	Ac_cpSSR 5	GGGCTTTAGTGAGAGTGAGAC	AAAGGGTAATGCCTGCTT	50.61	tRNA-Asp- trnY-GUA IGS	(TTTC)₃	2	140-160	0.408	0.324
3	Ac_cpSSR 6	AGGTTTCTTTCCTTGCTACAG	GTCATTACGTGCGACTATCTC	51.89	ycf3	(TTTC)₃	2	180-190	0.007	0.007
4	Ac_cpSSR 7	GCTACTTCTGTTCTGATTCCA	CACTTATTGCTACTGCACTGTT	51.22	rpoC1	(ATTGA)₅	2	200-210	0.499	0.374
5	Ac_cpSSR 10	TATCTCCTTCGCTTGTAGTCA	GAGTCTGCCATTGTACTGAAA	50.92	clpP	(AATG)₃	3	100-220	0.254	0.237
6	Ac_cpSSR 11	CCGGATATATCGGAAATCTT	GAAGAAGAAGCTCCGTTTACT	49.56	petA-psbJ IGS	(TAAA)₃	2	160-180	0.235	0.207
7	Ac_cpSSR 12	GTAAACGGAGCTTCTTCTTCT	AAACGGATGAGATATTCTGC	49.56	petA- psbJ IGS	(TTTA)₃	2	250-280	0.455	0.351
8	Ac_cpSSR 13	GGACAAATGATCTCAGTACCA	TGTAGAATTACCGCTTGTAGC	50.92	clpP	(TAAA)₃	3	170-210	0.225	0.212
9	Ac_cpSSR 14	GACTAAGGTTGCTGTTTCCAT	CGGTTTGTGTAGCCATAAAT	51.22	psbN-psbH IGS	(TTTA)₃	2	180-200	0.244	0.214
10	Ac_cpSSR 15	GAATAGTTGAAGTGGATTCTCC	CTATGCTACATAGGGGGATTT	51.22	PetB- petD IGS	(GGAT)₃	2	180-200	0.287	0.244
11	Ac_cpSSR 16	GTCCTCATTCCTTGCACTTAT	GTCATAGAACGGGTACCTCA	51.66	accD-psa1 IGS	(TATAA)₃	3	100-210	0.507	0.427
12	Ac_cpSSR 17	CAACTTCACGTTGACTAATGG	CGTCGATCTATCGTAACAGAA	50.92	psaC-ndhE IGS	(TA)₇	2	210-230	0.492	0.371
13	Ac_cpSSR 18	CATTGAGTGCACCCTATACAT	GTCCCTTCTGATGAACAGATT	50.92	psaC-ndhE IGS	(AAT)4	3	200-250	0.540	0.434
14	As_cpSSR1	TCTAAAGACCCCACAACATC	GACATAGTGCCCCAAAAATA	50.22	PsbK-PsbI IGS	(TTA)₄	2	200-220	0.204	0.183
15	As_cpSSR 2	AATATTCAGGGGACTACATGG	TCACAGGTAGAACGTATTTGG	50.92	tRNA-Lys -maturase K IGS	(AATT)₃	2	200-300	0.009	0.008
16	As_cpSSR 3	AGGAATTCGTCGAGATTGTA	GTGTGTGCGAGTTGTATATTTC	49.86	AtpF	(AAAT)₃	3	160-230	0.278	0.255
17	As_cpSSR 4	CAATGGACTTGAGTCAGTGAT	CGAGCCTATTTATACGCTATCT	51.22	RpoC2-RpoC1 IGS	(ATTT)₃	2	180-200	0.423	0.333
18	As_cpSSR 5	GAAAGAAGATTAAGGCTCTG	TTCTACAAACGTTGAGTCAC	48.2	ribosomal protein S4-tRNA-Thr IGS	(TA)₆	2	170-180	0.423	0.333
19	As_cpSSR 6	TTGTGTCGTCTTGTATCGAA	AAGAAGCTCCATTTACTCACTC	49.86	PetA-PsbJ IGS	(TAAA)₃	2	160-200	0.165	0.151
20	As_cpSSR 7	GCGAAATCGTAGCATAGAAA	CGACCCGAATCTAAATCTAAG	49.96	PsaJ-ribosomal protein L33 IGS	(AT)₇	2	210-220	0.188	0.170
21	As_cpSSR 8	CGGGGAATTCTATTCTGTT	CAGCTCGTGAGAATATGGTAT	49.13	ribosomal protein L20	(TA)₈	4	200-230	0.534	0.457
22	As_cpSSR 9	GCAGGAATAAGTAGAAGTCCAA	GGCAAAGCATTTTAGCAAC	49.44	NdhF-ribosomal protein L32 IGS	(AT)₉	2	200-300	0.218	0.194

Na = Observed number of alleles; Ho = Observed heterozygosity; PIC = Polymorphic Information Content(calculated by Gene Calc (Bińkowski & Miks, 2018;https://www.gene-calc.pl/pic)

Download PDF

Journal Publication

published 01 Nov, 2023

Read the published version in South African Journal of Botany →

Version 1

posted

You are reading this latest preprint version

Development of chloroplast derived SSR markers for genus Allium and their characterization in the allies for genetic improvement of alliums

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Conclusion

Declarations

References

Tables

Status:

Journal Publication

Version 1