Establishment of a CaCC-based cell model and method for high-throughput screening of M3 receptor drugs

doi:10.21203/rs.3.rs-2003368/v1

Download PDF

Research Article

Establishment of a CaCC-based cell model and method for high-throughput screening of M3 receptor drugs

https://doi.org/10.21203/rs.3.rs-2003368/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Muscarinic acetylcholine receptor subtype 3 (M3 receptor) is a G Protein-Coupled Receptor (GPCR) that mediates many important physiological functions. Currently, no M3 receptor drugs with high specificity, high activity, and few side effects have been developed, and there is a lack of methods suitable for high-throughput screening of drugs with GPCRs. In this study, we established an efficient and sensitive drug cell screening model and method for targeting M3 receptors based on calcium-activated chloride channels (CaCCs). This screening model consists of Fischer rat thyroid follicular epithelial (FRT) cells that endogenously express M3 receptors, CaCCs, and the indicator YFP-H148Q/I152L. We verified that the model can sensitively detect changes in intracellular Ca²⁺ concentration using fluorescence quenching kinetics experiments, confirmed the screening function of the model by applying available M3 receptor drugs, and also evaluated the good performance of the model in high-throughput screening.

CaCC

high-throughput screening

M3 receptor

cell model

YFP-H148Q/I152L

The muscarinic acetylcholine receptors (mAChRs) are very important members of the human G protein-coupled receptor (GPCRs) family[1]. Molecular cloning studies have revealed the presence of five subtypes of mammalian mAChRs, namely M1-M5[2]. Of these, muscarinic acetylcholine receptor subtype 3 (M3 receptor) is predominantly distributed in smooth muscle in the vasculature as well as in the pulmonary respiratory system. Activation of the M3 receptor by acetylcholine activates downstream Gq proteins and mediates an increase in intracellular Ca²⁺ levels, leading to smooth muscle contraction[3].

Because of its important physiological function in vivo, the M3 receptor has been an important drug target. Currently, several marketed drugs target the M3 receptor, such as atropine and tiotropium[4]. However, these drugs also have a high affinity for other subtypes of mAChRs and there is a risk of side effects[5]. For example, the anticholinergic bronchodilator tiotropium, which acts mainly on M3 receptors in pulmonary bronchial smooth muscle and on M2 receptors in the lung, causes adverse effects[6]. Therefore, new drugs targeting the M3 receptor with greater potency are urgently needed.

The main method of drug screening for GPCRs is to detect changes in intracellular second messenger Ca²⁺ or cAMP concentrations. One of the mainstream methods used for intracellular Ca²⁺ detection is the use of fluorescent molecular probes[7]. The limitations of such methods in terms of price and experimental manipulation have hindered their application in high-throughput drug screening. Based on this, we established a high-throughput screening cell model and method for targeting M3 receptor based on calcium-activated chloride channels (CaCCs). This screening strategy is applicable to screen most of the GPCRs drugs that mediate intracellular Ca²⁺ elevation.

CaCCs are ion channels that can be activated by trace amounts of intracellular Ca²⁺ and open to transport anions such as Cl⁻ or I⁻ into the cell. Cl⁻ is present in large amounts in the cell, while I⁻ is present in very low amounts in the cell, so demonstrating the validity of the model by changes in I⁻ has the advantage of accurate assay results and is less susceptible to interference. anoctamin-1 (ANO1) is the molecular basis of CaCCs, responding to intracellular Ca²⁺ concentrations at nanomolar levels[8, 9]. At the same time, it is a powerful I⁻transporter, capable of transporting 10⁶ per second in a single channel[10]. In combination with it, YFP-H148Q/I152L is a double mutant of yellow fluorescent protein that can be quenched by trace amounts of I⁻[11]. After extensive experiments, we found that the M3 receptor is endogenously expressed in Fischer rat thyroid (FRT) cells. FRT cells can be grown on relatively inexpensive media with good adhesion to commonly used cell culture plates while allowing stable structures expression of the transfected protein. Therefore, we applied FRT cells as vectors to stably transfect ANO1 and YFP-H148Q/I152L and successfully validated that the screening model we constructed could perform high-throughput screening of M3 receptor drugs. These results provide support for the future development of M3 receptor drugs as well as GPCRs drugs.

2.1 Materials

FRT cells were donated by Prof. Tong-hui Ma from Northeast Normal University (Jilin, China); The primers, cut-gel recovery kits, PLVX/G-418-pEGFP-ANO1 plasmid and PLVX/puromycin-YFP-H148Q/I152L plasmid were purchased from Sangon Biotech (Shanghai, China); 10% fetal bovine serum (FBS) was purchased at Thermo Fisher Scientific (USA); Lipofectamine 2000 liposomes, TRIzol reagent, Reverse transcription reagents, Geneticin (G-418), puromycin, rabbit anti-rat M3 polyclonal antibody, rabbit anti-rat β-actin monoclonal antibody, goat anti-rabbit IgG purchased from Invitrogen (California, USA); F-12 nutrient medium, Eact, Niflumic acid (NFA), carbachol, acetylcholine, bethanechol, 4-diphenylacetoxy-N-methylpiperidine methiodide (4-DAMP), tiotropium purchased from Sigma-aldrich (USA); RT-PCR reagents and whole protein extraction kits were purchased from TransGen Biotech (Beijing, China), PVDF membranes were purchased from Millipore (USA); ECL chemiluminescence assay kits were purchased from Solebro (Beijing, China).

2.2 Detection of M3 receptor endogenous expression on FRT cells

2.2.1 Detection of M3 receptor expression by RT-PCR

FRT cell lines in good growth condition were taken, and total RNA was extracted from FRT cells according to TRIzol instructions, and total RNA concentration and purity were measured by Nanodrop 2000 (Thermo Fisher, USA). The cDNA was synthesized by reverse transcription using a reverse transcription kit. 6 pairs of primers were designed and synthesized: M1-M5 receptors and β-actin, and the primer sequences and gene bank numbers are shown in Table 1. Amplification was performed using a PCR instrument (ABI, USA), and the resulting PCR products were subjected to agarose gel electrophoresis and imaged by exposure using a gel imager (Bio-Rad, USA) to compare the correct length of the products. The target bands were cut and recovered using a cut-gel recovery kit. The recovered DNA was subjected to nucleic acid sequencing.

Table 1

Primer sequence
Primers	Sequences (5' to 3')	Base number	Product length (bp)	gene bank no.
β-actin(Forward)	GTCGTCGACAACGGCTCC	18	260	NM_001101.5
β-actin(Reverse)	AGGTCTCAAACATGATCTGGGT	22	260	NM_001101.5
M1(Forward)	GGTCAACACCGAGCTCAAGA	20	343	NM_080773.1
M1(Reverse)	TTGCCAGAAGAGGATGGCTG	20	343	NM_080773.1
M2(Forward)	TGAGGGAAGGGAGACAGGTT	20	680	NM_031016.2
M2(Reverse)	GCCATTTTTGTGGTCCGCTT	20	680	NM_031016.2
M3(Forward)	CAGCAGAAGCCGAGTGATGA	20	300	NM_012527.2
M3(Reverse)	TGCAGCAAAGTAGAGAGCCT	20	300	NM_012527.2
M4(Forward)	CGGAACCTCTGGCTTGTTC	19	537	NM_031547.1
M4(Reverse)	TGCCATCTTAGTAGTGCGGC	20	537	NM_031547.1
M5(Forward)	GTGCTAACTAATGCCACGGG	20	781	NM_017362.5
M5(Reverse)	TCTGGCACTCATCAGGTGGT	20	781	NM_017362.5

2.2.2 Detection of M3 receptor expression by Western blot

The total protein of FRT cells was extracted according to the whole protein extraction kit. The protein concentration was determined using the BCA protein assay kit. Add 1× electrophoresis solution to the electrophoresis tank, add samples, electrophoresis at a constant voltage of 80 V for 30 min, and then change the voltage to 120 V for 60 min until the blue bands run out of the bottom of the gel plate. The gel was transferred to the PVDF membrane and then placed in 5% skimmed milk powder for closure. The membrane was washed with Phosphate Buffered Saline (PBS) to finish adding rabbit anti-rat antibodies to M3 and β-actin as primary antibodies overnight at 4°C. The primary antibody was recovered and the membrane continued to be washed. After washing, the protein bands were observed using the ECL chemiluminescence kit. Three sets of parallel experiments were set up for this experiment.

2.3 Establishment of a cell model co-expressing ANO1 and YFP-H148Q/I152L

2.3.1 Cell Culture

FRT cells were cultured in a modified F12 nutrient medium supplemented with 10% fetal bovine serum (FBS). Place in a 37℃, 5% CO₂ incubator and culture. After the cells were passaged more than 3 times, the cells were left in good condition before the experiment was performed.

2.3.2 Transfections

The ANO1 plasmid, transfection reagent, and F-12 basic culture medium were added to the EP tubes according to the Lipofectamine 2000 instructions, incubated at room temperature for 20 min, and then added to the cell culture medium. 48 h later, if the green fluorescence of EGFP was expressed on the cell membrane, the ANO1 transfection was successful, and then the transfected cells were screened using antibiotic G418. The cells were then screened using the antibiotic G418. After 2 weeks of screening, the obtained cell lines were subjected to limited dilution to obtain cloned lines with high expression. The YFP-H148Q/I152L plasmid was transfected with FRT cells stably expressing ANO1 in the same way. The transfected cells were screened using the antibiotic puromycin. Transfection culture to obtain FRT cell lines expressing ANO1-YFP-H148Q/I152L.

2.4 Detection of cell model functions

2.4.1 Whole-cell patch-clamp detection of ANO1 currents

FRT-ANO1 cells in good condition were taken and placed under an inverted fluorescence microscope and perfused with the electrode outer solution. The resistance of the electrode to water was approximately 4–6 MΩ, and after applying negative pressure to form a 6 GΩ high impedance seal, the cell membrane at the tip of the electrode was ruptured by rapid negative pressure to form a whole-cell recording pattern. The initial clamp voltage was 0 mV, and after 10 ms of recording, the cells were given step stimulation (-80 mV to 80 mV in steps of 20 mV). Each step stage was recorded for 1000 ms. The experiment was divided into 3 groups: Ca²⁺ group, Ca²⁺-NFA group, and control group.

The electrode outer solution (bath solution) was 140 mmol/L NMDG-Cl, 2 mmol/L MgCl₂, 5 mmol/L CaCl₂, and 10 mmol/L HEPES. The inner electrode solutions (pipette solution) contained zero calcium, 0.6 mmol/L calcium solution, 100 µmol/L NFA (ANO1 antagonist), and 0.6 mmol/L calcium solution, respectively.

2.4.2 Fluorescence quenching kinetic assay to detect ANO1 and YFP-H148Q/I152L function

FRT cells stably co-transfected with ANO1-YFP-H148Q/I152L were inoculated into black-walled clear-bottomed 96-well plates and then cultured for 36 h. The experiment was divided into three groups: agonist group, antagonist group, and control group. Each group of experiments was conducted 3 times. To the wells of the antagonist group, 40 µmol/L ANO1 antagonist NFA was added and incubated for 10 min. NaI-PBS was added to the pump of the FLUOstar automatic multifunctional zymograph (BMG, Germany), and the relative fluorescence intensity was calculated automatically every 0.2 s. The first 2 s was used as the baseline, and after 2 s the instrument added 120 µL of NaI-PBS containing 20 µmol/L ANO1 agonist Eact to the wells of the agonist and antagonist groups at a rate of 100 µL/s. To the wells of the control group, 120 µL of NaI-PBS was added. Changes in fluorescence slope values were analyzed by macro-calculation of the raw data using Excel software.

2.5 Detection of cell model to screen for M3 receptor drugs

2.5.1 Fluorescence quenching kinetics experiments

The cells were divided into 5 groups: 3 groups of agonists and 2 groups of antagonists. Three of the agonist groups were added with M3 receptor agonists carbachol, acetylcholine, and bethanechol, respectively, and a multifunctional enzyme marker was used to perform the assay and analyze the change in fluorescence slope values. The 2 groups of antagonists were incubated for 10 min by adding 4-DAMP and tiotropium, two M3 receptor antagonists respectively, and then the antagonists were aspirated out and 120 µL of NaI-PBS containing carbachol was added. Similarly, analyze the change in fluorescence slope values. Then different concentrations of the drug were applied to ANO1-YFP-H148Q/I152L cells respectively, and the trends of fluorescence slope values of different concentrations of the drug were observed.

2.5.2 Z-factor assessment

The Z-factor is an important parameter for evaluating the stability of high-throughput screening methods. It is calculated as follows: Z-factor = 1–3×(|SD_positive|+|SD_negtive|)/(|Mean_positive|-|Mean_negative|)[12]. 100 µmol/L carbachol was added to 6 columns of the 96-well plate as a positive control, while PBS was added to the other 6 columns as a negative control. The Z-factor values of the 96-well plates were assayed.

2.6 Statistical analyses

Graphical and statistical analysis was performed using GraphPad Prism, using a T-test, one-way analysis, with P < 0.05 being considered a statistically significant difference. The non-linear curve fitting analysis was performed to calculate the half effective concentration (EC₅₀) and half inhibitory concentration (IC₅₀) for the concentration-dose dependence of the different agonists and antagonists.

3.1 M3 receptors are endogenously expressed in FRT cells.

To construct a drug screening model for M3, we found that FRT cells endogenously express M3 receptors by RT-PCR and Western blot assays.

RT-PCR results showed specific bands for the M3 receptor and β-actin, while the rest of the receptors did not amplify specific bands (Fig. 1A1). The sequencing results of the cut and recovered products of the M3 bands were analyzed on Chromas software (Fig. 1A2). The nucleotide sequences measured were compared in NCBI-BLAST with the sequences of the M3 gene included in the GenBank database, and the similarity was 100%, indicating that the cloned DNA fragment was the M3 gene fragment (Fig. 1A3). The RT-PCR results showed that FRT cells endogenously expressed the M3 receptor at the mRNA level. Analysis of the three sets of Western blot results showed (Fig. 1B) that FRT cells expressed M3 receptor at the protein level.

3.2 Successful establishment of a cell model of FRT-ANO1-YFP

By inverted fluorescence microscopy, green fluorescence was visible on the membrane of FRT-ANO1 cells, demonstrating that ANO1 was expressed in the cell membrane; green fluorescence was visible in the cytoplasm and on the membrane of FRT-ANO1-YFP cells, demonstrating that YFP-H148Q/I152L was expressed in the cytoplasm (Fig. 2A). The transfection efficiency of the cells was analyzed by applying flow cytometry (BD, USA) and could be as high as more than 80% (Fig. 2B). That is, a stable transfection model of FRT cells with high expression of ANO1 and YFP-H148Q/I152L was successfully established.

3.3 ANO1 is regulated by Ca²⁺ and YFP-H148Q/I152L is I^- sensitive

3.3.1 ANO1 can be activated by Ca²⁺ and generate currents in classical CaCCs

In the patch-clamp experiment, the current increased with increasing stimulation voltage in the Ca²⁺ group after + 20 mV (Fig. 3A). At the same concentration of calcium activation, NFA effectively inhibited the open current of ANO1 (Fig. 3B). The control group showed no significant current changes in the absence of Ca²⁺ stimulation (Fig. 3C). the I-V curve showed a clear outward rectification feature (Fig. 3D), we analyzed the current values of the above three groups at 80 mV (Fig. 3E) and successfully confirmed that Ca²⁺ can open the ANO1 channel, i.e. ANO1 is regulated by Ca²⁺.

3.3.2 ANO1 can transport I^- and YFP-H148Q/I152L sensitive to I^-

The results of fluorescence quenching kinetics experiments showed that the relative fluorescence intensity of the agonist group decreased significantly after the addition of Eact and I⁻, indicating that ANO1 opened and transported I⁻ into the cell, resulting in the quenching of YFP-H148Q/I152L. The antagonist group was incubated with NFA, and then the relative fluorescence intensity did not change significantly after the addition of activator and I⁻, indicating that ANO1 was not opened. There was no significant change in relative fluorescence intensity in the control group, indicating that ANO1 was not opened (Fig. 3F). The fluorescence slope values of the agonist, antagonist, and control groups are shown in Fig. 3G. That is, it was confirmed that ANO1 could transport I⁻ into the cell in a short time and YFP-H148Q/I152L could be rapidly quenched by I⁻.

3.4 Cell models with the ability to screen M3 receptor drugs in high throughput

To demonstrate that the cell model has the function of screening M3 receptor drugs, we applied the M3 receptor embodied drugs for validation, and the agonist and antagonistic action principles are shown in Fig.s 4A and B, respectively.

3.4.1 Cell models can screen for M3 receptor drugs

The experimental results showed that the relative fluorescence intensity decreased significantly after the addition of the M3 receptor agonist and I⁻ in the agonist group, indicating that the agonist bound to the M3 receptor, causing a biological cascade reflection, Ca²⁺ concentration increase, ANO1 channel opening, I⁻ inward flow and fluorescence quenching. The antagonist group added M3 receptor antagonist also binds to M3 receptor, but plays the opposite role, after adding I⁻, there is no significant change in relative fluorescence intensity, ANO1 channel is not opened, and there is no significant change in fluorescence signal value (Fig. 5A). The fluorescence slope values of the agonist and antagonist groups are shown in Fig. 5B. The above results suggest that FRT cells co-expressing ANO1-YFP-H148Q/I152L can screen M3 receptor drugs.

The fluorescence signal detected in the agonist group showed different changes after the addition of different concentrations of the M3 receptor agonist. The EC₅₀ was 5.477, 7.863, and 14.75 µmol/L, respectively. In the antagonist group, the fluorescence signal decreased as the concentration of the antagonist increased, i.e. the greater the concentration of the antagonist, the stronger the inhibitory effect, showing a dose-dependent relationship. The IC₅₀ was 10.74 and 18.49 µmol/Lµmol/L, respectively (Fig. 5C).

3.4.2 Cell models suitable for high-throughput screening

The results of the software analysis showed that the SD_positive value was 4.648, the SD_negtive value was 4.758, the Mean_positive value was 89.64 and the Mean_negative value was 14.01. The Z-factor was calculated according to the formula to be 0.627 and the signal-to-noise ratio was 6.398:1 (Fig. 5D). It is generally considered that the model stability is high when the Z-factor is above 0.5[13]. Therefore, this cell model is suitable for high-throughput screening of M3 receptor drugs.

Like other GPCRs, mAChRs are characterized by having seven transmembrane helices[2]. The five MR isoforms share 82–92% homology in the transmembrane region and 64–82% sequence similarity overall[14]. mAChRs drugs cause significant patient distress due to side effects caused by low selectivity[15]. Therefore, the design of studies to investigate ligands selective for a particular isoform of mAChRs is of great clinical importance.

We believe that there are two possible reasons for not obtaining specific drugs: one is that there are no more M3 receptor-specific drugs to be developed or to be modified in the screening library. Today, however, combinatorial antibody libraries are very large, often containing more than 10¹¹ members[16]. So, we think this is highly unlikely. Secondly, there is not a suitable screening method. Methods commonly used nowadays to detect Ca²⁺ concentration such as calcium ion indicator method, fluorescent probe method, membrane clamp technique[7, 17–19], and new methods for screening based on the affinity of the drug to the receptor such as cell membrane chromatography (CMC) method[20]. These methods are undoubtedly non-negligible in the detection of intracellular Ca²⁺ concentrations, and each has its advantages. However, for high-throughput screening of drugs, their advantages do not work well. For example, the reagents or equipment used in these methods are more expensive and technically demanding for the experimenter. More importantly, the extremely low intracellular content of Ca²⁺ determines the difficulty of its direct detection[21, 22]. Therefore, it is difficult to meet the needs of large-scale high-throughput drug screening by the above methods.

We propose a high-throughput screening model based on ANO1 GPCRs. It has the following advantages. First, only a trace amount of Ca²⁺ is required to activate ANO1 and it can transport approximately 10⁶ I⁻ per second into the cell[8, 10]. YFP-H148Q/I152L fluorescent protein has a strong optical signal, is easily captured, and can be rapidly quenched upon encountering I⁻[11]. The combination of the two components allows for the detection of linear changes in fluorescence signal intensity. Secondly, our designed method only requires 13.8 s to complete the single-well assay, and it takes less than 25 min to screen nearly 100 drugs, and the model can be repeatedly passed for more than 20 generations, which is economical, convenient, and technically simple. In conclusion, this model is advantageous for the high-throughput screening of GPCRs drugs that can cause intracellular Ca²⁺ elevation.

Because the assay is indirect, false positive results will occur when small molecules acting on upstream and downstream targets of M3 receptors are encountered during the screening, which may screen for agonists of ANO1 channels or other endogenous Ca²⁺ channels on FRT cells. However, this does not affect our initial screening experiments for a large number of drugs, which we can subsequently validate by other methods for detecting Ca²⁺ concentration as mentioned previously.

In summary, this experiment successfully constructed a cellular screening model for drugs based on CaCC targeting the M3 receptor. This method is a milestone breakthrough for the high-throughput screening of M3 receptor drugs, and is also applicable to the screening of other GPCRs and other drugs with Ca²⁺ signaling-related targets. It lays a solid foundation for the development of drugs targeting GPCRs and opens up new ideas in many fields such as basic research and drug development, which has a rather broad application prospect.

Declaration of competing interest

All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in this manuscript.

Acknowledgments

This work was partly supported by the National Natural Science Foundation of China (81601234), the Science and Technology Project of Traditional Chinese Medicine of Jilin Province (2021092), the Starting fund for doctoral research of Jilin Medical University (JYBS2021013lk), the Project of Jilin provincial Department of Education (JJKH20220462KJ, JJKH20220473SK).

Disclosure

Xueying Liu and Xiaohong Ju are co-first authors of this study. Feng Hao and Cheng Hu are co-corresponding authors of this study. All authors declare that there are no conflicts of interest associated with this work.

Kruse, A.C.,Kobilka, B.K. &Gautam, D. et al. (2014) Muscarinic acetylcholine receptors: novel opportunities for drug development. Nat Rev Drug Discov 13 (7), 549–60.
Moran, S.P.,Maksymetz, J. &Conn, P.J. (2019) Targeting Muscarinic Acetylcholine Receptors for the Treatment of Psychiatric and Neurological Disorders. Trends Pharmacol Sci 40 (12), 1006–1020.
Jing, M.,Li, Y. &Zeng, J. et al. (2020) An optimized acetylcholine sensor for monitoring in vivo cholinergic activity. Nat Methods 17 (11), 1139–1146.
Tolaymat, M.,Sundel, M.H. &Alizadeh, M. et al. (2021) Potential Role for Combined Subtype-Selective Targeting of M(1) and M(3) Muscarinic Receptors in Gastrointestinal and Liver Diseases. Front Pharmacol 12, 786105.
Kow, R.L. &Nathanson, N.M. (2012) Structural biology: Muscarinic receptors become crystal clear. Nature 482 (7386), 480–1.
Haga, K.,Kruse, A.C. &Asada, H. et al. (2012) Structure of the human M2 muscarinic acetylcholine receptor bound to an antagonist. Nature 482 (7386), 547–51.
Rossi, A.M. &Taylor, C.W. (2020) Reliable measurement of free Ca(2+) concentrations in the ER lumen using Mag-Fluo-4. Cell Calcium 87, 102188.
Peters, C.J.,Gilchrist, J.M. &Tien, J. et al. (2018) The Sixth Transmembrane Segment Is a Major Gating Component of the TMEM16A Calcium-Activated Chloride Channel. Neuron 97 (5), 1063–1077.e4.
Ji, Q.,Guo, S. &Wang, X. et al. (2019) Recent advances in TMEM16A: Structure, function, and disease. J Cell Physiol 234 (6), 7856–7873.
Dang, S.,Feng, S. &Tien, J. et al. (2017) Cryo-EM structures of the TMEM16A calcium-activated chloride channel. Nature 552 (7685), 426–429.
Greenwald, E.C.,Mehta, S. &Zhang, J. (2018) Genetically Encoded Fluorescent Biosensors Illuminate the Spatiotemporal Regulation of Signaling Networks. Chem Rev 118 (24), 11707–11794.
Rebbeck, R.T.,Singh, D.P. &Janicek, K.A. et al. (2020) RyR1-targeted drug discovery pipeline integrating FRET-based high-throughput screening and human myofiber dynamic Ca(2+) assays. Sci Rep 10 (1), 1791.
Sharma, K.K.,Przybilla, F. &Restle, T. et al. (2016) FRET-based assay to screen inhibitors of HIV-1 reverse transcriptase and nucleocapsid protein. Nucleic Acids Res 44 (8), e74.
Maeda, S.,Qu, Q. ,Robertson &M.J. et al. (2019) Structures of the M1 and M2 muscarinic acetylcholine receptor/G-protein complexes. Science 364 (6440), 552–557.
Bradley, S.J.,Molloy, C. &Valuskova, P. et al. (2020) Biased M1-muscarinic-receptor-mutant mice inform the design of next-generation drugs. Nat Chem Biol 16 (3), 240–249.
Lin, C.W. &Lerner, R.A. (2021) Antibody Libraries as Tools to Discover Functional Antibodies and Receptor Pleiotropism. Int J Mol Sci 22 (8), 4123.
Dana, H.,Sun, Y. &Mohar, B. et al. (2019) High-performance calcium sensors for imaging activity in neuronal populations and microcompartments. Nat Methods 16 (7), 649–657.
de la Peña, E. &Gomis, A. (2019) Characterization of TRPC Channels in a Heterologous System Using Calcium Imaging and the Patch-Clamp Technique. Methods Mol Biol 1987, 83–97.
Linsdell, P.,Negoda, A. &Cowley, E.A. et al. (2020) Electrostatic Tuning of Anion Attraction from the Cytoplasm to the Pore of the CFTR Chloride Channel. Cell Biochem Biophys 78 (1), 15–22.
Lin, Y.,Jia, Q. &Sun, W. et al. (2020) Multi targeted cell membrane chromatography: A comprehensive method for screening the anaphylactoid components from complex samples. Talanta 209, 120539.
Yue, J.F.,Qiao, G.H. &Liu, N. et al. (2016) Novel KCNQ2 channel activators discovered using fluorescence-based and automated patch-clamp-based high-throughput screening techniques. Acta Pharmacol Sin 37 (1), 105–10.
Bootman, M.D.,Allman, S. &Rietdorf, K. et al. (2018) Deleterious effects of calcium indicators within cells; an inconvenient truth. Cell Calcium 73, 82–87.

No competing interests reported.

Download PDF

Editorial decision: Major revision
04 Oct, 2022
Reviews received at journal
30 Sep, 2022
Reviewers agreed at journal
22 Sep, 2022
Reviewers invited by journal
18 Sep, 2022
Editor assigned by journal
29 Aug, 2022
Submission checks completed at journal
29 Aug, 2022
First submitted to journal
26 Aug, 2022

You are reading this latest preprint version

Establishment of a CaCC-based cell model and method for high-throughput screening of M3 receptor drugs

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Materials

2.2 Detection of M3 receptor endogenous expression on FRT cells

2.2.1 Detection of M3 receptor expression by RT-PCR

2.2.2 Detection of M3 receptor expression by Western blot

2.3 Establishment of a cell model co-expressing ANO1 and YFP-H148Q/I152L

2.3.1 Cell Culture

2.3.2 Transfections

2.4 Detection of cell model functions

2.4.1 Whole-cell patch-clamp detection of ANO1 currents

2.4.2 Fluorescence quenching kinetic assay to detect ANO1 and YFP-H148Q/I152L function

2.5 Detection of cell model to screen for M3 receptor drugs

2.5.1 Fluorescence quenching kinetics experiments

2.5.2 Z-factor assessment

2.6 Statistical analyses

3. Results

3.1 M3 receptors are endogenously expressed in FRT cells.

3.2 Successful establishment of a cell model of FRT-ANO1-YFP

3.3 ANO1 is regulated by Ca²⁺ and YFP-H148Q/I152L is I^- sensitive

3.3.1 ANO1 can be activated by Ca²⁺ and generate currents in classical CaCCs

3.3.2 ANO1 can transport I^- and YFP-H148Q/I152L sensitive to I^-

3.4 Cell models with the ability to screen M3 receptor drugs in high throughput

3.4.1 Cell models can screen for M3 receptor drugs

3.4.2 Cell models suitable for high-throughput screening

4. Discussion

Declarations

Declaration of competing interest

Acknowledgments

Disclosure

References

Additional Declarations

Status:

Version 1

Establishment of a CaCC-based cell model and method for high-throughput screening of M3 receptor drugs

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Materials

2.2 Detection of M3 receptor endogenous expression on FRT cells

2.2.1 Detection of M3 receptor expression by RT-PCR

2.2.2 Detection of M3 receptor expression by Western blot

2.3 Establishment of a cell model co-expressing ANO1 and YFP-H148Q/I152L

2.3.1 Cell Culture

2.3.2 Transfections

2.4 Detection of cell model functions

2.4.1 Whole-cell patch-clamp detection of ANO1 currents

2.4.2 Fluorescence quenching kinetic assay to detect ANO1 and YFP-H148Q/I152L function

2.5 Detection of cell model to screen for M3 receptor drugs

2.5.1 Fluorescence quenching kinetics experiments

2.5.2 Z-factor assessment

2.6 Statistical analyses

3. Results

3.1 M3 receptors are endogenously expressed in FRT cells.

3.2 Successful establishment of a cell model of FRT-ANO1-YFP

3.3 ANO1 is regulated by Ca2+ and YFP-H148Q/I152L is I- sensitive

3.3.1 ANO1 can be activated by Ca2+ and generate currents in classical CaCCs

3.3.2 ANO1 can transport I- and YFP-H148Q/I152L sensitive to I-

3.4 Cell models with the ability to screen M3 receptor drugs in high throughput

3.4.1 Cell models can screen for M3 receptor drugs

3.4.2 Cell models suitable for high-throughput screening

4. Discussion

Declarations

Declaration of competing interest

Acknowledgments

Disclosure

References

Additional Declarations

Status:

Version 1

3.3 ANO1 is regulated by Ca²⁺ and YFP-H148Q/I152L is I^- sensitive

3.3.1 ANO1 can be activated by Ca²⁺ and generate currents in classical CaCCs

3.3.2 ANO1 can transport I^- and YFP-H148Q/I152L sensitive to I^-