Yeast hydrolysate attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage in weaned piglet

doi:10.21203/rs.3.rs-2005990/v1

Download PDF

Research Article

Yeast hydrolysate attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage in weaned piglet

https://doi.org/10.21203/rs.3.rs-2005990/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 17 Mar, 2023

Read the published version in Journal of Animal Science and Biotechnology →

You are reading this latest preprint version

Background

Yeast hydrolysate (YH) has attracted much attention as a nutritional additive, and it is generally considered to be non-toxic, effective and safe. However, there is still inconclusive on the effects of dietary YH supplementation on immunity function and intestinal barrier of piglets. This study was conducted to investigate the effects of YH supplementation on inflammatory responses and intestinal barrier in piglets challenged with lipopolysaccharide.

Methods

Twenty-four piglets (with an average body weight of 7.42 ± 0.34 kg) weaned at 21 days of age were randomly fed a diet containing 0 or 0.5% yeast hydrolysate for 21 days. On the 22nd day, half of piglets were intraperitoneally injected with lipopolysaccharide at 150 µg/kg BW, and the other half were injected with an equal volume of sterile normal saline. Four hours later, blood samples of each piglet were collected and then piglets were slaughtered.

Results

LPS injection increased serum levels of adrenocorticotropic hormone (ACTH), cortisol, haptoglobin (HP), serum amyloid A protein (SAA), tumor necrosis factor-α (TNF-α), and diamine oxidase (DAO) (P < 0.05), decreased the jejunal villus height, the protein and mRNA abundances of zonula occludens-1 (ZO-1) and occludin (OCLN) (P < 0.05), enhanced the protein and mRNA abundances of TNF-α, interleukin-1β (IL-1β), toll-like receptors 4 (TLR4) and phosphor-Nuclear factor-κB-p65 (p-NFκB-p65) (P < 0.01). Dietary YH supplementation attenuated the impaired effects of ACTH, cortisol, HP, IL-1β, and DAO in serum (P < 0.05). Furthermore, YH supplementation up-regulated the villus height, protein and mRNA abundances of ZO-1 and OCC (P < 0.05), downregulated TNF-α, IL-1β, TLR4 and p-NFκB-p65 mRNA expressions and the corresponding protein abundances in the jejunum in LPS-challenged pigs (P < 0.01).

Conclusion

YH could alleviate inflammatory response and intestinal barrier injury in weaned piglets challenged with LPS, which was associated with inhibited the TLR4/NF-κB signaling pathway.

Yeast hydrolysate

piglets

lipopolysaccharide

intestinal barrier

inflammatory response

Intestinal epithelial barrier, a structure of continuous monolayer enterocytes, is dominated by intercellular tight junction [1]. Under a normal state, it acts as a selective filter that enables the absorption of nutrients and ensures an effective defense against exogenous pathogens, luminal antigens, etc. [2]. For early weaned mammals, however, the gastrointestinal tract is immature and vulnerable to multitudinous stresses [3], and intestinal epithelial barrier is frequently defective in various pathological status, and in bacterial infections induced by pathogens [4, 5].The damaged intestinal epithelial barrier mainly causes the increase of intestinal permeability, promotes the transfer of antigens in lumen to the subepithelial tissues, and further exacerbates the mucosal and systemic inflammatory reactions [1, 6, 7]. In particular, the secretion of pro-inflammatory cytokines during the inflammatory response is a major factor in triggering the disruption of the intestinal barrier [8]. Thus, several investigations suggested that a feasible intestinal protection strategy was to prevent the occurrence of intestinal inflammation. Intestinal inflammation occurs in piglets at weaning, and is frequently accompanied by structural and functional damage with subsequent diarrhea and growth retardation [9]. Therefore, effective and safe preventive approaches to maintenance of intestinal health are urgently needed for piglets.

Yeast (Saccharomyces cerevisiae) is widely distributed in nature and has been inseparable from human life [10]. Yeast hydrolysate (YH), also known as yeast autolysate, is obtained from Saccharomyces cerevisiae via protein hydrolysis enzyme [11, 12]. Several researches suggested that the autolytic yeast fractions or peptides from autolyzed yeasts revealed physiological effects on anti-obesity [13, 14], anti-fatigue [15], anti-stress [16, 17] and immuno-promotional activities [18, 19]. For these reasons, YH has attracted much attention as a functional material supplement and it is generally recognized as non-toxic, effective and safe [20]. Recently, several studies were focused on improving intestinal health and immune-potentiating activities with YH. Specifically, YH has multiple roles on promoting digestion and absorption of nutrients [21], improving intestinal microflora structure [22] and decreasing the diarrhea of young animals [15], while also acts as an immunomodifier to prevent gut inflammation [23]. However, the protective effects of dietary supplementation with YH on intestinal barrier are limited and inconclusive. It is widely known that over-inflammation in intestine is one of the most factors causing intestinal barrier dysfunction [1, 2, 9]. Consequently, considering the above, we postulated that YH has the potential to prevent the LPS-induced intestinal barrier dysfunction in piglets by alleviating inflammation and the related signaling pathways. This study demonstrated these hypotheses by assessing the effects of YH on the systemic inflammatory response, intestinal morphology, expression of tight junction-related proteins and gut anti-inflammatory capacity in piglets.

Chemical analysis of yeast hydrolysate

Yeast hydrolysate was provided by Jiangmen Thealth Bioengineering Co., Ltd (Guangzhou, China). The contents of moisture, crude protein, crude fat and crude ash were measured with the reference of AOAC [24]. Gross energy was determined by an oxygen bomb calorimeter (Parr instruments, Moline, IL). The soluble protein in yeast hydrolysate was extracted according to the method of Wang et al. [25] and fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) system using the previous study [26]. The gel was stained with Coomassie Brilliant Blue (Beyotime, Shanghai, China) for 40 minutes and de-stained with deionized water for 8 hours.

Experimental animals, diet, and design

The animal procedures were reviewed and approved by the Animal Care and Use Committee at Sichuan Agricultural University. A total of twenty-four weaned piglets (21-d-old), with an average initial body weight of 7.42±0.34 kg, were randomly allotted to two groups receiving either a basal diet or YH diet (the basal diet supplementation with 5000 mg/kg yeast hydrolysate) for 21 days (Fig. 2A). The basal diet (Table 2) was formulated to meet and exceed NRC (2012) requirements. The molecular weight of yeast hydrolysate was less than 50 kDa and mostly clustered below 25 kDa (Fig. 1). Yeast hydrolysates mainly provided a rich source of crude protein (45.50%), and contributed less to crude ash (6.47%) and crude fat (2.17%). Piglets have free access to water and feed throughout the experiment.

LPS injection

After 21-day feeding trial, immunological challenge was applied to the half of piglets in each of two groups (Fig. 2A). The challenged piglets were intraperitoneally injected with Escherichia coli LPS (E. coli serotype O55: B5, Sigma Chemical Inc., St. Louis, MO, United State) at 150 μg/kg BW, and unchallenged piglets were administrated the same volume of sterile physiological saline. The dose of LPS used in this study was consistent with the previous report [27]. Previous experiments have presented that LPS injection particularly caused dramatic inflammatory response and intestinal barrier dysfunction in pigs, rats and mice. And these negative effects generally occurred within 3-6 hours after LPS injection [7, 28]. Therefore, blood and intestinal samples in this study were collected 4 h following LPS or saline injection.

Growth performance

Yeast hydrolysate treatment was a main factor prior to the LPS challenge. Piglets were weighted individually on day 1 and 22 of the experiment. Daily feed consumption was recorded for each piglet. Average daily gain and the ratio of feed intake to gain were calculated as well.

Blood sample collection and analysis

Four hours following LPS and saline injection, blood samples were collected in 10 ml vacutainer tubes via anterior vena cava. Blood was centrifugated at 3500 ×g for 10 min at 4℃. Serum samples were stored at -20℃ until subsequent analysis for inflammatory markers and diamine oxidase (DAO) levels. Commercially available porcine ELISA kits (Chenglin Biological Technology Co., Ltd, Beijing, China) were performed according to the manufacturer’s instructions for the following indicators: adrenocorticotropic hormone (ACTH), cortisol, C-reactive protein (CRP), serum amyloid A (SAA), haptoglobin (HP), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and DAO in serum.

Intestinal samples collection and analysis

Piglets were euthanized with pentobarbital sodium (200 mg/kg) in a separate sampling room away from other animals. The intestine was immediately removed. A 2-cm segment was removed from mid-jejunum and fixed with 4% paraformaldehyde solution. Paraffin embedding was used to cut into cross sections (5 μm thick). The jejunal morphology was determined by hematoxylin and eosin (H＆E) stain. Intestinal morphological images were photographed with a Nikon TS100 microscope (40 × and 100 ×). Villus height and crypt depth were analyzed and calculated by Image Pro Plus 6.0 software (Media Cybernetics, Bethesda, MD, USA). Other sections were stained using immunofluorescence for TLR4 protein. Briefly, mouse anti-TLR4 monoclonal antibody (1:100, sc-293072, Santa Cruz, Dallas, TX, USA) was incubated overnight at 4℃. Corresponding secondary antibody (Cy3 conjugated Goat Anti-mouse IgG, 1:300, GB21301 from Servicebio, Wuhan, China) was incubated for 50 minutes at room temperature. The slides were washed three times with PBS, and then incubated with DAPI solution at room temperature for 10 min and stored in the dark. After immunofluorescence, microphotographs were acquired with an inverted microscope (Leica DMI400B, Germany). In addition, open the middle segment of jejunum longitudinally (about 15-cm) and wash with ice-clod saline, and then mucosal samples were scraped into sterile tube. Mucosal samples were immediately placed into liquid nitrogen and stored at -80℃ until the analysis of genes and proteins expressions. About 0.5 g of frozen jejunal mucosal scrapings were homogenized in ice-cold saline and prepared into a 10% homogenate, crushed using an ultrasonic cell crushing system at 4°C and then centrifuged (3,000 x g, 15 min, 4°C). The collected supernatant was used to analyze TNF-α and IL-1β contents.

mRNA abundance analysis

Total RNA was extracted from jejunal mucosa using the TRIZOL reagent (TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China). RNA integrity was verified by agarose gel electrophoresis. cDNA was synthesized with PrimeScript RT kit (TaKaRa). Real-time PCR was performed using SYBR Premix Ex Taq reagents (TaKaRa) and CFX-96 RT-qPCR Detection System (Bio-Rad). The genes of intestinal barrier and inflammatory markers related primer pairs were synthesized by Invitrogen (Shanghai, China) and listed in table 3. The mRNA expression of target gene relative to housekeeping gene (β-actin) was calculated by the method of Arce et al. [29].

Western blot analysis

Western blot analysis was performed as previously described. Briefly, protein was extracted from jejunal mucosa using the lysis buffer (Beyotime, Shanghai, China). Protein concentration was measured with the BCA protein assay kit (Pierce, Rockford, IL, USA). Then, protein was transferred to polyvinylidene fluoride membranes using a wet Trans-Blot system (Bio-Rad). After blocking, membranes were incubated with primary antibodies: anti-TLR4 (sc-293072, Santa Cruz, USA), anti-ZO1 (61-7300, Invitrogen, USA), anti-OCC (ab31721, abcam, UK), anti-TNF-α (ab6671, abcam), anti-IL-1β (sc-12742), anti-NFκB-p65 (6956, CST, Cell signaling Technology, USA), anti-p-NFκB-p65 (3033, CST), and anti-β-actin (sc-47778, Santa Cruz). After washing, the corresponding secondary antibodies, goat anti-rabbit/mouse IgG -HRP secondary antibody (sc-2030 and sc-2031, Santa Cruz), were incubated at room temperature for 1 h. Visualization of membranes was performed with the Clarity™ Western ECL substrate (Bio-Rad) and the ChemiDoc XRS imaging system (Bio-Rad). The β-actin was applied as a controller for the mean of protein load.

Statistical analysis

All data were analyzed by SAS statistical software (Version 9.4; S.A.S, Institute Inc., Cary, NC, USA) and tested for normality using the Shapiro-Wilk test. Each piglet served as the statistical unit. The data of growth performance were analyzed by two-tailed Student’s t-test. For data from serum and jejunum, the MIXED model procedures of SAS were used for statistical analysis. The model included the following main effects: diet (0% or 0.5% yeast hydrolysate), immunological challenge (saline or LPS), and the interactions of diet and challenge. All data were expressed as means ± SEM. P < 0.05 was considered statistically significant, and 0.05 < P < 0.10 indicated a trend.

YH exhibits growth-promoting effect in piglets.

Firstly, a 21-day feeding experiment was conducted to examine the effects of YH on growth performance of piglets under normal conditions (Fig. 2A). Compared with control group, dietary YH supplementation increased ADFI (P < 0.01) and ADG (P < 0.01) (Fig. 2B and 2C), decreased F/G of piglets (P < 0.05) (Fig. 2D).

YH alleviates systemic inflammatory response in piglets challenged with LPS

To investigate whether dietary YH supplementation can alleviate LPS-induced inflammatory response in piglets, we first analyzed the pro-inflammatory factors including acute phase protein, stress hormone and cytokines in serum (Fig. 3). As expected, compared with saline treatment, LPS injection enhanced SAA (Fig. 3A), HP (Fig. 3B), cortisol (Fig. 3D), ACTH (Fig. 3E) and TNF-α (Fig. 4A) levels in serum (P < 0.05). The levels of ACTH, cortisol, HP and TNF-α were decreased by adding YH to the diet (P <0.01). There was a significant diet × LPS interaction observed for ACTH, cortisol, HP and IL-1β (Fig. 4B) (P <0.05). Regarding these variables, piglets fed YH diets showed a lower response to LPS injection.

YH attenuates LPS-induced intestinal barrier dysfunction.

The gut is a well-recognized immune organ, and the intestinal barrier has been shown to defend against the invasion of pathogenic bacteria and antigens. Hence, we next examined whether dietary YH inclusion possessed a preservative effect on intestinal barrier in LPS-caused immune-stimulation. The result showed that LPS challenge enhanced the serum concentrations of DAO (Fig. 5C) (P < 0.01), caused dramatic intestinal congestion (Fig 5A), induced intestinal mucosal injury reflected by villous atrophy and mucosal detachment (Fig. 5B), and decreased the villus height (Fig. 5D) (P < 0.05) and the ratio of villus height to crypt depth (Fig. 5F) (P < 0.05). Dietary YH supplementation significantly decreased DAO levels (P < 0.05), and improved villus height (P < 0.01) and the ratio of villus height to crypt depth (P < 0.01). No interaction effects were observed on DAO levels and jejunal morphology (P > 0.05). The intestinal barrier-related proteins were further examined (Fig. 6). LPS injection reduced the relative mRNA expressions of CLDN-1 (Fig. 6A), ZO1 (Fig. 6B), OCC (Fig. 6C) and MUC2 (Fig. 6D) in jejunal mucosa (P < 0.05). Piglets received YH diet had higher protein abundance of OCC (Fig. 6E and 6F) (P < 0.01), and trended to increase the relative mRNA expression of ZO1 (P = 0.06). There was an interaction effect between dietary YH supplementation and LPS challenge, as piglets given YH had higher mRNA expression of OCC and MUC2 (P < 0.05) and more protein abundance of OCC and ZO1 (Fig. 6E and 6G) in LPS challenged-piglets (P < 0.01).

YH inhibits the expression of TNF-α and IL-1β of jejunum in piglets challenged with LPS.

To determine whether YH also can attenuate intestinal inflammation, we assessed the levels of inflammatory markers in jejunal mucosa. LPS injection enhanced the concentrations of TNF-α (Fig. 7A) (P = 0.06) and IL-1β (Fig. 7B) (P < 0.01) in jejunal mucosa. A further analysis by RT-qPCR and western blot revealed that LPS challenge significantly increased the mRNA expressions of TNF-α (Fig. 7C) and IL-1β (Fig. 7D) and the corresponding protein abundances (Fig. 7E-7G) (P < 0.01). Conversely, a down-regulation was observed in the mRNA and protein abundance of TNF-α and IL-1β in piglets fed YH diet (P < 0.01). Also, the inflammatory markers were markedly affected by the interaction of LPS injection and YH diet. Specifically, dietary YH inclusion markedly down-regulated the mRNA and protein expression IL-1β and the levels and protein abundance of TNF-α in piglets challenged with LPS (P < 0.05).

YH suppresses the inflammatory response in the jejunum of LPS-challenged piglets by reducing TLR4 signaling.

Next, we sought to identify whether the afore mentioned changes in pro-inflammatory cytokines were related to TLR4 signaling (Fig. 8). We investigated the expression of TLR4, the major inflammation-associated receptor, by immunofluorescence analysis and discovered that the distribution of TLR4 in jejunum of piglets enhanced by LPS challenge (Fig. 8A). Nevertheless, the variability was reversed with the supplementation of YH when compared to the piglets fed a basal diet. Moreover, we observed an up-regulation in the expressions of TLR4 protein (Fig. 8B and 8C) and p-NFκB-p65 protein (Fig. 8B and 8D) in piglets challenged by LPS (P < 0.01). Dietary YH supplementation decreased the protein abundances of TLR4 and p-NFκB-p65 (P < 0.01). Here, an interaction of LPS injection and YH diet was found for TLR4 protein (P < 0.05).

For piglets, weaning is generally contributed to intestinal barrier dysfunction, accompanied by the enhancement of intestinal permeability, resulting in the invasion of pathogenic bacterium and then causing intestinal injury [30]. These negative effects are partly attributable to an immaturity of intestinal tract and systemic immunity for piglets during the weaning phase. Therefore, there is urgently needed for an effective and safe strategy to improve the intestinal status. YH, an autolysate of Saccharomyces cerevisiae, possesses multi-biological effects and is received remarkable attention as a functional ingredient for improving the growth performance and intestinal environment [15, 18]. As shown in an animal model, the low molecular weight YH (below 30 kDa) exhibits a low toxicity [20]. This hydrolysate is more accessible to animals due to its low molecular weight contributing to a higher solubility in aqueous media and a better digestibility and absorptivity [31]. Previous studies have found that YH (below 10 kDa) revealed physiological effects on anti-obesity [32, 33] and anti-stress [16, 17]. And the beneficial effects of YH on growth performance have been characterized in rats [34], piglets [35], growing-finishing pigs [21], chickens [36] and fish [23, 37]. In this study, the molecular weight of YH was less than 50 kDa and mostly clustered below 25 kDa. Throughout the 21-d feeding experiment (pre-challenge), we observed that dietary YH supplementation increased growth performance of piglets. Similar results have been found in our previous study that feeding YH significantly improved growth performance for piglets under the normal physiological condition and the reason might be that YH could improve intestinal barrier function [18]. Nevertheless, it remains to be studied whether YH can improve intestinal health under pathological states. In the present study, we focused on whether dietary YH alleviated the intestinal barrier impairment through inhibiting the massive release of pro-inflammatory cytokines. Hence, we utilized an incontrovertible model for acute gut injure by injecting lipopolysaccharide (LPS). LPS is an intrinsic constituent of membranes in gram-negative bacteria and it is a powerful endotoxin [7]. It binds to Toll-like receptor 4 (TLR4) and subsequently activates downstream signaling pathways, triggering an inflammatory response [38].

Acute phase proteins (APPs) such as C-reactive protein (CRP), haptoglobin (HP) and serum amyloid A (SAA) were secreted by hepatocytes and served as a crucial role in the etiopathogenesis of immune diseases [39]. In addition, some stress hormones (eg. ACTH and cortisol) were frequently used in response to infectious status in the body [40]. With the infection and injury of the host, serum concentrations of APPs and stress hormones will be dramatically enhanced. Indeed, our results demonstrated that LPS-injection enhanced the serum concentrations of HP, SAA, ACTH and cortisol in piglets. However, supplementation of YH to the LPS-infected piglets reduced the levels of HP, ACTH and cortisol, suggesting that YH attenuated LPS-induced stress response. To our knowledge, TNF-α and IL-1β were the critical inducers of APPs [41]. And it is a highly significant correlation between serum APPs and TNF-α levels in some infectious agents [42]. In the present investigation, LPS challenge resulted in an increase of TNF-α and IL-1β in serum. Undoubtedly, LPS caused an excessive activation of immune system. Nevertheless, YH supplementation alleviated the increase of TNF-α and IL-1β in LPS-piglets, which indicated dietary YH supplementation could ameliorate the systemic inflammation after LPS infection. Over-production of proinflammatory cytokines manufactured intestinal damage, such as villous atrophy, mucosal swelling, submucosal hemorrhage and exfoliation, and led to an increase of intestinal permeability [7]. Several blood indictors have been used to evaluate the intestinal permeability. DAO, an enzyme found at high levels in the mammalian intestinal mucosa, is a marker of maturation and integrity in response to intestinal epithelium [43]. The levels of serum DAO are positively correlated with intestinal permeability. In this study, YH supplementation reduced DAO concentrations, indicating that YH had beneficial effects on alleviating the increase of intestinal permeability of piglets challenged with LPS. Meanwhile, intestinal permeability can usually be assessed with intestinal epithelial barrier function [6]. Therefore, it is possible that YH supplementation can mitigate systemic inflammatory associated with the improvement of intestinal barrier function.

Intestinal morphology is regarded as a visual reflection for the growth and development of gut and determined by villus height and crypt depth [44]. This study showed that LPS-injection induced intestinal damage including villous atrophy, mucosal detachment, and a decrease of villus height in jejunum of piglets. While dietary inclusion of YH could counteract the morphological changes of jejunum after LPS challenge, thereby maintaining the villus integrity and structure of intestinal mucosa. Considering the importance of intestinal epithelial barrier in intestinal function, the tight junctions between epithelial cells were analyzed in this study. Tight junctions are multi-protein complexes including claudins, occludin and ZOs, which defend against the passage of luminal antigens, pathogenic bacterium and their toxins [6]. Recently, the experimental results showed that YH inclusion markedly attenuated the down-regulation mRNA expressions of occludin, and the protein abundances of occludin and ZO1 in jejunal mucosa of LPS-challenged piglets. Thus, dietary YH administration could maintain the integrity of intestinal barrier by inhibiting the decrease of tight junction protein expression under immunological stress, which might be the potential reasons why YH alleviated the impairments of intestinal permeability and morphology in LPS-piglets.

It is generally accepted that cytokines are the critical modulators of intestinal inflammation [41]. Over-production of pro-inflammatory cytokines (e.g. TNF-α and IL-1β) has been demonstrated to directly impair the tight junctional function of some epithelial and endocrine cells [45]. Previous studies have indicated that alleviating intestinal inflammation might effectively prevent pathogenic bacteria and their toxins from disrupting intestinal barrier function [2]. Consequently, the reduction of intestinal pro-inflammatory cytokine concentrations under stressful conditions is one of the major strategies to protect the intestinal barrier and mitigate intestinal inflammation. In the present study, YH supplementation significantly reduced the mRNA expressions of TNF-α and IL-1β, and the corresponding protein abundances in jejunal mucosa in LPS challenged-piglets. Similarly, Waititu et al. [46] reported that piglets receiving a YH riched in cell wall polysaccharides reduced TNF-α level in ileum challenged by LPS. Hence, the protected effect of YH on intestinal barrier appears to be achieved by suppressing the inflammatory response. This is also a possible reason why YH ameliorates the systemic inflammatory response.

With a further view to investigating the molecular mechanisms of YH in the alleviation of intestinal inflammation, we evaluated the activation of TLR4 signaling pathway. TLR4, a typical pattern recognition receptor in the TLR protein family, is widely distributed on the surface of various intestinal cells and plays an essential role in LPS-mediated signaling [38]. Mechanistically, TLR4 activation triggered by LPS can induce the increased expression of downstream molecules (such as NF-κB), and then enhance the expression of proinflammatory cytokines-related genes, resulting in intestinal barrier damage [7, 47]. Currently, we observed that YH supplementation significantly decreased the protein abundance and immunofluorescence intensity of TLR4 in jejunal mucosa of piglet challenged with LPS, as well as downregulated the protein levels of p-NF-κB. NF-κB, the master transcription factor for TLR4 signaling, is phosphorylated and translocated to the nucleus in the stimulated state, then promoting the release of pro-inflammatory cytokines [48]. Accordingly, YH supplementation inhibits the TLR4/NF-κB signaling pathway, which may represent a potential mechanism to decelerate the signaling of LPS, thereby enabling the inflammatory response to be dampened.

Dietary YH supplementation improves the growth performance and alleviates LPS-induced intestinal barrier injury and inflammation, which was associated with inhibited the TLR4/NF-κB signaling pathway and decreased the overproduction of inflammatory cytokines, as well as improved intestinal barrier function.

ACTH: Adrenocorticotropic hormone; ADFI: Average daily feed intake; ADG: Average daily gain; CLDN-1: Claudin-1; CRP: C-reactive protein, DAO: Diamine oxidase; F/G: The ratio of feed intake to gain; HP: Haptoglobin; IL-1β: Interleukin-1β; LPS: Lipopolysaccharide; MUC2: mucin2; NF-κB: Nuclear factor-κB; OCLN: Occludin; SAA: Serum amyloid A; TLR4: Toll-like receptors 4; TNF-α: Tumor necrosis factor-α; YH: Yeast hydrolysate; ZO1: Zonula occludens1.

Acknowledgments

We gratefully acknowledge our debt to the generous donation from Jiangmen Thealth Bioengineering Co., Ltd, and the help of Huifen Wang and Zhemin Gu in animal experiment and sample collection.

Author’s contributions

BY conceived and designed the experiment. RF and CL participated in the animal experiment, data analysis and drafting of the manuscript. DC, GT, PZ and JH were responsible for animal care and sampling. JY and XM contributed technical support. YL and JL performed biochemical analysis.

Funding

This work was supported by the National Key Research and Development Program of China (2018YFD0500605), the Key Research and Development Program of Sichuan Province (2021YFYZ0008), and the Sichuan Pig Innovation Team of National Modern Agricultural Industry Technology System of China (scsztd-2020-08-11).

Ethics approval and consent to participate

All procedures described in this study were approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University (No.20190129).

Consent for publication

Not applicable.

Competing interests

Authors declare there are no competing interests.

Rana AS, Michel B, Thomas M. Mechanism of cytokine modulation of epithelial tight junction barrier. Front Biosci: a journal and virtual library. 2009,14: 2765.
Croschwitz KP, Hogan SP. Intestinal barrier function: molecular regulation and disease pathogenesis. J Allergy Clin Immun. 2009,124(1): 3-20.
Weström B, Arévalo-Sureda E, Pierzynowska K, Pierzynowski SG, Pérez-Cano FJ. The immature gut barrier and its importance in establishing immunity in newborn mammals. Front Immunol. 2020,11: 1153.
Ng QX, Soh AYS, Loke W, Lim DY, Yeo WS. The role of inflammation in irritable bowel syndrome (IBS). J Inflamm Res. 2018,11: 345.
Barani M, Rahdar A, Sargazi S, Amiri MS, Sharma PK, Bhalla N. Nanotechnology for inflammatory bowel disease management: Detection, imaging and treatment. Sensing and Bio-Sensing Res. 2021,32:100417.
Anderson R, Dalziel J, Gopal P, Bassett S, Ellis A, Roy N. The role of intestinal barrier function in early life in the development of colitis. Colitis. 2012: 1-30.
Williams JM, Duckworth CA, Watson AJ, Frey MR, Miguel JC, Burkitt MD, et al. A mouse model of pathological small intestinal epithelial cell apoptosis and shedding induced by systemic administration of lipopolysaccharide. Dis Model Mech. 2013,6(6): 1388-1399.
Hiippala K, Jouhten H, Ronkainen A, Hartikainen A, Kainulainen V, Jalanka J, et al. The potential of gut commensals in reinforcing intestinal barrier function and alleviating inflammation. Nutrients. 2018,10(8): 988.
Mao J, Qi S, Cui Y, Dou X, Luo XM, Liu J, et al. Lactobacillus rhamnosus GG attenuates lipopolysaccharide-induced inflammation and barrier dysfunction by regulating MAPK/NF-κB signaling and modulating metabolome in the piglet intestine. J Nutr. 2020,150(5): 1313-1323.
Parapouli M, Vasileiadis A, Afendra AS, Hatziloukas E. Saccharomyces cerevisiae and its industrial applications. AIMS Microbiol. 2020,6(1): 1.
Jung EY, Hong YH, Kim JH, Park Y, Bae SH, Chang UJ, et al. Effects of yeast hydrolysate on hepatic lipid metabolism in high-fat-diet-induced obese mice: yeast hydrolysate suppresses body fat accumulation by attenuating fatty acid synthesis. Ann Nutr Metab. 2012,61(2): 89-94.
Mosser M, Chevalot I, Olmos E, Blanchard F, Kapel R, Oriol E, et al. Combination of yeast hydrolysates to improve CHO cell growth and IgG production. Cytotechnology. 2013,65(4): 629-641.
Jung EY, Lee JW, Hong YH, Chang UJ, Suh HJ. Low dose yeast hydrolysate in treatment of obesity and weight loss. Pre Nutr Food Sci. 2017,22(1): 45.
Park Y, Kim JH, Lee HS, Jung EY, Lee H, Noh DO et al. Thermal stability of yeast hydrolysate as a novel anti-obesity material. Food Chem. 2013,136(2): 316-321.
Hu J, Park JW, Kim IH. Effect of dietary supplementation with brewer's yeast hydrolysate on growth performance, faecal microbial counts, diarrhoea score, blood profile, rectal temperature in weanling pigs challenged with lipopolysaccharide. J Anim Physiol An N. 2020,104(2): 629-636.
Kim JM, Lee SW, Kim KM, Chang UJ, Song JC, Suh HJ. Anti-stress effect and functionality of yeast hydrolysate SCP-20. Eur Food Res Technol. 2003,217(2): 168-172.
Lee HS, Jung EY, Suh HJ. Chemical composition and anti-stress effects of yeast hydrolysate. J Med Food. 2009,12(6): 1281-1285.
Fu RQ, Liang C, Chen DW, Yan H, Tian G, Zheng P, et al. Effects of dietary Bacillus coagulans and yeast hydrolysate supplementation on growth performance, immune response and intestinal barrier function in weaned piglets. J Anim Physiol An N. 2021, 105(5): 898-907.
Gong Y, Yang F, Hu J, Liu C, Liu H, Han D, et al. Effects of dietary yeast hydrolysate on the growth, antioxidant response, immune response and disease resistance of largemouth bass (Micropterus salmoides). Fish Shellfish Immun. 2019,94: 548-557.
Jung EY, Lee HS, Chang UJ, Bae SH, Kwon KH, Suh HJ. Acute and subacute toxicity of yeast hydrolysate from Saccharomyces cerevisiae. Food Chem Toxicol. 2010,48(6): 1677-1681.
Zhang JY, Park JW, Kim IH. Effect of supplementation with brewer’s yeast hydrolysate on growth performance, nutrients digestibility, blood profiles and meat quality in growing to finishing pigs. Asian Austral J Anim. 2019,32(10): 1565.
Fu RQ, Chen DW, Tian G, Zheng P, Mao XB, Yu J, et al. Effect of dietary supplementation of Bacillus coagulans or yeast hydrolysates on growth performance, antioxidant activity, cytokines and intestinal microflora of growing-finishing pigs. Anim Nutr. 2019,5(4): 366-372.
Andriamialinirina HJT, Irm M, Taj S, Lou JH, Jin M, Zhou Q. The effects of dietary yeast hydrolysate on growth, hematology, antioxidant enzyme activities and non-specific immunity of juvenile Nile tilapia, Oreochromis niloticus. Fish Shellfish Immun. 2020,101: 168-175.
Latimer Junior G. Official methods of analysis of AOAC International, Gaithersburg: AOAC International, 2016.
Wang Y, Liu J, Wei F, Liu X, Yi C, Zhang Y. Improvement of the nutritional value, sensory properties and bioavailability of rapeseed meal fermented with mixed microorganisms. LWT. 2019,112: 108238.
Shi C, He J, Yu J, Yu B, Mao X, Zheng P, et al. Physicochemical properties analysis and secretome of Aspergillus niger in fermented rapeseed meal. PloS one. 2016,11(4): e0153230.
Touchette KJ, Carroll JA, Allee GL, Matteri RL, Zannelli ME, Effect of spray-dried plasma and lipopolysaccharide exposure on weaned pigs: I. Effects on the immune axis of weaned pigs. J Anim Sci. 2002,80(2): 494-501.
Liu Y, Huang J, Hou Y, Zhu H, Zhao S, Ding B, et al. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Brit J Nutr. 2008,100(3): 552-560.
Arce R, Barros S, Wacker B, Peters B, Moss K, Offenbacher S. Increased TLR4 expression in murine placentas after oral infection with periodontal pathogens. Placenta. 2009,30(2): 156-162.
Moeser AJ, Pohl CS, Rajput M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim Nutr.2017,3(4): 313-321.
Kim KW, Thomas R. Antioxidative activity of chitosans with varying molecular weights. Food Chem. 2007,101(1): 308-313.
Jung EY, Kim SY, Bae SH, Chang UJ, Choi JW, Suh HJ. Weight reduction effects of yeast hydrolysate below 10 kDa on obese young women. J Food Biochem. 2011,35(2): 337-350.
Jung EY, Cho MK, Hong YH, Kim JH, Park Y, Chang UJ, et al. Yeast hydrolysate can reduce body weight and abdominal fat accumulation in obese adults. Nutr. 2014,30(1): 25-32.
Kim JM , Kim SK, Jung EY, Bae SH, Suh HJ, Yeast hydrolysate induces longitudinal bone growth and growth hormone release in rats. Phyto Res: An Inter J Dev Phar Toxicol Eva Natur Pro Deriv. 2009,23(5): 731-736.
Molist F, van Eerden E, Parmentier H, Vuorenmaa J. Effects of inclusion of hydrolyzed yeast on the immune response and performance of piglets after weaning. Anim Feed Sci Tech. 2004,195: 136-141.
Wang T, Cheng K, Yu C, Tong Y, Yang Z, Wang T. Effects of yeast hydrolysate on growth performance, serum parameters, carcass traits, meat quality and antioxidant status of broiler chickens. J Sci Food Agr. 2021,102(2): 575-583.
Jin M, Xiong J, Zhou QC, Yuan Y, Wang XX, Sun P. Dietary yeast hydrolysate and brewer's yeast supplementation could enhance growth performance, innate immunity capacity and ammonia nitrogen stress resistance ability of Pacific white shrimp (Litopenaeus vannamei). Fish Shellfish Immun. 2018,82: 121-129.
Ciesielska A, Matyjek M, Kwiatkowska K. LR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell Mol Life Sci.2021,78(4):1233-1261.
Perez L. Acute phase protein response to viral infection and vaccination. Arch Biochem Biophys. 2019,671:196-202.
Chami R, Monteleone AM, Treasure J, Monteleone P. Stress hormones and eating disorders. Mol Cell Endocrinol. 2019,497: 110349.
Luan YY, Yao YM. The clinical significance and potential role of C-reactive protein in chronic inflammatory and neurodegenerative diseases. Front Immunol. 2018,9: 1302.
Moya SL, Boyle L, Lynch PB, Arkins S. Pro-inflammatory cytokine and acute phase protein responses to low-dose lipopolysaccharide (LPS) challenge in pigs. Anim Sci. 2006,82(4): 527-534.
Luk GD, Bayless TM, Baylin SB, Diamine oxidase (histaminase). A circulating marker for rat intestinal mucosal maturation and integrity. J Clin Invest, 1980,66(1): 66-70.
Chelakkot C, Ghim J, Ryu SH. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp Mol Med. 2018,50(8): 1-9.
Capaldo CT, Nusrat A, Cytokine regulation of tight junctions. BBA-Biomembranes. 2009,1788: 864-871.
Waititu SM, Yin F, Patterson R, Rodriguez-Lecompte JC, Nyachoti CM. Short-term effect of supplemental yeast extract without or with feed enzymes on growth performance, immune status and gut structure of weaned pigs challenged with Escherichia coli lipopolysaccharide. J Anim Sci Biotechno. 2016,7(1): 1-13.
Guo S, Al-Sadi R, Said HM, Ma TY. Lipopolysaccharide causes an increase in intestinal tight junction permeability in vitro and in vivo by inducing enterocyte membrane expression and localization of TLR-4 and CD14. Amer J Path. 2013,182(2): 375-387.
Tang J, Xu L, Zeng Y, Gong F, Effect of gut microbiota on LPS-induced acute lung injury by regulating the TLR4/NF-kB signaling pathway. Int Immunopharmacol. 2021,91:107272.

Table 1 Chemical component of yeast hydrolysate

Composition

Moisture

(%)

Crude protein

(%)

Crude fat

(%)

Crude ash

(%)

Gross energy

(cal /g)

Content

3.95

45.50

2.17

6.47

3825.00

Table 2 Composition and nutrients levels of the basal diet (air-dry basis%)

Ingredients	Content (%)	Nutrient level ³
Corn	31.42	Digestible energy, MJ/kg	14.73
Extruded corn	30.00	Crude protein %	18.50
Soybean meal	9.94	Ca %	0.75
Extruded soybean	8.00	Total P %	0.56
Fish meal	4.00	Available P %	0.37
Whey powder	5.00	Digestible Lys %	1.30
Soybean protein concentrate	5.00	Digestible Met %	0.38
Soybean oil	1.90	Digestible Thr %	0.77
Sucrose	2.00	Digestible Trp %	0.21
Limestone	0.85
Dicalcium phosphate	0.45
NaCl	0.20
L-Lys·HCl（78%）	0.33
DL-Met (99%)	0.07
L-Thr（98.5%）	0.03
L-Trp（98%）	0.01
Chloride choline	0.15
Vitamin premix ¹	0.05
Mineral premix ²	0.30
Benzoic acid	0.30
Total	100.00

¹ Vitamin premix provided the following per kg of diet: VA 9 000 IU, VD₃ 3 000 IU, VE 20.0 IU, VK₃ 3.0 mg, VB₁ 1.5 mg, VB₂ 4.0 mg, VB₆ 3.0 mg, VB₁₂ 0.02 mg, nicotinic acid 30.0 mg, pantothenic acid 15.0 mg, folic acid 0.75 mg, biotin 0.1 mg.

² Mineral premix provided the following per kg of diet: Fe (FeSO₄·H₂O) 100.0 mg, Cu (CuSO₄·5H₂O) 6.0 mg, Zn (ZnSO₄·H₂O) 100.0 mg, Mn(MnSO₄·H₂O) 4.0 mg, I（KI） 0.14 mg, Se（Na₂SeO₃) 0.3 mg.

³ Nutrients levels were calculated values.

Table 3 Primer sequences used for real-time PCR

Gene	Primer sequence (5’ –3’)	Product length(bp)	Accession number
β-actin	F: TCTGGCACCACACCTTCT	114	DQ178122
	R: TGATCTGGGTCATCTTCTCAC
ZO1	F: CAGCCCCCGTACATGGAGA	114	XM_005659811
	R: GCGCAGACGGTGTTCATAGTT
OCLN	F: CTACTCGTCCAACGGGAAAG	158	NM_001163647.2
	R: ACGCCTCCAAGTTACCACTG
ClDN-1	F: TCTTAGTTGCCACAGCATGG	106	NM001244539
	R: CCAGTGAAGAGAGCCTGACC
MUC2	F: GGTCATGCTGGAGCTGGACAGT	181	XM_003122394.1
	R: TGCCTCCTCGGGGTCGTCAC
IL-1β	F: CAGCTGCAAATCTCTCACCA	112	NM_214055.1
	R: TCTTCATCGGCTTCTCCACT
TNF-α	F: CGTGAAGCTGAAAGACAACCAG	121	NM_214022.1
	R: GATGGTGTGAGTGAGGAAAACG
	R: CAGGCTTCCGTCATCTGGTT

CLDN-1: Claudin-1; OCLN: Occludin; MUC2: Mucin2; IL-1β: interleukin-1β; TNF-α: Tumor necrosis factor-α; ZO1: Zonula occludens1.

GraphicalAbstract.png

Download PDF

Journal Publication

published 17 Mar, 2023

Read the published version in Journal of Animal Science and Biotechnology →

Editorial decision: Major revision
06 Oct, 2022
Reviewers agreed at journal
01 Sep, 2022
Reviewers invited by journal
01 Sep, 2022
Editor assigned by journal
29 Aug, 2022
First submitted to journal
27 Aug, 2022

You are reading this latest preprint version

Yeast hydrolysate attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage in weaned piglet

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Chemical analysis of yeast hydrolysate

Experimental animals, diet, and design

LPS injection

Growth performance

Blood sample collection and analysis

Intestinal samples collection and analysis

mRNA abundance analysis

Western blot analysis

Statistical analysis

Results

YH exhibits growth-promoting effect in piglets.

YH alleviates systemic inflammatory response in piglets challenged with LPS

YH attenuates LPS-induced intestinal barrier dysfunction.

YH inhibits the expression of TNF-α and IL-1β of jejunum in piglets challenged with LPS.

YH suppresses the inflammatory response in the jejunum of LPS-challenged piglets by reducing TLR4 signaling.

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Supplementary Files

Status:

Journal Publication

Version 1