The Role of Linc00467/TRAF5 in Promoting the Malignant Progression of Prostate Cancer and its Mechanism

doi:10.21203/rs.3.rs-2006387/v1

Download PDF

Research Article

The Role of Linc00467/TRAF5 in Promoting the Malignant Progression of Prostate Cancer and its Mechanism

https://doi.org/10.21203/rs.3.rs-2006387/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Prostate cancer (PCa) is a commonly occurring cancer in the prostate. However, its pathogenesis is complex and remains largely unknown. This study aims to uncover the biological role of Linc00467/TRAF5 in influencing the progression of PCa and to provide novel directions for clinical treatment of PCa.

Methods

Linc00467 and TRAF5 were screened from PIA through chip detection in our previous study. Linc00467 and TRAF5 expression was verified using RT-qPCR in PC3, DU145, and normal human prostate epithelial cell line (HPrEC). Clinical specimens were collected to measure the expression of Linc00467 and TRAF5 in normal prostate tissue, PIA tissue, and PCa tissue using RT-qPCR. To further elucidate the regulatory effects of Linc00467 on TRAF5, siLinc00467 (SH4) was transfected into PCa cell lines (PC3 and DU145), and the expression of TRAF5 was detected by Western-blot. To study the impact of Linc00467 and TRAF5 on the biological behavior of PCa cells, we transfected siLinc00467 (SH4), overexpressed TRAF5 plasmid (Ov-TRAF5), and overexpressed siLinc00467 + TRAF5 plasmid into PC3 and DU145 cells, respectively. Next, we performed specific assays (MTT assay, scarification test, Transwell, Tunel, and flow cytometry) to analyze the effects of Linc00467 and TRAF5 on proliferation, migration, invasion, and apoptosis of PCa cells (PC3 and DU145). We also utilized a tumor-bearing nude mice model to understand the effects of Linc00467 and TRAF5 on tumor growth.

Results

The experimental results demonstrate that Linc00467 is highly expressed in PCa cell lines (PC3 and DU145), while the expression of TRAF5 is low. We found a similar pattern in clinical specimens (PIA and PCa tissues) where in Linc00467 was highly expressed and TRAF5 was downregulated. Inhibiting Linc00467 can promote TRAF5 expression, significantly reducing the proliferation, migration, and invasion of PCa cells (PC3 and DU145) and promoting apoptosis. The experiment on tumor-bearing nude mice showed that Linc00467 inhibition and overexpressed TRAF5 could inhibit tumor growth.

Conclusion

Our study suggests that Linc00467 is a tumor-promoting gene in PCa, while TRAF5 is a tumor suppressor gene. Furthermore, Linc00467 has a regulatory effect on TRAF5. The tumor-promoting effect of Linc00467 may be exerted by regulating TRAF5, but its specific mechanism needs to be explored further.

LINC00467

TRAF5

Prostate cancer

long non-coding RNA

oncogene

Prostate cancer (PCa) is one of the most common malignant tumors threatening men’s health worldwide. In China, PCa incidence ranks second among male malignant tumors, with its mortality rate ranking eighth, according to a 2021 report[1]. With the prolongation of life expectancy in China, the continuous improvement of the diagnosis and treatment levels, and the westernized lifestyles and other factors, the incidence and mortality of PCa in China also show an increasing trend year by year. In addition, the disease incidence in young and middle-aged men has also been increasing in recent years[2, 3]. Therefore, the early diagnosis and treatment of PCa will remain the focus of the medical and health fields worldwide.

Proliferative inflammatory atrophy (PIA) is a special type of inflammation in PCa. De Marzo et al. proposed and defined it as epithelial hyperplasia based on focal inflammatory atrophy[4–6]. In recent years, an increasing number of scholars believe that PIA and prostate intraepithelial neoplasia (PIN) are the precancerous lesions of PCa. The main lines of evidence include: (1) In pathological PCa sections, PCa is often accompanied by the presence of PIA and PIN[7]; (2) Some critical genes associated with the malignant progression of PCa (such as GSTP1, INPP4B, PTEN, etc.) show similar expression patterns in PIA (up-regulated or down-regulated simultaneously) [8–10]; (3) Increasing clinical data and primary research data show that inflammation is closely related to the occurrence and development of tumors[11, 12].

Long non-coding RNA (LncRNA) refers to RNA that is not translated into polypeptides and has a length of more than 200 nt[13–15]. LncRNAs play a regulatory role in the differentiation, proliferation, apoptosis of PCa cells, their sensitivity to androgen, etc[16–18]. Based on the pathogenesis pattern from PIA to PCa, manual microdissection is adopted to separate pure normal prostate tissue, PIA group tissue, and PCa tissue[19]. LncRNA + mRNA Human Gene Expression Microarray chips are employed to detect the expression of lncRNA and mRNA in these three kinds of tissues. Tissue and cell samples are verified to screen out Linc00467 and TRAF5.

The involvement of Linc00467 in the genesis and development of neuroblastoma was first reported in 2014[20]. Its carcinogenic and anticancer effects on various human tumors have also been reported in recent years. Linc00467 is involved in the occurrence and development of human cancers such as cancers of the lung, liver, colon, and cervix[21–27]. The regulatory mechanism of Linc00467 for human tumor development may be different for different types of tumors. Even for the same kind of tumor, the regulatory mechanism can differ[27–29].

Tumor necrosis factor receptor-associated factors (TRAFs) are a type of intracellular adaptor proteins that can bind to intracellular and extracellular receptors to regulate downstream signal transduction in cells[30, 31]. At present, there are six known members of the TRAFs family (TRAF1-6) in mammals. Among them, TRAF5 can combine with various cell membrane and intracellular receptors to activate NF-KB, JNK, IRF3/IRF7, and other signaling pathways, thereby playing a role in inhibiting or promoting cancer[32].

In summation, in this study, under the new pathogenesis pattern of PIA developing to PCa, the chip detection method is used to screen out Linc00467 and TRAF5. Some exploratory studies are carried out to further verify the role and relevant mechanism of Linc00467 and TRAF5 in the malignant progression of PCa.

2.1 Cell culture

Human PCa cell lines (PC3 and DU145), as well as normal human prostate epithelial cell line (HPrEC), were purchased from the American ATCC Cell Bank (ATCC, www.ATCC.rog, USA). DU145 and PC3 cells were cultured in RPMI-1640 (Gibco, USA) and F12K medium (Gibco), respectively. HPrEC cells were cultured in ATCC prostate primary epithelial cell medium. 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Solarbio, China) were added to the medium, and the cells were cultured at 37°C in a humidified environment with 5% CO₂.

2.2 Clinical specimen collection

Between September 2015 and June 2020, we collected clinical tissue specimens from 55 PCa patients treated with radical prostatectomy in the Urology Department of the Second Affiliated Hospital of Nanchang University. After isolation of the specimens, the tissues were divided into tissue blocks of 2 cm and then stored in a liquid nitrogen tank till further processing. The study protocol and informed consent were approved by approved by The Second Affiliated Hospital of Nanchang University Medical Research Ethics Committee. All clinical tissue specimens were conducted in accordance with the Guide for Declaration of Helsinki and Obtain the patient's consent.

2.3 Cell transfection

Construct and synthesize siLinc00467 and overexpressed TRAF5 plasmid (KeyGEN BioTECH, NanJing, China). siLinc00467 and NC (Linc00467) sequences are given in Table 1

Table 1 siLinc00467 and NC (Linc00467) sequences

shRNA	sequences
siLinc00467(SH1)	5’-ACACTAAGTTCAGACTCAT-3’
siLinc00467(SH2)	5’-CCTGACTCATGCTACGCAA-3’
siLinc00467(SH3)	5’-GCAACATTCATGCGACTATT-3’
siLinc00467(SH4)	5’-TCAGACTCATGAAACCAAT-3’
NC(Linc00467)	5’-GAGTAATCAAATAAATGCGA-3’

Cell grouping- Control group: blank control group; Negative control group; Linc00467 inhibitor group: transfecting siLincoo467; Ov-TRAF5 group: transfecting overexpressed TRAF5 plasmid group.

Cell transfection: 24 h before transfection, cells were passaged in 6-well plates, and transfection was performed when the cells grew to about 70%-90%. The siLinc00467 and TRAF5 plasmids were transfected into PC3 and DU145 cells with Lipofectamine3000 (Thermo Fisher Scientific, Carlsbad, California, America). The specific operations were carried out according to the protocol provided with Lipofectamine3000. The cell medium was changed after 6 h, and RNA and total protein were extracted after culturing for 72 h.

2.4 RNA extraction and real-time quantitative RT-PCR (RT-qPCR) analysis

Post-treatment, the total RNA of each group was extracted, and 5 µg total RNA was reverse transcribed into cDNA using the Reverse Transcription system (Takara Bio, Inc.) according to the manufacturer’s protocol. PCR was carried out using 2 µL of cDNA product, 1 µL (10 µM) of forward and antisense primers, 12.5 µL of 2×Taq PCR Master Mix, and 8.5 µL of ddH2O (total reaction volume of 25 µL). GAPDH was taken as the internal reference.

The relative expression of Linc004”7 an’ TRAF5 was determined by the 2^−ΔΔCT method. The primer sequences were as follows

Linc00467–F:	5′- CAGCACCGATCCCGACATAGAT -3′
Linc00467–R:	5′- TCTGGCTTCCTGAAGACGATGA -3′
TRAF5–F:	5′- AACACCTGGCTGTATGTCCTGAAG -3′
TRAF5–R:	5′- ATGTGCTCCCGTAAGGCTGAATG -3′
GAPDH–F:	5′-AGATCATCAGCAATGCCTCCT-3′
GAPDH–R:	5′- TGAGTCCTTCCACGATACCAA-3′

2.5 Western-blot

Protein samples were denatured in SDS sample buffer (125 mmol/L Tris-HCl, pH 6.8, 50% glycerol, 2% SDS, 5% mercaptoethanol, 0.01% bromophenol blue) and subjected to SDS-PAGE (5% concentration and 12% separation) and blotted onto Immobilon-FL transfer membranes (EMD Millipore). The blotted membranes were blocked at 4˚C with 5% skimmed milk in Tris-buffered saline containing 0.1% Tween 20 (Beijing Solarbio Science & Technology Co., Ltd.) for 2 h. They were subsequently incubated with primary antibodies against TRAF5 (1:500, cat. No. 41658, Cell Signaling Technology, Inc.) overnight at 4˚C. After three washes in Tris-buffered saline containing 0.1% Tween 20, the PVDF membranes were incubated with anti-mouse IgG (dilution 1:5,000, cat. No. SW1030, Beijing Solarbio Science & Technology Co., Ltd.) for 2 h at 25˚C. Next, the PVDF membranes were soaked in chemiluminescence reagents (cat. No. SW2030, Beijing Solarbio Science & Technology Co., Ltd.). Quantification of the western blotting was performed using a Bio-Rad imaging system (ChemiDoc MP v721BR06186, Bio-Rad Laboratories, Inc.).

2.6 Transwell assay

The Transwell invasion chamber was used to detect changes in invasive ability. The Matrigel-free Transwell chamber was prepared according to the instructions. The above cells (~1×10⁵ cells) and 100 μL 0.2% BSA serum-free culture medium were added to the upper chamber, and 500 μL FBS-containing culture medium was added to the lower chamber. These cells were incubated at 37℃. After 8 hours, the filter membrane was taken out and fixed with 4% paraformaldehyde. The non-adherent cells on the filter membrane were wiped off with a cotton swab, and cells that penetrated to the back of the filter membrane were counted after staining.

2.7 MTT assay

The cells in the logarithmic growth phase of each group were taken and inoculated onto a 96-well plate with ~5000 cells/well. For each group, 5 duplicate wells and corresponding zero-setting wells were arranged. During the time periods of 6 h, 12 h, 24 h, 48 h, and 72 h, 20 μL of MTT solution was added to each well, and after 4 h of incubation, 150 μL of DMSO was added. An enzyme-linked immunosorbent assay meter measured the absorbance value for each well at 490 nm. Cell inhibition rate= (1-absorbance value of experimental group/absorbance value of control group)×100%.

2.8 Scarification test

Cells at a density of about 2.5×10⁵ cells/well were inoculated onto a 24-well plate and then cultured for 12 h. After the above processing in each group, a “cross” scratch was made with a yellow pipette tip. The scratch was photographed under an inverted microscope, and the scratch width at this time point was measured (denoted as Wbefore). After they were cultured in the incubator for 24 h, the scratch width was measured again (denoted as Wafter), and the migration distance was calculated (migration distance= Wbefore-Wafter).

2.9 Flow cytometry

7.5×10⁵ cells/well were inoculated onto a 6-well plate, and after grouping, they were prepared into cell suspensions (~1-5×10⁵ cells). 500 µL of Binding Buffer was used to suspend the cells, followed by 5 µL of Annexin V-APC. After mixing, 5 μL of 7-AAD was added with gently mixing. The reaction was conducted at room temperature in the dark for 5-15 minutes (min). Cell apoptosis was detected within 1 h on the equipment (Facscallbar flow cytometry, Becton Dickinson, USA).

2.10 Tunel experiment

7.5×10⁵ cells/well were inoculated onto a 6-well plate. After grouping, the cells were collected, and the cell samples (cell smears or round coverslips) were naturally air-dried. They were immersed in 4% paraformaldehyde fixative for 30 min or overnight to improve cell permeability. This was followed by PBS soaks for 3 min×3. 1% Triton-100 was added to the samples, and they were kept at room temperature for 15 min. Next, they were soaked in PBS for 5 min and washed 3 times. The samples were then treated with 3% H₂O₂-methanol solution for 15 min, soaked in PBS for 5 min, and washed 3 times. 100 µL TdT enzyme reaction solution was added dropwise into each sample, kept in the dark and moistened, and reacted at 37℃ for 1 h, followed by soaking in PBS for 5 min and washing 3 times. 100 µL Streptavadin-FITC was added dropwise, kept in the dark and moistened, and reacted at 37 ℃ for 30 min. Then it was soaked in PBS for 5 min and washed 3 times. The sections were put in Hoechst staining solution to stain for 10 min and rinsed with distilled water. After sealing, the sections were observed under a fluorescence microscope.

2.11 In vivo tumor-bearing experiment

12 BALB/c nude mice (13-15 g weight and 4-6-week age), with 6 males and 6 females, were selected and randomly divided into 2 groups (N=6). 5×10⁷ Pca cells were taken and suspended in 200 μL PBS and then injected subcutaneously in the groin of BALB/c nude mice in each group. The tumor diameter was measured every 3 days. Once the tumor diameter reached 0.5 cm, the tumor was injected with ①siLinc00467+ lip3000; ②overexpressed TRAF5 plasmid + lip3000; ③siLinc00467 and overexpressed TRAF5 plasmid + lip3000; ④ Equal volume of PBS, 2 times/week, continuously for 4 weeks. The tumor volume was measured continuously for 8 weeks (tumor volume = (length × width²) × 0.5). After 8 weeks, the mice were euthanized by cervical dislocation under 40 mg/kg pentobarbital anesthesia. and the tumors were taken out and weighed. All animal studies were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of China. All experiments involving animal were reviewed and approved by The Nanchang University Ethics Committee of Medical Laboratory Animals.

2.12 Statistical analysis

SPSS 21.0 statistical software was used to analyze the obtained data, and measurement data were expressed as mean±standard deviation (M±SD). The results of multiple groups were compared using the one-way analysis of variance to test and analyze the mean values among groups. If P <0.05, the result is considered to be statistically significant.

3.1 Linc00467 is highly expressed in cancer cells and Pca tissues, while TRAF5 is underexpressed.

Through RT-qPCR analysis, it was found that the expression of Linc00467 was significantly higher in Pca cell lines (PC3 and DU145) than in normal prostate cells (HprEC) (Fig. 1A, P < 0.05). Contrastingly, the expression of TRAF5 was significantly lower in Pca cell lines (PC3 and DU145) than in normal prostate cells (HprEC) (Fig. 1A, P < 0.05). Using clinical Pca surgical specimens and RT-qPCR detection, it was observed that with the malignant progression degree of Pca increasing, Linc00467 expression showed a rising trend (Fig. 1B). In contrast, TRAF5 showed a declining tendency (Fig. 1C).

3.2. Transfecting SiLinc00467 (SH4) can inhibit the expression of Linc00467, while transfecting overexpressed TRAF5 plasmid can promote the overexpression of TRAF5.

After transfecting siRNA (SiLinc00467 including SH1, SH2, SH3, SH4, and NCSilinc00467) into the PC3 cell line, the RT-qPCR analysis demonstrated that transfecting SiLinc00467 (SH4) could inhibit the expression of Linc00467 (Fig. 2C). After transfecting overexpressed TRAF5 plasmid into PC3 and DU145 cell lines, Western-blot analysis showed that the expression of TRAF5 in the transfection group was significantly higher than in the control groups (Fig. 2A, B, P < 0.05).

3.3 Inhibition Of Linc00467 Promoted The Expression Of Traf5

To determine whether Linc00467 has a regulatory effect on TRAF5, western-blot and RT-qPCR were employed to detect the expression of TRAF5 after the inhibition of Linc00467 expression. Western-blot showed that Linc00467 downregulation significantly promoted TRAF5 protein expression (Fig. 2D, E, P < 0.05). Similarly, RT-qPCR results exhibited that Linc00467 inhibition significantly increased TRAF5 mRNA levels (Fig. 2F, P < 0.05).

3.4 Linc00467 inhibition or TRAF5 overexpression alone or simultaneously can inhibit the proliferation of Pca cells

MTT results indicated that the cell inhibition rate of PC3 cell line showed no significant change among the groups at 6 h and 12 h, which was increased gradually at 24 h, 48 h, and 72 h. The cell inhibition rate in the group with inhibited Linc00467 expression and simultaneously overexpressed TRAF5 was significantly higher than in the other groups (Fig. 3E, P < 0.05). Furthermore, the cell inhibition rate at 72 h was higher than at 6 h, 12 h, 24 h, and 48 h. The cell inhibition rate at 72 h in the overexpressed TRAF5 group was significantly higher than that in the group with inhibited Linc00467 expression (Fig. 3E, P < 0.05). For the DU145 cell line, the cell inhibition rate did not change significantly among the groups at 6 h, 12 h, and 24 h, but it gradually increased at 48 h and 72 h. Besides, the cell inhibition rate in the Linc00467 inhibition with simultaneous TRAF5 overexpression group was significantly higher than those in the other groups (Fig. 3F, P < 0.05). The cell inhibition rate of the group at 72 h was higher than that of the groups at 6 h, 12 h, 24 h, and 48 h, while that of the TRAF5 overexpression group at 48h and 72 h was significantly higher than that of the downregulated Linc00467 expression group (Fig. 3F, P < 0.05).

3.5 Inhibition of Linc00467 expression together with overexpression of TRAF5 can inhibit the cell migration of Pca cell lines PC3 and DU145

Scarification test indicated that TRAF5 overexpression significantly inhibits the cell migration in Pca cell lines PC3 and DU145 (Figs. 4A/A1, B/B1, P < 0.05). Similarly, Linc00467 inhibition with TRAFT5 overexpression significantly inhibited the cell migration in Pca cells (Figs. 4A/A1, B/B1, P < 0.05).

3.6 Downregulated Linc00467, along with overexpression of TRAF5, can inhibit the invasion ability of Pca cell lines PC3 and DU145

The results of the Transwell assay suggested that downregulated Linc00467 expression or overexpressing TRAF5, as well as downregulated Linc00467 and simultaneously overexpressing TRAF5, could significantly reduce the invasion ability of Pca cell lines PC3 and DU145 (Figs. 4C/C1, D/D1, P < 0.05). Compared with downregulated Linc00467 expression group and overexpressing TRAF5 group, the invasion ability of the Pca cell lines PC3 and DU145 was significantly reduced in the downregulated Linc00467 expression and simultaneously overexpressing TRAF5 group (Figs. 4C/C1, D/D1, P < 0.05). Whereas, compared with the Linc00467 overexpression group, the invasion ability of the Linc00467 inhibition group showed no significant change (Figs. 4C/C1, D/D1, P > 0.05).

3.7 Downregulated Linc00467 expression, together with overexpressing TRAF5, can promote the apoptosis of Pca cell lines PC3 and DU145

Tunel experiment demonstrated that downregulated Linc00467 expression or overexpressing TRAF5, as well as downregulated Linc00467 expression and simultaneously overexpressing TRAF5, could significantly promote the apoptosis of Pca cell lines PC3 and DU145 (Figs. 3C/C1, D/D1, P < 0.05). Compared with the Linc00467 inhibition group and TRAF5 overexpression group, the number of apoptotic cells increased significantly in the Linc00467 inhibition with simultaneous TRAF5 overexpression group (Figs. 3C/C1, D/D1, P < 0.05). However, the number of apoptotic cells did not change significantly in the Linc00467 inhibition group compared to the TRAF5 overexpression group (Figs. 3C/C1, D/D1, P > 0.05).

Flow cytometry results showed that downregulated Linc00467 or overexpressing TRAF5, as well as downregulated Linc00467 and simultaneously overexpressing TRAF5, could promote apoptosis in Pca cell lines PC3 and DU145 (Figs. 3A/A1, B/B1, P < 0.05). Compared with the Linc00467 inhibition group and TRAF5 overexpression group, the apoptosis rates in the early and late-stage were significantly increased in the Linc00467 inhibition group with simultaneous TRAF5 overexpression (Figs. 3A/A1, B/B1, P < 0.05). However, compared with the TRAF5 overexpression group, the apoptosis rates in the early and late-stage showed no significant change in the Linc00467 inhibition group (Figs. 3A/A1, B/B1, P > 0.05).

3.8 Downregulated Linc00467 expression together with overexpressing TRAF5 can inhibit tumor growth in a mice tumor-bearing model

Animal experiment results illustrated that downregulated Linc00467 or overexpressing TRAF5, as well as downregulated Linc00467 and simultaneously overexpressing TRAF5, could inhibit the growth of tumors borne by mice (Fig. 5, P < 0.05). Compared with the downregulated Linc00467 group and overexpressing TRAF5 group, a significant inhibitory effect on tumor growth in tumor-bearing mice was observed in the group of Linc00467 inhibition with simultaneous TRAF5 overexpression (Fig. 5, P < 0.05). Compared with the TRAF5 overexpression group, there was no significant change in tumor growth inhibition in the Linc00467 inhibition group (Fig. 5, P > 0.05).

Like other human tumors, the pathogenesis for Pca remains unclear. In this study, we started from the perspective of the development model of PIA to Pca to explore the driver oncogene(s) for Pca. Unfortunately, pure PIA cells could not be isolated for culture, and PIA cell lines cannot be purchased. Therefore, in our previous study, we isolated PIA tissue by hand-made microdissection and successfully extracted RNA that could be used in chip detection[33]. We selected chip detection to analyze lncRNA and mRNA. In data analysis and screening, we mainly focused on the literature on the relationship between mRNA and tumors and inflammation. Finally, we selected Linc00467 and TRAF5 for verification.

The Linc00467/miRNA/mRNA signaling axis is a crucial candidate in the current research on the mechanisms for Linc00467 regulating the occurrence and development of human tumors. As indicated by studies on liver cancer cells, Linc00467 could inhibit the expression of miR-9-5p/miR-18a-5p, thereby relieving their inhibitory effect on PPARA/NEDD9 through “sponge adsorption” and promoting cancer[27, 28]. According to certain lung cancer studies, Linc00467 could target miR-4779 and miR-7978 to promote lung cancer cell proliferation, invasion, and metastasis[26]. Linc00467 could also adsorb miR-20b-5p to relieve the inhibitory effect of miR-20b-5p on CCND1 to promote the growth of lung adenocarcinoma cells[25]. Additionally, it could bind miR-125a-3p to relieve the inhibitory effect of miR-125a-3p on SIRT6, thereby reducing the resistance of non-small cell lung cancer to cisplatin[29]. In cervical cancer, Linc00467 targets miR-107 to increase the expression of KIF23 to exert its cancer-promoting effect[23]. Similarly, in colorectal cancer, nervous system tumors, and head and neck squamous cell carcinoma, Linc00467 promotes cancer by acting on miRNAs[34–36]. A Pca study showed that Linc00467 promotes prostate cancer progression via M2 macrophage polarization and the miR-494-3p/STAT3 axis[37], But our experiments reveals that Linc00467 has a regulatory effect on TRAF5 and the tumor-promoting effect of Linc00467 may be exerted by regulating TRAF5 .

Based on these findings, we attempted to determine whether some miRNAs could act on TRAF5 in PCa. In preliminary experiments, we found that Linc00467 could act on miR-18a-5p, but miR-18a-5p and TRAF5 had no sequence match in mRNA. Thus, we abandoned the regulation mechanism of the Linc00467/miR-18a-5p/TRAF5 signaling axis. Certainly, the Linc00467/miRNA/TRAF5 signal axis may objectively exist that regulates the occurrence and development of PCa. However, due to time limitations and other factors, we did not continue to improve this work. In follow-up experiments, we will investigate miRNAs in the Linc00467/miRNA/TRAF5 signal regulation axis in PCa.

In addition to the classic Linc00367/miRNA/mRNA signal regulation axis, Linc00467 also has other regulatory mechanisms that affect the occurrence and development of human tumors. For example, Linc00467 can promote the metastasis of germ cell tumors by promoting the phosphorylation of AKT3 and AKT. The low expression of Linc0067 in germ cell tumors can increase the efficacy of PD1 immunotherapy[38]. Linc00467 can also recruit EZH2 to bind to the promoter of HTRA3 and inhibit the expression of HTRA3, thereby exerting its pro-tumorigenic effect[22]. In addition to regulating tumors, Linc00467 can target LRGUK and TDRD6 to regulate spermatogenesis[39].

In PCa, whether Linc0046 regulates the promoter of TRAF5 or Linc00467 directly regulates TRAF5 mRNA has not yet been reported. In liver cancer cells, it was found that Linc00467 could bind to the messenger RNA-binding protein 3 (IGF2BP3) of insulin-like growth factor 2 to increase the stability of TRAF5 mRNA, thereby affecting the occurrence and development of liver cancer[40]. By predicting the target gene of Linc00467-RNA through the https://starbase.sysu.edu.cn/ database, we found: that Linc00467 could indeed target TRAF5. Linc00467 was highly expressed, while TRAF5 was lowly expressed in PCa. Inhibiting the expression of Linc00467 could promote the expression of TRAF5 mRNA. Based on this, we speculated that Linc00467, which is highly expressed in PCa, could form base-pairing with TRAF5 mRNA, leading to the degradation of TRAF5 mRNA and inhibiting its expression. We will confirm this hypothesis with Dual-Luciferase Reporter Assay in follow-up experiments.

In conclusion, Linc00467 has diverse functions in regulating the occurrence and development of human tumors. In PCa, a classic LncRNA regulatory mechanism, Linc00467/miRNA/mRNA, has been found. However, it remains to be clarified how Linc00467 affects TRAF5. The most probable mechanism is that Linc00467 directly acts on the TRAF5 mRNA to restrict the translation of TRAF5 protein. This can affect the biological behavior and the malignant progression of PCa. Whether the Linc00467/miRNA/TRAF5 signal axis regulates the malignant progression of PCa remains to be supported by further experimental data. Of course, other regulatory mechanisms may exist as well. Future studies will focus on expanding our understanding of these mechanisms.

Ethics approval and consent to participate

The experimental protocol was established, according to the ethical guidelines of the Helsinki Declaration and was approved by the Human Ethics Committee of The Second Affiliated Hospital of Nanchang University Medical Research. The animal studies is reported in accordance with ARRIVE guidelines，all animal studies were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of China and was approved by Nanchang University Ethics Committee of Medical Laboratory Animals. Written informed consent was obtained from individual or guardian participants.

Consent for publication

Not applicable

Availability of data and materials

The datasets used or analysed during the current study are available from the corresponding author on reasonable request.(exce pt agarose gel with Mark of western-blot).

Competing interests

The authors declare that they have no conpeting interest in this work.

Funding

Jiangxi Youth Science Fundation (20161BAB215250); Youth Fundation of Second Affiliated Hospital of Nanchang University (2016YNQN12029); Jiangxi Provincial Health Fund for Traditional Chinese Medicine (2019A027); Jiangxi Health and Family Planning Commission Fundation (202130387); National Natural Science Foundation of P.R. China (81860455), The Natural Science Foundation of Jiangxi (2019ACB20010)

Authors' contributions

(I) Conception and design: Yibing Wang, Xiali Zhang，Luo jun

(II) Administrative support: Lidong Wu, Tao Zeng

(III) Provision of study materials: Bin Fu,Yibing Wang

(IV) Collection and assembly of data: Yibing Wang,Gongxian Wang, Zhiqiang Luo

(V) Data analysis and interpretation: Yibing Wang

(VI) Manuscript writing: All authors

(VII) Final approval of manuscript: All authors.

Acknowledgments

My deepest gratitude goes first and foremost to Professor Bin Fu, my supervisor,for his constant encouragement and guidance.He has walked me through all the stages of the writing of this thesis. Without his consistent and illuminating instruction,this thesis could not have reached its present form.

Last my thanks would go to my beloved family for their loving considerations and great confidence inme all through these years.I also owe my sincere gratitude to my friends and my fellow classmates who gave me their help and time in listening to me and helping me work out my problems during the difficult course of the thesis.

Cao W, Chen HD, Yu YW, Li N, Chen WQ. Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. Chin Med J (Engl). 2021;134(7):783–91.
Hu Y, Zhao Q, Rao J, Deng H, Yuan H, Xu B. Longitudinal trends in prostate cancer incidence, mortality, and survival of patients from two Shanghai city districts: a retrospective population-based cohort study, 2000–2009. BMC Public Health. 2014;14:356.
Qi D, Wu C, Liu F, Gu K, Shi Z, Lin X, Tao S, Xu W, Brendler CB, Zheng Y, et al. Trends of prostate cancer incidence and mortality in Shanghai, China from 1973 to 2009. Prostate. 2015;75(14):1662–8.
De Marzo AM, Platz EA, Sutcliffe S, Xu J, Grönberg H, Drake CG, Nakai Y, Isaacs WB, Nelson WG. Inflammation in prostate carcinogenesis. Nat Rev Cancer. 2007;7(4):256–69.
Puhr M, De Marzo A, Isaacs W, Lucia MS, Sfanos K, Yegnasubramanian S, Culig Z. Inflammation, Microbiota, and Prostate Cancer. Eur Urol Focus. 2016;2(4):374–82.
De Marzo AM, Marchi VL, Epstein JI, Nelson WG. Proliferative inflammatory atrophy of the prostate: implications for prostatic carcinogenesis. Am J Pathol. 1999;155(6):1985–92.
Wang W, Bergh A, Damber J-E: Increased p53 immunoreactivity in proliferative inflammatory atrophy of prostate is related to focal acute inflammation. APMIS: acta pathologica, microbiologica, et immunologica Scandinavica 2009, 117(3):185–195.
Rynkiewicz NK, Fedele CG, Chiam K, Gupta R, Kench JG, Ooms LM, McLean CA, Giles GG, Horvath LG, Mitchell CA. INPP4B is highly expressed in prostate intermediate cells and its loss of expression in prostate carcinoma predicts for recurrence and poor long term survival. Prostate. 2015;75(1):92–102.
De Nunzio C, Kramer G, Marberger M, Montironi R, Nelson W, Schröder F, Sciarra A, Tubaro A. The controversial relationship between benign prostatic hyperplasia and prostate cancer: the role of inflammation. Eur Urol. 2011;60(1):106–17.
Rivera-Calderón LG, Fonseca-Alves CE, Kobayashi PE, Carvalho M, Drigo SA, de Oliveira Vasconcelos R, Laufer-Amorim R. Alterations in PTEN, MDM2, TP53 and AR protein and gene expression are associated with canine prostate carcinogenesis. Res Vet Sci. 2016;106:56–61.
Hugo HJ, Saunders C, Ramsay RG, Thompson EW. New Insights on COX-2 in Chronic Inflammation Driving Breast Cancer Growth and Metastasis. J Mammary Gland Biol Neoplasia 2015.
Taverna G, Pedretti E, Di Caro G, Borroni EM, Marchesi F, Grizzi F. Inflammation and prostate cancer: friends or foe? Inflamm Res. 2015;64(5):275–86.
Kopp F, Mendell JT. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell. 2018;172(3):393–407.
Beermann J, Piccoli MT, Viereck J, Thum T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. Physiol Rev. 2016;96(4):1297–325.
Schmitt AM, Chang HY. Long Noncoding RNAs in Cancer Pathways. Cancer Cell. 2016;29(4):452–63.
Choi ST, Song JS. Serum Procalcitonin as a Useful Serologic Marker for Differential Diagnosis between Acute Gouty Attack and Bacterial Infection. Yonsei Med J, 57(5):1139–1144.
Luo G, Wang M, Wu X, Tao D, Xiao X, Wang L, Min F, Zeng F, Jiang G. Long Non-Coding RNA MEG3 Inhibits Cell Proliferation and Induces Apoptosis in Prostate Cancer. Cell Physiol biochemistry: Int J experimental Cell Physiol Biochem Pharmacol. 2015;37(6):2209–20.
Hildebrand JM, Yi Z, Buchta CM, Poovassery J, Stunz LL, Bishop GA. Roles of tumor necrosis factor receptor associated factor 3 (TRAF3) and TRAF5 in immune cell functions. Immunol Rev. 2011;244(1):55–74.
Wang Y, Hao C, Fu B, Liu W, Zhou X, Zeng T, Guo J, Wang G. A novel method to identify and isolate proliferative inflammatory atrophy (PIA) clusters and to extract high-quality PIA RNA. Int J Clin Exp Pathol. 2015;8(4):3987–93.
Atmadibrata B, Liu PY, Sokolowski N, Zhang L, Wong M, Tee AE, Marshall GM, Liu T. The novel long noncoding RNA linc00467 promotes cell survival but is down-regulated by N-Myc. PLoS ONE. 2014;9(2):e88112.
Yang J, Liu Y, Mai X, Lu S, Jin L, Tai X. STAT1-induced upregulation of LINC00467 promotes the proliferation migration of lung adenocarcinoma cells by epigenetically silencing DKK1 to activate Wnt/β-catenin signaling pathway. Biochem Biophys Res Commun. 2019;514(1):118–26.
Wang X, Liu H, Shen K, Pan X, Wei Y, Lv T, Song Y. Long intergenic non–coding RNA 00467 promotes lung adenocarcinoma proliferation, migration and invasion by binding with EZH2 and repressing HTRA3 expression. Mol Med Rep. 2019;20(1):640–54.
Li GC, Xin L, Wang YS, Chen Y. Long Intervening Noncoding 00467 RNA Contributes to Tumorigenesis by Acting as a Competing Endogenous RNA against miR-107 in Cervical Cancer Cells. Am J Pathol. 2019;189(11):2293–310.
He X, Li S, Yu B, Kuang G, Wu Y, Zhang M, He Y, Ou C, Cao P. Up-regulation of LINC00467 promotes the tumourigenesis in colorectal cancer. J Cancer. 2019;10(25):6405–13.
Ding H, Luo Y, Hu K, Liu P, Xiong M. Linc00467 promotes lung adenocarcinoma proliferation via sponging miR-20b-5p to activate CCND1 expression. Onco Targets Ther. 2019;12:6733–43.
Chang Y, Yang L. LINC00467 promotes cell proliferation and stemness in lung adenocarcinoma by sponging miR-4779 and miR-7978. J Cell Biochem 2019.
Cai K, Li T, Guo L, Guo H, Zhu W, Yan L, Li F. Long non-coding RNA LINC00467 regulates hepatocellular carcinoma progression by modulating miR-9-5p/PPARA expression. Open Biol. 2019;9(9):190074.
Zheng Y, Nie P, Xu S. Long noncoding RNA linc00467 plays an oncogenic role in hepatocellular carcinoma by regulating the miR-18a-5p/NEDD9 axis. J Cell Biochem. 2020;121(5–6):3135–44.
Xue F, Yang C, Yun K, Jiang C, Cai R, Liang M, Wang Q, Bian W, Zhou H, Liu Z, et al: Reduced LINC00467 elevates microRNA-125a-3p to suppress cisplatin resistance in non-small cell lung cancer through inhibiting sirtuin 6 and inactivating the ERK1/2 signaling pathway. Cell Biol Toxicol 2021.
Ely KR, Kodandapani R, Wu S. Protein-protein interactions in TRAF3. Adv Exp Med Biol. 2007;597:114–21.
Lee NK, Lee SY. Modulation of life and death by the tumor necrosis factor receptor-associated factors (TRAFs). J Biochem Mol Biol. 2002;35(1):61–6.
Tang X, Zhang L, Wei W. Roles of TRAFs in NF-kappaB signaling pathways mediated by BAFF. Immunol Lett. 2018;196:113–8.
Wang Y, Hao C, Fu B, Liu W, Zhou X, Zeng T, Guo J, Wang G. A novel method to identify and isolate proliferative inflammatory atrophy (PIA) clusters and to extract high-quality PIA RNA. Int J Clin Exp Pathol. 2015;8(4):3987–93.
Li Z, Liu J, Chen H, Zhang Y, Shi H, Huang L, Tao J, Shen R, Wang T. Ferritin Light Chain (FTL) competes with long noncoding RNA Linc00467 for miR-133b binding site to regulate chemoresistance and metastasis of colorectal cancer. Carcinogenesis 2019.
Liang R, Tang Y. LINC00467 knockdown repressed cell proliferation but stimulated cell apoptosis in glioblastoma via miR-339-3p/IP6K2 axis. Cancer Biomark 2020.
Chen Y, Ding Y. LINC00467 enhances head and neck squamous cell carcinoma progression and the epithelial-mesenchymal transition process via miR-299-5p/ubiquitin specific protease-48 axis. J Gene Med. 2020;22(7):e3184.
Jiang H, Deng W, Zhu K, Zeng Z, Hu B, Zhou Z, Xie A, Zhang C, Fu B, Zhou X, et al. LINC00467 Promotes Prostate Cancer Progression via M2 Macrophage Polarization and the miR-494-3p/STAT3 Axis. Front Oncol. 2021;11:661431.
Bo H, Zhu F, Liu Z, Deng Q, Liu G, Li R, Zhu W, Tan Y, Liu G, Fan J, et al. Integrated analysis of high-throughput sequencing data reveals the key role of LINC00467 in the invasion and metastasis of testicular germ cell tumors. Cell Death Discov. 2021;7(1):206.
Bo H, Liu Z, Zhu F, Zhou D, Tan Y, Zhu W, Fan L: Long noncoding RNAs expression profile and long noncoding RNA-mediated competing endogenous RNA network in nonobstructive azoospermia patients. Epigenomics 2020.
Jiang W, Cheng X, Wang T, Song X, Zheng Y, Wang L. LINC00467 promotes cell proliferation and metastasis by binding with IGF2BP3 to enhance the mRNA stability of TRAF5 in hepatocellular carcinoma. J Gene Med. 2020;22(3):e3134.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The Role of Linc00467/TRAF5 in Promoting the Malignant Progression of Prostate Cancer and its Mechanism

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1