Nicotine exacerbates diabetic nephropathy through upregulation of Grem1 expression

doi:10.21203/rs.3.rs-2007804/v1

Download PDF

Research Article

Nicotine exacerbates diabetic nephropathy through upregulation of Grem1 expression

https://doi.org/10.21203/rs.3.rs-2007804/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 06 Jul, 2023

Read the published version in Molecular Medicine →

You are reading this latest preprint version

Background

Diabetic nephropathy (DN) is a major complication of diabetes mellitus. The tobacco epidemic exacerbates kidney damage in patients with DN. Clinical reports indicate that smoking is a significant risk factor for chronic kidney disease, including DN; however, the underlying molecular mechanisms remain unclear.

Method

In the present study, we used a diabetic mouse model to investigate the molecular mechanisms for nicotine-exacerbated DN. Twelve-week-old female mice were injected with streptozotocin (STZ) to establish a hyperglycemic diabetic model. After four months, the control and hyperglycemic diabetic mice were further divided into four groups (control, Nicotine, diabetic, Nicotine + diabetic) by intraperitoneal injection of Nicotine or PBS. After another two months, urine and blood were collected for kidney injury assay, and renal tissues were harvested for further molecular assays using RNA-seq analysis, real-time PCR, Western blot, and immunohistochemistry. In in vitro studies, we used siRNA to suppress Grem1 expression in human podocytes and then treated them with Nicotine and high glucose to compare podocyte injury.

Result

Nicotine administration alone did not cause apparent kidney injury, but it significantly increased hyperglycemia-induced albuminuria, BUN, and the expression of KIM-1 and NGAL. Results from RNA-seq analysis, real-time PCR, and western blot analysis revealed that, compared to hyperglycemia or Nicotine alone, the combination of nicotine treatment and hyperglycemia significantly increased the expression of Grem1 and activated the TGF-β pathway. In vitro experiments, suppression of Grem1 expression attenuated nicotine-exacerbated podocyte injury.

Conclusion

Grem1 plays a vital role in the nicotine-exacerbated DN. Grem1 may be a potential therapeutic target for chronic smokers with DN.

Grem1

Nicotine

Diabetic nephropathy

TGF-beta

Therapeutic target

Diabetes mellitus is a global epidemic, showing an increasing trend yearly, seriously threatening human health. An estimated 463 million people worldwide had type 2 diabetes in 2019, according to the International Diabetes Federation. This number is expected to rise to 700 million by 2045(Saeedi, et al. 2019). A nationally representative survey of over 75,000 adults published in 2020 showed that the prevalence of diabetes in China was 11.2%(Li, et al. 2020). Diabetic nephropathy (DN) is a common microvascular complication of diabetes (20–40%)(Warren, et al. 2019) and manifests in the form of progressive proteinuria, decreased glomerular filtration rate (GFR), and glomerular hypertension with higher cardiovascular morbidity and mortality(Zhang, et al. 2016; Ma, et al. 2019). The etiology and molecular mechanisms of DN are unclear, making it difficult to prevent and treat. An increasing prevalence of diabetes and associated high morbidity and mortality have led to the current management of diabetic kidney patients poses an enormous socioeconomic burden on society(Saeedi, et al. 2019). Henceforth, there is an urgent need to improve the mechanistic understanding of DN and to develop new and practical therapeutic approaches to prevent or delay the progression of DN.

The tobacco epidemic is also a significant public health problem. For example, China is the world's largest tobacco producer and consumer ( The Writing Committee of 2020 Report on Health Hazards of Smoking in China. 2021) and inhabits more than 300 million smokers; there are more than 1 million deaths yearly result from smoking-related diseases, including more than 100,000 deaths from secondhand smoke exposure(Wang, et al. 2018). Tobacco epidemic continues to be a major public problem in majority of the developing countries and associated with high morbidity and mortality.

Smoking has been reported to be an important risk factor for diabetes, and smokers have twice the risk of developing diabetes as non-smokers (Mardarowicz, et al. 2010). Animal experiments have also confirmed that cigarette smoking aggravates diabetic kidney injury in rats and mice (Jiang, et al. 2019; Jaimes, et al. 2021). Recent studies demonstrate that Nicotine, one of the highly active compounds in cigarette smoke, contributes to the pathogenesis of smoking-mediated kidney dysfunction (Hukkanen, et al. 2005; Rezonzew, et al. 2012). Nicotine mediates its effects via activating muscle and neuronal nicotinic acetylcholine receptors (nAChRs) (Albuquerque, et al. 2009). Studies from our group and others have confirmed that the nAChRs are expressed in non-neuronal cells, including kidney cells (such as podocytes, tubular epithelial cells, and mesangial cells), endothelial cells, and vascular smooth muscle cells. We found that Nicotine promoted podocyte apoptosis through activating MAPK kinases and enhancing oxidative stress (Lan, et al. 2016). It is reported that short-term stimulation of tubular epithelial cells with a high dose of Nicotine (200–400 µM) causes apoptosis or epithelial-mesenchymal transition (EMT) through enhanced ROS generation (Arany, et al. 2012; Kim, et al. 2016); while long-term stimulation with a low dose of Nicotine (1–10 µM) increases proliferation through activation of AKT(Chang and Singh 2018). For mesangial cells, nicotine stimulation activates the TGF-β or Wnt/β-catenin pathway, which promotes the cell proliferation and production of extracellular matrix proteins (Jaimes, et al. 2007; Jaimes, et al. 2009; Hua, et al. 2010; Lan, et al. 2018). These studies show that nicotine stimulation causes injuries to kidney cells, leading to renal dysfunction. However, it is still unclear whether Nicotine plays a vital role in promoting DN, and the molecular mechanism of Nicotine in promoting DN is still unclear.

As a high-throughput sequencing technology developed rapidly in recent years, RNA sequencing (RNA-seq) technology has been widely used to study gene functions. It has been a powerful method for studying the molecular mechanism of specific biological processes and diseases(Lv, et al. 2020). Using RNA-seq, many critical genes related to the pathogenesis of kidney disease have been identified(Yu, et al. 2020; Hassanzadeh and Wang 2021; Kilari, et al. 2021; Tang, et al. 2021; Zheng, et al. 2021).

In this study, we performed RNA-seq to analyze the gene expression changes in mouse kidneys caused by nicotine-exacerbated DN. We identified Grem1 as a vital gene promoting kidney damage in response to Nicotine in the diabetic milieu. We also examined the expression and role of Grem1 and its downstream genes belonging to the TGF-β pathway in nicotine-exacerbated DN.

Animals and treatments

Unless otherwise mentioned, all animal administrations and treatments were performed following our previous publication(Wen, et al. 2019; Lan, et al. 2020). To generate Streptozotocin (STZ)-induced diabetic mouse model, 12-week-old female mice (20–25 g) on FVB/N background were fasted but given water freely for 18 h and then were injected intraperitoneally with streptozotocin (Sigma-Aldrich, St. Louis, MO, USA), freshly dissolved in sterile PBS at a dose of 100 mg/kg body weight for three consecutive days. Normal control mice received sterile PBS only in the same manner. Four days after the last injection, the blood glucose levels of the mice were measured. Mice with glucose levels above 200 mg/dl were considered successful hyperglycemic diabetic models (diabetic mellitus, DM) and used for further experiments. After four months, the control group and diabetic mice were further divided into two other groups, as follows: 1) Control (Con) group; 2) Nicotine (Nic) group; 3) diabetic mellitus (DM) group; 4) Nic + DM (N + D) group. Mice in the Nic and Nic + DM groups were administered an intraperitoneal injection of nicotine (1 mg/kg, every other day). In contrast, mice in the Con and DM groups were parallelly administrated with PBS. After another two months, urine and blood samples were collected, and the mice were sacrificed with CO₂. Blood was expelled from circulating vessels by perfusion with PBS, and kidney samples were collected.

Albuminuria was assessed using a mouse albumin ELISA kit (Bethyl Lab, Hamburg, Germany). Blood urea nitrogen (BUN) was determined using the Urea Nitrogen (BUN) Colorimetric Detection Kit (Thermo Fisher Scientific, Waltham, MA).

Culture of human podocytes

Human podocytes were cultured as previously reported(Lan, et al. 2016; Wen, et al. 2019). Briefly, immortalized human podocytes were cultured in a growth medium containing RPMI 1640 supplemented with 10% fetal bovine serum,1 X penicillin-streptomycin, one mM L-glutamine, and 1X insulin, transferrin, and selenium (ITS) (Invitrogen, Grand Island, NY) at the permissive temperature (33 ℃). When cells reached about 80% confluence, they were transferred to 37 ℃ for seven days of differentiation in an ITS-free medium.

Apoptotic cell determination

TUNEL staining. In mouse tissues, apoptotic cells were assayed using TUNEL staining with Click-iT™ TUNEL Colorimetric IHC Detection Kit (Thermo Fisher Scientific, C10625). In vitro studies determined cellular apoptosis using Hoechst33342 staining, as described in previous publications(Lan, et al. 2016; Wen, et al. 2019). Cells with condensed and fragmented nuclei were identified as apoptotic cells. The nuclei of healthy cells appeared blue (TUNEL-negative), and the nuclei of apoptotic cells were stained brown (TUNEL-positive) after TUNEL staining.

Real-time PCR

Real-time PCR was performed as previous descriptions (Lan, et al. 2013; Lan, et al. 2016; Wen, et al. 2019). Briefly, total RNA was isolated from mouse kidney samples using TRIzol reagent (Invitrogen). Five micrograms of total RNA were reverse transcribed using the first-strand synthesis system (Invitrogen). Real-time PCR was performed in a Prism 7900HT sequence-detection system (Applied Biosystems, Foster City, CA, USA). Using the comparative CT method, a GAPDH internal control determined and standardized relative mRNA levels. GAPDH was used as an internal control. The primer sequences are listed in Table 1.

Table 1

The primers for qPCR
Gene	Forward primer	Reverse primer
Grem1	GCACATCCGAAAGGAGGAAG	ATGGATATGCAACGGCACTG
Kim-1	CCAATGGACATCGTGTCACC	GGGTCTTCTTGGAGGACGTG
NGAL	ATTTGTTCCAAGCTCCAGGGC	CCTTCAGTTCAGGGGACAGCT
Id1	CATGAACGGCTGCTACTCACG	GTCCCGACTTCAGACTCCGAG
Id4	CTGTGCCTGCAGTGCGATATG	AAAGCAGGGTGAGTCTCCAGC
Snail1	ATTCTCCTGCTCCCACTGC	GACTCTTGGTGCTTGTGGAG
GAPDH	CCATGGAGAAGGCTGGGC	CAAAGTTGTCATGGATGA

Western blotting analysis

Unless otherwise mentioned, Western blot was performed as described in our previous publications (Lan, et al. 2013; Lan, et al. 2016; Wen, et al. 2019). Primary antibodies used were rabbit anti-Grem1 (Novus Biologicals, NBP1-31150, 1:1000), rabbit anti-P-Smad2/3 (Abcam, ab63399, 1:1000), rabbit anti-P-Smad1/5/8 (Millipore Sigma, AB3848-I, 1:1000), and mouse anti-actin (Santa Cruz Biotechnology, sc-8432, 1:3000). For protein expression quantification, films were scanned using a Canon Scan 9950F scanner. The acquired images were analyzed using the NIH image program in the public domain.

RNA sequencing and data analysis

The extraction of total RNA has been described above. In the subsequent procedure, mRNA molecules were purified from total RNA using Oligo(dT)-attached magnetic beads. The Agilent Bioanalyzer 2100 system analyzed the cDNA libraries' qualities. RNA-seq was conducted using the BGISEQ500 platform. Clean reads were obtained from raw data after removing the adapter, ploy-N, and low-quality reads. HISAT was used to align clean reads to the reference genome. Bowtie2 was used to align clean reads to reference gene sequence, and RSEM was used to calculate gene and transcript expression levels. The method of fragments per kilobase of transcript sequence per million base pairs (FRKM) was used to calculate the expression level of each transcript. The software DESeq2 was used to analyze the differential expression genes and the standard p-value < 0.05 and log₂(fold change) > 0 (up-regulated) or log₂(fold change) < 0 (down-regulated) were taken to identify as differentially expressed genes (DEGs). Fuzzy C-means clustering was used to identify mice's special gene group responding to nicotine-exacerbated DN.

Immunohistochemistry and histology studies

Immunohistochemical studies were performed following previous publications (Jaimes, et al. 2007; Lan, et al. 2018). Primary antibodies were rabbit anti-Grem1 (Novus Biologicals, NBP1-31150, 1:100) and rabbit anti-Nephrin (Cambridge, MA, ab58968, 1:100). Formalin-fixed hemisected kidneys were embedded in paraffin and stained with Periodic Acid Schiff (PAS) for histological studies.

Statistical analysis

Unless otherwise noted, statistical analysis was conducted following our previous reports (Lan, et al. 2013; Lan, et al. 2016; Wen, et al. 2019). All data were statistically evaluated by analysis of variance (ANOVA) followed by Newman-Keuls multiple comparison tests using software (Prism 4.0, GraphPad Software). Statistical significance was considered when p values < 0.05.

1. Nicotine exacerbates DN in mice

To examine the effects of Nicotine and hyperglycemia on kidney injuries, we first determined albuminuria and BUN in treated mice. The Results showed that Nicotine alone did not increase albuminuria or BUN, whereas hyperglycemia significantly increased both (Fig. 1A, B). Interestingly, we found that the combination of Nicotine and hyperglycemia further increased albuminuria and BUN compared with hyperglycemia alone (Fig. 1A, B). We then detected the expression of Kidney Injury Molecule-1 (KIM-1) and Neutrophil gelatinase-associated lipocalin (NGAL), two biomarkers for kidney injury, by real-time PCR. The results showed that Nicotine alone did not increase the expression of either gene, while its combination with hyperglycemia significantly increased the expression of both genes compared to hyperglycemia alone (Fig. 1C, D).

We performed PAS staining to quantify the kidney glycogen accumulation in control and experimental mice in response to Nicotine and hyperglycemia. Nicotine or hyperglycemia alone did not increase the PAS staining in kidney tissues; in contrast, the combination of Nicotine and hyperglycemia significantly increased the PAS staining in both glomerular and tubular tissue, suggesting Nicotine and hyperglycemia synergistically increased kidney glycogen content (Fig. 2). We also examined apoptosis caused by Nicotine and hyperglycemia by using TUNEL staining. We found the combination of Nicotine and hyperglycemia-induced apoptosis in a more significant number of kidney cells than in either treatment alone (Fig. 3).

Nephrin is a vital slit diaphragm (SD) molecule, a major constituent of the glomerular filtration barrier. A decreased nephrin expression is associated with podocyte injury and kidney dysfunction (Jourdan, et al. 2018; Poulaki, et al. 2020). We performed real-time PCR and immunofluorescence staining to examine the effects of Nicotine and hyperglycemia on nephrin expression. Both modalities showed that the combined treatment (Nicotine and hyperglycemia) decreased nephrin protein and mRNA expressions compared to the treatment with Nicotine or hyperglycemia alone (Fig. 4).

Taken together, these results demonstrated that Nicotine exacerbated DN in mice.

2. Transcriptome changes induced by nicotine-exacerbated DN.

To uncover the underlying molecular mechanisms for nicotine-exacerbated DN, we performed RNA-seq analysis to compare the transcriptomes among the treatments of control (Con), nicotine (Nic), diabetic mellitus (DM) group, and combination of Nicotine and diabetic mellitus (Nic + DM). We randomly selected three mice from each group and extracted total RNAs from their kidneys to construct sequencing libraries. We obtained about 2.95 G of clean data with an average mapping rate of 95.76% per sample to the reference genome (data not shown). A total of 20110 genes were identified in all samples (Table S1). To confirm the effects of different treatments on gene expression in mouse kidneys, we analyzed the gene expression between the experiment groups (Nic, DM, and Nic + DM) and the control group. Compared with the control group, 4171 differentially expressed genes (DEGs) were identified in the Nic + DM group, of which 2063 genes were down-regulated and 2180 were up-regulated. (Fig. 5A, Table S2). To explore the genes strongly reflected in the process of nicotine promoting DN damage, the parameters were selected as log₂FC > = 5 (up-regulated) or log₂FC<=-5 (down-regulated) but -log10 (p-value) > 5 at the same time. We found that five up-regulated genes (Cyp4a12b, Lcn2, Gbp10, Gbp8, Ubd, Grem1) and eight down-regulated genes (Gm6300, Plin1, Cfd, Car3, Kap, Nat8l, Lrrc15, and Cacna1i) were strongly responsive to the Nicotine promoting DN damage (Fig. 5A).

We also analyzed DEGs in the Nic group vs. Con group and the DM group vs. Con group, respectively. Compared with the control group, we identified that 1610 genes were down-regulated and 1632 genes were up-regulated in the Nic group, 755 genes were down-regulated, and 936 genes were up-regulated in the DM group (Figure S1, Table S3, S4). Here, we found that the down-regulated gene Gm6300 and up-regulated genes Ubd, Gm14391, and Art2a-ps strongly responded to hyperglycemia. These genes presented as a differential expression in the DM group vs. the Con group. The Gm6300 and Ubd genes were also obviously differentially expressed in the Nic + DM group vs. Con group. These two genes may be specific genes involved in regulating hyperglycemia damaging kidneys. Moreover, we found that some genes related to oxidative stress were differentially expressed. For example, CYBB and Ncf1, which promote ROS production, were up-regulated, while SOD1, which inhibits oxidative stress, was significantly down-regulated in the Nic + DM group vs. the Con group (Table S2).

3. Special gene group responded in nicotine-exacerbated DN mice.

We performed a Fuzzy C-means clustering analysis to figure out the genes playing important roles in Nicotine and hyperglycemia-induced kidney damage. Our results showed that 1082 genes clustered into four unique expression patterns in 4 groups of samples (Fig. 5C, Table S5). Interestingly, 259 genes were clustered into cluster 2, and the expression patterns of these genes presented an exciting phenomenon (Table S5). The overall expression trend of these genes is that the expression levels of the first three groups (Con, Nic, and DM) are relatively close, but there is a sudden up-regulation trend in the fourth group (Nic + DM) (Fig. 5C). The up-regulated genes in Nic + DM vs. Con and the fold change (FC) were much larger than those in DM vs. Con; candidate genes were selected for Fuzzy C means clustering analysis. These 259 genes of cluster 2 may be a potential hub genome that specifically increases and responds to nicotine-induced DN kidney damage nicotine to promote DN damage.

Further, we performed the Venn analysis to identify genes involved in Nicotine promoting kidney damage in DN. The selected 50 genes had the highest up-regulation levels, were in cluster 2, and were placed in both the Nic and the DM groups. Venn diagram showed seven common genes (Ubd, Saa1, Grem1, Gbp8, Lcn2, Mat1, Chil3) among the four treatment groups. These genes might play critical roles in the process of Nicotine and high glucose-induced kidney damage (Fig. 5B).

4. The Grem1 may be a vital gene in the process of Nicotine exacerbating mouse DN.

To identify genes that play a vital role in Nicotine-exacerbated DN in mice, we first screened the fold changes (FC) of the six common genes in the Nic + DM group compared to the Con group. Our results showed that the genes Ubd, Saa1, and Grem1were the top three most up-regulated genes (Fig. 6A). We also analyzed the expression trends of 6 common genes in the three comparison groups, including Nic + DM vs. Con, Nic + DM vs. Nic, and Nic + DM vs. DM. Surprisingly, only Grem1 of the top three genes (Ubd, Saa1, and Grem1) was up-regulated in the three comparison groups (adopted p value < 0.05, Table 2). Furthermore, our data showed that Grem1 (log₂FC = 2.854042328) and Grem2 (log₂FC = 2.508648596) genes were also up-regulated in the DM vs Con group (Table S4), but the difference in up-regulation was not large. However, Grem1 (log₂FC = 5.731750645) was significantly up-regulated than Grem2 (log₂FC = 3.655715778) in the DM + Nic vs Con group (Table S2).

Table 2

The fold changes of identified seven differentially expressed genes in three groups
		Nic + DM vs. Con		Nic + DM vs. Nic		Nic + DM vs. DM
Gene id	Gene name	log2FC	p-value	log2FC	p-value	log2FC	p-value
24108	Ubd	6.4330023	2.14E-08	5.568934739	3.42102E-06	1.405613845	0.260412665
20208	Saa1	6.191799165	0.000046	3.271862017	0.009054783	1.43047504	0.159121216
23892	Grem1	5.731750645	0.000000226	5.001079469	4.89209E-07	2.883274271	0.002156905
76074	Gbp8	5.54548219	0.000000125	3.928375351	6.72766E-05	1.457002581	0.158508517
16819	Lcn2	5.40400181	5.93E-12	5.181678867	1.61987E-11	2.290049156	0.02696154
11720	Mat1a	5.043812868	0.003280271	2.448511208	0.094333698	1.361990523	0.47284171
12655	Chil3	4.947779857	0.0000217	3.158978799	0.000422072	2.538680922	0.012031274

Grem1 is a critical member of the TGF-beta signaling pathway(Marquez-Exposito, et al. 2020), so we suspect that the TGF-beta signaling pathway involves nicotine-promoting kidney damage in DN. We analyzed the DEGs in the Nic + DM vs. Con group to test this hypothesis. We found that 24 DEGs were mapped to the TGF-beta pathway, including 12 down-regulated and 12 up-regulated genes (Fig. 6B). It is worth noting that Grem1 was still the gene with the most significant fold change among the 24 DEGs (Fig. 6B). Notably, the Grem2 gene was the second most up-regulated gene mapped to the TGF-beta pathway. These results suggest that the 24 DEGs represented by Grem1 in the TGF-beta signaling pathway were critical in regulating Nicotine to promote kidney damage in DN. Accordingly, the TGF-beta pathway is likely to be one of the core pathways involved in the nicotine-exacerbated DN.

To confirm the expression of Grem1 in nicotine-exacerbated DN, Real-time PCR and Western blot were performed to examine its expression in mouse kidneys. Our results showed that Nicotine had no significant effect on Grem1 expression in mice with blood glucose levels less than 200 dg/ml; however, it significantly increased Grem1 expression in the kidneys of diabetic mice (Fig. 6C).

In addition, we further confirmed the expression of Grem1 in mouse kidneys through immunofluorescent staining. As displayed in Fig. 7, nicotine increased Grem1 expression in the glomerular and tubular cells under the condition of hyperglycemia. Considering the importance of podocyte for kidney function, we also examined Grem1 expression in podocyte by immunofluorescence staining. The results showed that some Grem1-expressing cells also expressed nephrin, a molecular marker for podocyte, indicating that nicotine could increase Grem1 expression in podocyte (Fig. 8).

5. The phosphorylation of the Smad signaling pathway, being downstream of the TGF-beta pathway, responds to the Nicotine and exacerbates hyperglycemia-induced Grem1 increasing

Grem1 plays its function through 3 signaling pathways: 1) activation of Smad2/3; 2) suppression of Smad1/5/8; 3) activation of VEGFR2. We also examined the effects of Nicotine and hyperglycemia on these downstream signaling pathways. Western blotting and IHC staining showed that the combination of Nicotine and hyperglycemia significantly increased the activation of Smad2/3 and decreased the activation of Smad1/5/8 (Fig. 9A-D) compared with Nicotine or hyperglycemia alone.

To further confirm the activity changes of Smads, we examined the mRNA of Id1 and Id4, the targeting genes for Smad1/5/8, and Snail, the targeting gene for Smad2/3. The results showed that the combination of Nicotine and hyperglycemia significantly decreased the mRNA levels of Id1 and Id4 but increased the level of Snail (Fig. 9E). At the same time, our RNA-seq data also showed that the Id1 and Id4 were down-regulated, and Snail was up-regulated in Nic + DM vs. Con group (Table S2). These data suggest that Nicotine promotes activation of Smad2/3 but suppresses Smad1/5/8 in hyperglycemia.

6. Knocking down Gram1 partially attenuated Nicotine and high glucose-induced podocyte injury

To examine the role of Grem1 in nicotine-exacerbated DN, we treated human podocytes with high glucose and Nicotine. The results showed that high glucose and nicotine co-treatment significantly increased Grem1 expression (Fig. 10A). Cleaved caspase 3, a biomarker of cell apoptosis, was also raised with Nicotine and high glucose; however, the expression of nephrin was significantly decreased (Fig. 10A).

To establish the causation between Grem1 expression and podocyte injury, we knocked down Grem1 expression with its specific siRNA. The results showed that knocking down Grem1 expression significantly reduced cleaved caspase 3 but partially restored nephrin expression (Fig. 10B). These results demonstrated that Grem1 played a vital role in nicotine-exacerbated podocyte injury.

Cigarette smoking is among the top ten contributors to global morbidity and mortality (Lande, et al. 2010). Increasing evidence shows that cigarette smoking is an independent risk factor for developing and progressing chronic kidney disease, including D (Jain and Jaimes 2013; Hall, et al. 2016; Bello, et al. 2017; Xia, et al. 2017; Zhu, et al. 2017). Therefore, understanding the relationship between smoking and DN is of great significance for the prevention and treatment of DN in this study, we focused on the role of Nicotine, the primary active component of cigarette smoke, in the progress of DN. Our results showed that although Nicotine alone could not cause apparent kidney damage, it significantly boosted hyperglycemia-induced albuminuria, BUN, expression of Kim and NGAL, accumulation of glycogen in renal tissues (PAS staining), and apoptosis of kidney cells, suggesting that Nicotine carries a potential to exacerbate DN. Through RNA-seq analysis, we identified the role of Grem1 and its related TGF-β signaling pathway in the development and progression of DN. Additionally, in vitro data showed that suppressing Grem1 expression could partially attenuate nicotine-exacerbated podocyte injury. The present study demonstrated that Nicotine exacerbates DN through upregulation of Grem1 expression. This is the first report to reveal the molecular mechanisms involved in smoke-mediated exacerbation of DN.

To systematically understand the molecular mechanisms for cigarette smoke-enhanced DN, we treated mice with Nicotine (Nic), hyperglycemia (DN), and the combination of Nicotine and hyperglycemia (Nic + DN). Then we performed RNA-seq to compare the kidney transcriptome changes of these mice. Compared with the control group (Con), we identified 3432, 1691, and 4243 DEGs in the Nic, DM, and Nic + DM groups. This indicates that Nicotine is involved in regulating this process by affecting a wide range of gene expression in the process of aggravating the kidney damage in the diabetic milieu.

Among the DEGs induced by Nicotine and hyperglycemia, we identified six up-regulated genes (Cyp4a12b, Lcn2, Gbp10, Gbp8, Ubd, Grem1) that were strongly responsive to nicotine-promoted kidney injury (Fig. 5A). Increased Cyp4a12b was found to lead to severe oxidative stress(Gui, et al. 2013), and Gbp10 and Gbp8 are selectively up-regulated by a panel of proinflammatory cytokines and T(Degrandi, et al. 2007). Ubd is a ubiquitin-like protein modifier that targets proteins for proteasomal degradation, and inflammatory stimuli up-regulate UBD (inflammatory stimuli up-regulate both UBD). Lcn2 is also known as NGAL. It is not only a marker of kidney damage but also a fat calin-2/NGAL as a potential biomarker for inflammation and metabolic diseases (Abella, et al. 2015; Shang and Wang 2017). Grem1 has been reported to promote renal inflammation, apoptosis, and fibrosis (Lavoz, et al. 2018; Marquez-Exposito, et al. 2018). Our findings suggest that the process by which Nicotine promotes DN damage may be mainly related to the operation of increased renal inflammation and oxidative stress. Anti-inflammatory treatment may be a potential treatment option to alleviate smoking-induced DN damage.

Among the up-regulated genes in this study, Grem1was the most notable in all the three comparison groups (Nic + DM vs. Con, Nic + DM vs. Nic, and Nic + DM vs. DM). Grem1, a member of the DAN family, represents a collection of BMP antagonists that are highly expressed during development and have important roles in limb bud formation and digitation, kidney formation and morphogenesis, and left-right axis specification (Zúñiga, et al. 1999; Khokha, et al. 2003; Marques, et al. 2004; Michos, et al. 2004; Michos, et al. 2007). In recent years, some studies showed that overexpression of Grem1 could lead to aggravation of kidney damage. For example, in an experimental mouse with folic acid-induced nephropathy, specific overexpression of Grem1 in tubules increased renal impairment, which was mainly mediated by up-regulation of local proinflammatory and pro-fibrotic factors (Droguett, et al. 2014). Similar results were found in studies of streptozotocin-induced DN in a mouse model (Marchant, et al. 2015). In addition, in human DN, the expression level of Grem1 is positively correlated with the renal tubulointerstitial fibrosis score, suggesting that Grem1 has a deleterious effect on human kidney disease(Dolan, et al. 2005). Our results also showed that Nicotine increased Grem1 expression in renal tubular cells, glomeruli, and podocytes (Fig. 6,7). It is well known that Grem1 is a gene in the TGF-beta signaling pathway. By comparing the differentially expressed genes with genes in the TGF-beta signaling pathway from the KEGG database, we found that 24 DEGs were mapped to the TGF-beta pathway (Fig. 5B). Here, we found that Grem1 and Grem2 were the top 2 up-regulated genes of 24 DEGs. Although previous studies by our group demonstrated that Grem2 increasing induced by high glucose could mediate podocyte apoptosis (Wen, et al. 2019), and indeed we also found that the Grem1 and Grem2 were both up-regulated in the DM vs. Con group; our research shows that Grem1 is the most responsive to nicotine-promoted kidney damage in DN compared to Germ2. The results suggest that Grem1 may be a significant gene in the TGF-beta pathway dependent on nicotine-exacerbated kidney damage in DN. Furthermore, we confirmed the role of TGF-beta signaling in nicotine-mediated kidney damage. We found that the combination of Nicotine and hyperglycemia increased the activation of Smad2/3 and the expression of its target genes Id1 and Id4 but decreased the activation of Smad1/5/8 and the expression of its target gene Snail. Similarly, we confirmed in our RNA-seq data that Id1 and Id4 were down-regulated, but Snail was up-regulated in Nic + DM vs. Con group (Table S2). The present study demonstrated that nicotine-mediated diabetic kidney injury involves the TGF-beta signaling pathway in general and Grem1 in particular.

Moreover, Grem1 has been reported to activate NF-κB signaling in vivo and in vitro, increasing proinflammatory genes and leading to the recruitment of immune infiltrating cells such as CD3 + cells and macrophages in the kidney(Sanz, et al. 2010). VEGFR2 is a functional receptor for Grem1 in the kidney(Lavoz, et al. 2015). It appears that Gremlin-1/VEGFR2 activates the downstream MAP kinase family, which finally translocates CREB protein to the nucleus, inducting transcription of migration and proinflammatory cytokines and thus triggering an infiltrative inflammation in kidney tissues (Corsini, et al. 2014). Additionally, TGF-β has been considered a primary regulator of EMT-induced renal fibrosis in D (Sutariya, et al. 2016). Grem1 induces activation of the Smad signaling pathway in a TGF-β-independent manner. Grem1 overexpression maintains activation of the Smad pathway through TGF-beta, thereby promoting a chronic process. Nonetheless, the silencing of the Grem-1 gene can inhibit the TGF-β1 response in vitro, and the use of neutralizing the TGF-β1 antibody can inhibit the Grem-1-induced fibrotic response. Combined with previous studies, it has been shown that nicotine stimulation activates the TGF-β pathway, which promotes cell proliferation and the production of extracellular matrix proteins (Jaimes, et al. 2007; Jaimes, et al. 2009; Hua, et al. 2010; Lan, et al. 2018). Thus, Nicotine appears to promote renal fibrosis in the diabetic milieu by up-regulating Grem1 and activating Smad signaling (TGF-beta pathway). At the same time, it also fosters kidney inflammation by starting a series of downstream genes such as VEGFR2/MAP/CREB.

Recently, in a mice model similar to human crescentic nephritis induced by nephrotoxic serum (NTS), it was found that treatment with bromodomain and extra-terminal domain (BET) inhibitor (iBET) in NTS-injected mice inhibited renal Germ1 overexpression and diminished glomerular damage, thereby restoring podocytes, suggesting that inhibition of Germ1 has significant potential value in nephritis (Tejedor-Santamaria, et al. 2022). Notably, the present study showed that knockdown of Grem1 significantly restored nephrin expression under combined treatment with Nicotine and high glucose (Fig. 9B). This implies that Grem1 inhibition might ameliorate podocyte damage by Nicotine and high glucose. In summary, the present study confirms that Grem1 plays the act of a critical gene, and participation of the TGF-beta signaling pathway is significant in nicotine-exacerbated kidney damage in the diabetic milieu. It is possible that interfering with the expression of Grem1 will be an effective way to treat long-term diabetic smokers, and Grem1 may also become a potential target for developing related therapeutic drugs. It will be interesting to generate knockout mice to remove/reduce Grem1 expression and then expose them to Nicotine and hyperglycemia alone or in combination. By comparing the kidney injuries induced by different milieus, we can further confirm the role of Grem1 in the progress of nicotine-exacerbated DN.

Our studies have demonstrated that Nicotine and high glucose-mediated oxidative stress contributed to kidney cell injury (Lan, et al. 2016; Jiang, et al. 2019; Wen, et al. 2019). NADPH oxidases (Nox) is a membrane-bound enzyme complex to generate superoxide, a substrate for subsequent reactions to cause R.O.S. From the RNA-seq results of this study; we found that nicotine administration significantly increased the gene expression of some NADPH-oxidase subunits, such as CYBB, Ncf1, while Nicotine further increased hyperglycemia-induced expression of Ncf1 (Table S2). Moreover, it has been reported that the deficiency of superoxide dismutase (SOD1) in mice decreases antioxidant enzyme activities and results in severe oxidative stress^{(Hwang, et al. 2020)}. The present study also showed that the SOD1 was significantly down-regulated by Nicotine in DN (Table S2). These results strongly support the previous findings that increased oxidative stress caused by Nicotine and/or high glucose contributes to the progress of DN. It will be interesting to examine the synergistic effect of increased oxidative stress caused by Nicotine and high glucose and to investigate whether Grem1 regulates the expression of related genes.

Nicotine exacerbates DN through upregulation of Grem1 expression in kidney cells. The present study reveals a new molecular mechanism for nicotine-enhanced kidney injury and highlights some novel potential therapeutic targets for smoking-related DN.

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of Data and Materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of interests

The authors declare that they have no competing interests.

Funding

This work was supported by the 2022 Health sciences and technology program of Hangzhou: General Project Category A (No. A20220084); and Biomedical and Health Industry Development Support Science and Technology Project in Hangzhou (No.2022WJC064). This work was also supported by a grant RO1DK118017 (PCS) from the National Institutes of Health, Bethesda, MD.

Authors' contributions

JC, XL, and PS oversaw the experiments and designed the analytical strategy.

JC, HX, RX, LH, RA, VK, SFM, and XL performed the experiments.

JC, AM, XL, and PS analyzed the data.

JC, XL, and PS wrote the manuscript.

All authors contributed to the final manuscript.

Acknowledgments

We sincerely appreciate Dr. Guisheng Wu for offering lab space to perform some of the experiments.

Abella V, Scotece M, Conde J, Gómez R, Lois A, et al. The potential of lipocalin-2/NGAL as biomarker for inflammatory and metabolic diseases. Biomarkers. 2015;20(8):565–71.
Albuquerque EX, Pereira EF, Alkondon M, Rogers SW. Mammalian nicotinic acetylcholine receptors: from structure to function. Physiol Rev. 2009;89(1):73–120.
Arany I, Reed DK, Grifoni SC, Chandrashekar K, Booz GW, et al. A novel U-STAT3-dependent mechanism mediates the deleterious effects of chronic nicotine exposure on renal injury. Am J Physiol Renal Physiol. 2012;302(6):F722–9.
Bello AK, Qarni B, Samimi A, Okel J, Chatterley T, et al. Effectiveness of Multifaceted Care Approach on Adverse Clinical Outcomes in Nondiabetic CKD: A Systematic Review and Meta-analysis. Kidney Int Rep. 2017;2(4):617–25.
Chang YW, Singh KP. Duration-dependent effects of nicotine exposure on growth and AKT activation in human kidney epithelial cells. Mol Cell Biochem. 2018;448(1–2):51–60.
Corsini M, Moroni E, Ravelli C, Andrés G, Grillo E, et al. Cyclic adenosine monophosphate-response element-binding protein mediates the proangiogenic or proinflammatory activity of gremlin. Arterioscler Thromb Vasc Biol. 2014;34(1):136–45.
Degrandi D, Konermann C, Beuter-Gunia C, Kresse A, Würthner J, et al. Extensive characterization of IFN-induced GTPases mGBP1 to mGBP10 involved in host defense. J Immunol. 2007;179(11):7729–40.
Dolan V, Murphy M, Sadlier D, Lappin D, Doran P, et al. Expression of gremlin, a bone morphogenetic protein antagonist, in human diabetic nephropathy. Am J Kidney Dis. 2005;45(6):1034–9.
Droguett A, Krall P, Burgos ME, Valderrama G, Carpio D, et al. Tubular overexpression of gremlin induces renal damage susceptibility in mice. PLoS One. 2014;9(7):e101879.
Gui S, Sang X, Zheng L, Ze Y, Zhao X, et al. Intragastric exposure to titanium dioxide nanoparticles induced nephrotoxicity in mice, assessed by physiological and gene expression modifications. Part Fibre Toxicol. 2013;10:4.
Hall ME, Wang W, Okhomina V, Agarwal M, Hall JE, et al. Cigarette Smoking and Chronic Kidney Disease in African Americans in the Jackson Heart Study. J Am Heart Assoc. 2016;5(6):e003280.
Hassanzadeh HR, Wang MD. An Integrated Deep Network for Cancer Survival Prediction Using Omics Data. Front Big Data. 2021;4:568352.
Hua P, Feng W, Ji S, Raij L, Jaimes EA. Nicotine worsens the severity of nephropathy in diabetic mice: implications for the progression of kidney disease in smokers. Am J Physiol Renal Physiol. 2010;299(4):F732–9.
Hukkanen J, Jacob P 3rd, Benowitz NL. Metabolism and disposition kinetics of nicotine. Pharmacol Rev. 2005;57(1):79–115.
Hwang J, Jin J, Jeon S, Moon SH, Park MY, et al. SOD1 suppresses pro-inflammatory immune responses by protecting against oxidative stress in colitis. Redox Biol. 2020;37:101760.
Jaimes EA, Tian RX, Raij L. Nicotine: the link between cigarette smoking and the progression of renal injury? Am J Physiol Heart Circ Physiol. 2007;292(1):H76–82.
Jaimes EA, Tian RX, Joshi MS, Raij L. Nicotine augments glomerular injury in a rat model of acute nephritis. Am J Nephrol. 2009;29(4):319–26.
Jaimes EA, Zhou MS, Siddiqui M, Rezonzew G, Tian R, et al. Nicotine, smoking, podocytes, and diabetic nephropathy. Am J Physiol Renal Physiol. 2021;320:F442–53.
Jain G, Jaimes EA. Nicotine signaling and progression of chronic kidney disease in smokers. Biochem Pharmacol. 2013;86(8):1215–23.
Jiang S, Quan DV, Sung JH, Lee MY, Ha H. Cigarette smoke inhalation aggravates diabetic kidney injury in rats. Toxicol Res (Camb). 2019;8(6):964–71.
Jourdan T, Park JK, Varga ZV, Pálóczi J, Coffey NJ, et al. Cannabinoid-1 receptor deletion in podocytes mitigates both glomerular and tubular dysfunction in a mouse model of diabetic nephropathy. Diabetes Obes Metab. 2018;20(3):698–708.
Khokha MK, Hsu D, Brunet LJ, Dionne MS, Harland RM. Gremlin is the BMP antagonist required for maintenance of Shh and Fgf signals during limb patterning. Nat Genet. 2003;34(3):303–7.
Kilari S, Sharma A, Zhao C, Singh A, Cai C, et al. Identification of novel therapeutic targets for contrast induced acute kidney injury (CI-AKI): alpha blockers as a therapeutic strategy for CI-AKI. Transl Res. 2021;235:32–47.
Kim CS, Choi JS, Joo SY, Bae EH, Ma SK, et al. Nicotine-Induced Apoptosis in Human Renal Proximal Tubular Epithelial Cells. PLoS ONE. 2016;11(3):e0152591.
Lan X, Lederman R, Eng JM, Shoshtari SS, Saleem MA, et al. Nicotine Induces Podocyte Apoptosis through Increasing Oxidative Stress. PLoS ONE. 2016;11(12):e0167071.
Lan X, Wen H, Aslam R, Shoshtari SSM, Mishra A, et al. Nicotine enhances mesangial cell proliferation and fibronectin production in high glucose milieu via activation of Wnt/β-catenin pathway. Biosci Rep. 2018;38(3):BSR20180100.
Lan X, Rai P, Chandel N, Cheng K, Lederman R, et al. Morphine induces albuminuria by compromising podocyte integrity. PLoS ONE. 2013;8(3):e55748.
Lan X, Kumar V, Jha A, Aslam R, Wang H, et al. EDA2R mediates podocyte injury in high glucose milieu. Biochimie. 2020;174:74–83.
Lande RG, Wyatt SA, Przekop PR. Jr. Addiction medicine: a model osteopathic medical school curriculum. J Am Osteopath Assoc. 2010;110(3):127–32.
Lavoz C, Alique M, Rodrigues-Diez R, Pato J, Keri G, et al. Gremlin regulates renal inflammation via the vascular endothelial growth factor receptor 2 pathway. J Pathol. 2015;236(4):407–20.
Lavoz C, Poveda J, Marquez-Exposito L, Rayego-Mateos S, Rodrigues-Diez RR, et al. Gremlin activates the Notch pathway linked to renal inflammation. Clin Sci (Lond). 2018;132(11):1097–115.
Li Y, Teng D, Shi X, Qin G, Qin Y, et al. Prevalence of diabetes recorded in mainland China using 2018 diagnostic criteria from the American Diabetes Association: national cross sectional study. BMJ. 2020;369:m997.
Lv TT, Mo YJ, Yu TY, Shao S, Lu MQ, et al. Using RNA-Seq to Explore the Repair Mechanism of the Three Methods and Three-Acupoint Technique on DRGs in Sciatic Nerve Injured Rats. Pain Res Manag. 2020; 7531409.
Ma T, Zheng Z, Guo H, Lian X, Rane MJ, et al. 4-O-methylhonokiol ameliorates type 2 diabetes-induced nephropathy in mice likely by activation of AMPK-mediated fatty acid oxidation and Nrf2-mediated anti-oxidative stress. Toxicol Appl Pharmacol. 2019;370:93–105.
Marchant V, Droguett A, Valderrama G, Burgos ME, Carpio D, et al. Tubular overexpression of Gremlin in transgenic mice aggravates renal damage in diabetic nephropathy. Am J Physiol Renal Physiol. 2015;309(6):F559–68.
Mardarowicz K, Mardarowicz G, Schabowski J. The need to increase the activity of family doctors for smoking cessation in patients with diabetes. Family Med Prim Care Rev. 2010;12(2):400–2.
Marques S, Borges AC, Silva AC, Freitas S, Cordenonsi M, et al. The activity of the Nodal antagonist Cerl-2 in the mouse node is required for correct L/R body axis. Genes Dev. 2004;18(19):2342–7.
Marquez-Exposito L, Lavoz C, Rodrigues-Diez RR, Rayego-Mateos S, Orejudo M, et al. Gremlin Regulates Tubular Epithelial to Mesenchymal Transition via VEGFR2: Potential Role in Renal Fibrosis. Front Pharmacol. 2018;9:1195.
Marquez-Exposito L, Cantero-Navarro E, R RR-D, Orejudo M, Tejera-Muñoz A, et al. Molecular Regulation of Notch Signaling by Gremlin. Adv Exp Med Biol. 2020;1227:81–94.
Michos O, Panman L, Vintersten K, Beier K, Zeller R, et al. Gremlin-mediated BMP antagonism induces the epithelial-mesenchymal feedback signaling controlling metanephric kidney and limb organogenesis. Development. 2004;131(14):3401–10.
Michos O, Gonçalves A, Lopez-Rios J, Tiecke E, Naillat F, et al. Reduction of BMP4 activity by gremlin 1 enables ureteric bud outgrowth and GDNF/WNT11 feedback signalling during kidney branching morphogenesis. Development. 2007;134(13):2397–405.
Poulaki E, Detsika MG, Fourtziala E, Lianos EA, Gakiopoulou H. Podocyte-targeted Heme Oxygenase (HO)-1 overexpression exacerbates age-related pathology in the rat kidney. Sci Rep. 2020;10(1):5719.
Rezonzew G, Chumley P, Feng W, Hua P, Siegal GP, et al. Nicotine exposure and the progression of chronic kidney disease: role of the α7-nicotinic acetylcholine receptor. Am J Physiol Renal Physiol. 2012;303(2):F304–12.
Saeedi P, Petersohn I, Salpea P, Malanda B, Karuranga S, et al. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res Clin Pract. 2019; 157: 107843.
Sanz AB, Sanchez-Niño MD, Ramos AM, Moreno JA, Santamaria B, et al. NF-kappaB in renal inflammation. J Am Soc Nephrol. 2010;21(8):1254–62.
Shang W, Wang Z. The Update of NGAL in Acute Kidney Injury. Curr Protein Pept Sci. 2017;18(12):1211–7.
Sutariya B, Jhonsa D, Saraf MN. TGF-β: the connecting link between nephropathy and fibrosis. Immunopharmacol Immunotoxicol. 2016;38(1):39–49.
Tang TT, Wang B, Li ZL, Wen Y, Feng ST, et al. Kim-1 Targeted Extracellular Vesicles: A New Therapeutic Platform for RNAi to Treat AKI. J Am Soc Nephrol. 2021;32(10):2467–83.
Tejedor-Santamaria L, Morgado-Pascual JL, Marquez-Exposito L, Suarez-Alvarez B, Rodrigues-Diez RR, et al. Epigenetic Modulation of Gremlin-1/NOTCH Pathway in Experimental Crescentic Immune-Mediated Glomerulonephritis. Pharmaceuticals (Basel). 2022;15(2):121.
The Writing Committee of 2020 Report on Health Hazards of Smoking in China. 2020 Report on Health Hazards of Smoking in China: an Updated Summary[J]. Chinese Circulation Journal, 2021; 36(10): 937–952.
Wang Q, Rizzo JA, Fang H. Changes in Smoking Behaviors following Exposure to Health Shocks in China. Int J Environ Res Public Health. 2018;15(12):2905.
Warren AM, Knudsen ST, Cooper ME. Diabetic nephropathy: an insight into molecular mechanisms and emerging therapies. Expert Opin Ther Targets. 2019;23(7):579–91.
Wen H, Kumar V, Mishra A, Song S, Aslam R, et al. Grem2 mediates podocyte apoptosis in high glucose milieu. Biochimie. 2019;160:113–21.
Xia J, Wang L, Ma Z, Zhong L, Wang Y, et al. Cigarette smoking and chronic kidney disease in the general population: a systematic review and meta-analysis of prospective cohort studies. Nephrol Dial Transplant. 2017;32(3):475–87.
Yu H, Chen D, Oyebamiji O, Zhao YY, Guo Y. Expression correlation attenuates within and between key signaling pathways in chronic kidney disease. BMC Med Genomics. 2020;13(Suppl 9):134.
Zhang L, Long J, Jiang W, Shi Y, He X, et al. Trends in Chronic Kidney Disease in China. N Engl J Med. 2016;375(9):905–6.
Zheng JY, Wang CY, Gao C, Xiao Q, Huang CW, et al. MLL3 suppresses tumorigenesis through regulating TNS3 enhancer activity. Cell Death Dis. 2021;12(4):364.
Zhu P, Pan XF, Sheng L, Chen H, Pan A. Cigarette Smoking, Diabetes, and Diabetes Complications: Call for Urgent Action. Curr Diab Rep. 2017;17(9):78.
Zúñiga A, Haramis AP, McMahon AP, Zeller R. Signal relay by BMP antagonism controls the SHH/FGF4 feedback loop in vertebrate limb buds. Nature. 1999;401(6753):598–602.

Download PDF

Journal Publication

published 06 Jul, 2023

Read the published version in Molecular Medicine →

Reviewers agreed at journal
08 Sep, 2022
Reviewers invited by journal
08 Sep, 2022
Editor invited by journal
31 Aug, 2022
Editor assigned by journal
30 Aug, 2022
First submitted to journal
29 Aug, 2022

You are reading this latest preprint version

Nicotine exacerbates diabetic nephropathy through upregulation of Grem1 expression

Status:

Journal Publication

Version 1

Abstract

Background

Method

Result

Conclusion

Figures

Introduction

Materials And Methods

Animals and treatments

Culture of human podocytes

Apoptotic cell determination

Real-time PCR

Western blotting analysis

RNA sequencing and data analysis

Immunohistochemistry and histology studies

Statistical analysis

Results

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1