Analysis of Drug Resistance Genotype and Distribution in Klebsiella pneumoniae Isolates from a Tertiary-Care Hospital in Guilin, China

doi:10.21203/rs.3.rs-2010279/v1

Download PDF

Research Article

Analysis of Drug Resistance Genotype and Distribution in Klebsiella pneumoniae Isolates from a Tertiary-Care Hospital in Guilin, China

https://doi.org/10.21203/rs.3.rs-2010279/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose

To better understand the distribution and drug resistance of Klebsiella pneumoniae and provide a basis for clinical treatment.

Methods

We studied 167 Klebsiella pneumoniae clinical specimens in the Second Affiliated Hospital of Guilin Medical University from November 2020 to June 2022. These clinical specimens were isolated from urine, blood, sputum, catheter, pus, drainage fluid, bile, joint fluid, alveolar lavage fluid, and wound/trauma/incision secretions were collected. The drug resistance of Klebsiella pneumoniae and clinical outcomes were analyzed. We designed primers based on relevant resistance genes in The Comprehensive Antibiotic Resistance Database, while a part of them also used primer sequences from the relevant literature. We detected the carbapenems gene using polymerase chain reaction (PCR) and sent the product to the company for sequencing and homology analysis.

Results

A total of 707 inpatients were recruited and 167 isolates of Klebsiella pneumoniae were obtained. 83 strains from sputum specimens (49.7%), 18 strains from wound/trauma/incision secretion specimens (10.8%), 15 strains from pus specimens (9.0%), and other strains from urine specimens, blood specimens, drainage fluid, bile specimens, bile specimens, catheter specimens, and joint fluid specimens (30.5%). Klebsiella pneumoniae has a high rate of resistance to ampicillin (AMP) (98.2%), tetracycline (TE) (36.5%), piperacillin (PIP) (36.5%), chloramphenicol (CHL) (35.3%), and cefazolin (CFZ) (33.5%). From the analysis of sequencing results, we found that 68 strains were missing membrane pore protein Ompk-35, 3 strains were detected carrying KPC-1/KPC-2 type, 12 strains were missing membrane pore protein Ompk-36, 62 strains were missing membrane pore protein Ompk-37, 1 strain was detected carrying NDM-1, and no VIM-1, IMP-4, OXA-48, SME-2.

Conclusions

Klebsiella pneumoniae mainly causes respiratory tract infections and has a high rate of resistance to cephalosporins, piperacillin, and other antibacterial drugs. The detection rate of missing membrane pore protein ompk-35/ompk-37 is high, and the more drug resistance gene species it carries, the more drug resistant drug species it is.

Klebsiella pneumoniae

multidrug resistance genotype

homology analysis

hospital communications

Klebsiella pneumoniae is an important gram-negative opportunistic pathogen that causes a variety of infectious diseases, including urinary tract infections, bacteremia, pneumonia, and liver abscesses, and is commonly associated with opportunistic infections, affects immunosuppressed patients, and causes nosocomial infections ^[1–6]. The rapid geographic spread of these clinical strains is particularly concerning. Klebsiella pneumoniae is also a leading cause of hospital-associated (HA) infections.

The heavy use of antimicrobial drugs in clinical settings has led to changes in the human flora and an increase in drug resistance of Klebsiella pneumoniae year after year. This adds to the difficulties and economic costs of clinical anti-infection treatment ^[7–10]. Drug-resistant Klebsiella pneumoniae is a global health problem that is spreading in several countries ^[11–14]. We need more in-depth investigation into drug resistance in Klebsiella pneumoniae isolates.

Carbapenems are atypical β-lactam antibiotics with the broadest antibacterial spectrum and strongest antibacterial activity, and have become one of the most important antibacterial drugs for the treatment of serious bacterial infections ^[15–18]. With the widespread use of carbapenems in clinical practice, statistics from the National Bacterial Drug Resistance Monitoring Network show that the detection rate of carbapenem-resistant antibiotics Klebsiella pneumoniae continues to rise ^[19]. Carbapenems can be classified into A, B, and D according to Ambler's molecular classification. KPC, SME, and other carbapenems are examples of carbapenems. Class B enzymes are also known as metalloid–lactamases, including NDM, IMP, VIM, etc. Class D enzymes are benzilones, encoded by blaOXA ^[20–24]. The pore protein-like genes are blaOmpk-35, blaOmpk36, and blaOmpk-37 ^{[25, 26]}. Studies have shown that the positive carbapenem isolates are extremely transmissible. The propensity of Klebsiella pneumoniae to spread in hospital settings correlates with the degree of drug resistance and is more frequently transmitted between hospitals than between countries ^[14]. Therefore, we sought to analyze the determinants of drug resistance in Klebsiella pneumoniae isolates collected from patients treated at the Second Affiliated Hospital of Guilin Medical University, China, between November 2020 and June 2022. Our aim is to provide a theoretical basis for clinical drug-resistance monitoring, anti-infective therapy, and hospital infection control.

Ethics Statement

All of the investigation protocols in this study were approved by the institutional ethics committee of the Second Affiliated Hospital of Guilin Medical University, Guilin, China. Written consent was given by the patients for their information to be stored in the hospital database and used for research. Permission to use the information in the medical records of the patients for research purposes was obtained from the Second Affiliated Hospital of Guilin Medical University. The institute ethics committee of the Second Affiliated Hospital of Guilin Medical University reviewed those relevant ethical issues in this study that were well considered.

Study Population, Bacterial Isolate Identification, and Drug Susceptibility Testing

This is a prospective surveillance study. Consecutive Klebsiella pneumoniae isolates were collected from unique patients being treated in the Second Affiliated Hospital of Guilin Medical University, Guilin, China (which is a 1,600-bed tertiary-care hospital serving approximately 30,000 in-patients per year) for the period of November 2020–June 2022. In the case of duplicate patient samples, the first collected isolate was chosen. A Luria-Bertani (LB) medium was used to culture all strains. The Klebsiella pneumoniae strains were confirmed by phenotypic tests and 16SrDNA sequencing. Drug susceptibility testing (DST) for the Klebsiella pneumoniae strains was performed using the BD PhoenixTM M50 system following the manufacturer’s instructions. The following 21 drugs were tested: amikacin (AMK), amoxicillin-clavulanic acid (AMC), ampicillin (AMP), ampicillin-sulbactam (SAM), aztreonam (ATM), cefazolin (CFZ), cefepime (FEP), cefotaxime (CTX), ceftazidime (CAZ), chloramphenicol (CHL), ciprofloxacin (CIP), polymyxin (POL), gentamicin (GM), imipenem (IPM), levofloxacin (LVX), meropenem (MEM), moxifloxacin (MXF), piperacillin (PIP), piperacillin-tazobactam (TZP), tetracycline (TE), and compound sulfamethoxazole (SMZ). The ESBLs were detected by the BD PhoenixTM M50 test (which is claimed to be a confirmatory ESBL test). The Escherichia coli strains ATCC25922, Staphylococcus aureus strain ATCC25923, Klebsiella pneumoniae strain ATCC700603 and Pseudomonas aeruginosa strain ATCC27853 were used as quality control strains for the DST. Clinical records of patients from whom the Klebsiella pneumoniae isolates were obtained were reviewed retrospectively.

Genomic DNA extraction

Genomic DNA was extracted using the boiling method. Add 200-500ul ddH₂O, pick the target strains in groups of ten strains, pick colonies from each MH plate in equal amounts, and grind them into a homogeneous suspension in a 1.5mL centrifuge tube. Each 1.5mL centrifuge tube was boiled for 10 min and centrifuged at 13,000g for 10 min. Then it was taken as genomic DNA. (DNA concentrations range from 50ng/ul to 100ng/ul.)

PCR Amplification and Sequencing

Drug resistance-associated genes were detected by supernatant PCR and sequencing using 9 pairs of primers listed in Table1. The primers were synthesized by the Beijing Genomics Institute (BGI, China). PCR was performed in a 20µL reaction mixture consisting of 4µL of ddH₂O, 10µL of Taq DNA polymerase (Takara), 2µL each of the primers, and 2µL of chromosomal DNA. All reaction mixtures were subjected to 35 cycles of 94°C pre-denaturation for 5 min, 94°C denaturation for 1 min, annealing, 72°C extension for 6 min, and 4°C forever. After PCR amplification, the 10µL product was analyzed by 1% agarose gel electrophoresis at 120V for 40 min along with a molecular weight standard. PCR products were purified and sequenced bi-directionally with the same primers used for PCR by the Beijing Genomics Institute (BGI, China). DNA sequences were annotated using the BLAST program at http://www.ncbi.nlm.nih.gov. Homology matching was done by DNAMAN.

Table 1 Primers used for PCR and sequencing of drug resistance-associated genes from Klebsiella pneumoniae isolates

Target genes	Primer sequence (5'to 3)			Amplicon size (bp)			Annealing temperature
	Forward		Reverse				(°C)
bla KPC-2		GATTGGCTAAAGGGAAACACG	GCCATACACTCCGCAGGTT		102bp	54
bla SME-2		AACGGCTTCATTTTTGTTTAG	GCTTCCGCAATAGTTTTATCA		820bp	56
bla NDM-1		TGGACCGATGACCAGACCG	GATCAGGCAGCCACCAAAA		354bp	56
bla IMP-4		GCAGAGCCTTTGCCAGATT	CGTGGGGATGGATTGAGA		288bp	56
bla VIM-1		CAGTCTCCACGCACTTTCA	GCACAACCACCGTATAGCAC		268bp	52
bla OXA-48		GAATGCCTGCGGTAGCAAAG	GGGCGATCAAGCTATTGGGA		192bp	59
bla Ompk-35		ACGGTATCGCACTGTCTG	CCTTGCCTTTGGTCTGTA		276bp	52
bla Ompk-36		GACTCGTCTGGCATTCGC	CGCCGTTCTGTTTCAAGG		314bp	56
bla Ompk-37		TCGGTCTGGTGGAGGGTCT	CTGTCGCTGCTGCGGTTA		106bp	56

Statistical Analysis

The SPSS25.0 software (International Business Machines Corporation) was used for data analysis. Categorical variables were compared with the chi-square test or Fisher’s exact test. A P value of 0.05 was considered to be statistically significant.

Patients' Demographic and Clinical Characteristics

From November 2020 to June 2022, a total of 167 non-repetitive patients at the Second Affiliated Hospital of Guilin Medical University who had Klebsiella pneumoniae isolates were subjected to DST using 21 antibiotics. The proportion of males and females was 64.1% (n = 107) and 35.9% (n = 60), respectively. 91.6% of the patients were Guilin residents, and the rest were from other provinces of China (non-Guilin residents). The median (SD) age of the patients was 6517.724 years (range 1.0–90.0 years). The majority of the patients were from the cerebrovascular ward (41, 24.6%) and the respiratory and critical care ward (26, 15.6%). The main source of the specimens was sputum (83, 49.7%). The detailed information on relevant demographic and clinical characteristics of the study population is summarized in Table 2.

Table 2 Demographic and clinical characteristics of the patients

Characteristics	Total n=167	(%)
Gender
Female	60	35.9
Male	107	64.1
Age group, years
≤40	19	11.4
41~50	11	6.6
51~60	34	20.4
61~70	47	28.1
71~80	38	22.8
≥81	18	10.8
Residence situation
Guilin resident	153	91.6
Non-Guilin resident	14	8.4
Source of specimens
Sputum	83	49.7
Pus	15	9.0
Urine	17	10.2
Wound/trauma/incision secretions	18	10.8
Drainage fluid	6	3.6
Hospital location
Cerebrovascular ward	41	24.6
Respiratory and critical care ward	26	15.6
Intensive care medicine ward	20	12
Hepatobiliary and pancreatic surgery ward	11	6.6
Endocrinology ward	14	8.4
Orthopedic ward	6	3.6
Dermatology ward	5	3.0
Gastrointestinal surgery ward	10	6.0
Cardiovascular medicine ward	3	1.8
Pediatric ward	4	2.4
Other wards	27	16.0

The Drug Susceptibility Patterns of the Klebsiella pneumoniae Isolates

Drug susceptibility testing was conducted for 167 Klebsiella pneumoniae isolates and the detailed information on resistance rates to all tested drugs is listed in Table 3. The highest resistance rate was observed for AMP, reaching 98.2% (n = 167), followed by resistance to TE (36.5%), PIP (36.5%), CHL (35.3%), CFZ (33.5%), SAM (32.3%), SMZ (28.7%), CIP (26.3%), and CTX (25.7%).

Table 3 Statistics of 102 Klebsiella pneumoniae isolates resistance to common clinical antimicrobial drugs

Drugs	Results of DST（%）
	Resistant	Intermediate	Susceptible
Ampicillin (AMP)	98.2	0.6	1.2
Tetracycline (TE)	36.5	1.2	62.3
Piperacillin (PIP)	35.3	4.8	59.9
Chloramphenicol (CHL)	35.3	1.8	62.9
Cefazolin (CFZ)	33.5	0.0	66.5
Ampicillin-sulbactam (SAM)	32.3	9.6	58.1
Compound sulfamethoxazole (SMZ)	28.7	0.0	71.3
Ciprofloxacin (CIP)	26.3	0.0	73.7
Cefotaxime (CTX)	25.7	1.0	73.7
Aztreonam (ATM)	22.8	1.2	76.0
Cefepime (FEP)	22.2	2.4	75.4
Levofloxacin (LVX)	21.6	0.0	78.4
Moxifloxacin (MXF)	21.0	3.0	76.0
Amoxicillin-clavulanic acid (AMC)	20.4	10.2	69.5
Ceftazidime (CAZ)	16.8	1.8	81.4
Gentamicin (GM)	16.8	0.6	82.6
Piperacillin-tazobactam (TZP)	13.2	1.8	85.0
Meropenem (MEM)	7.8	0.0	92.2
Imipenem (IPM)	7.8	0.0	92.2
Amikacin (AMK)	6.6	0.0	93.4
Polymyxin (POL)	1.8	0.0	98.2

The results of the resistant gene of Klebsiella pneumoniae isolate PCR amplification

The 167 Klebsiella pneumoniae strains were PCR amplified with our designed primers separately, and the suspected strains were sent for sequencing. We obtained the results by extensive PCR amplification and agarose gel electrophoresis experiments. 3 strains carried the KPC-2 type, 68 strains were missing membrane pore protein Ompk-35, 12 strains were missing membrane pore protein Ompk-36, 62 strains were missing membrane pore protein Ompk-37, 1 strain was detected carrying NDM-1, and no VIM-1, IMP-4, or OXA-48. Some electrophoresis results are shown in Figure 1. The result maps sent for sequencing provided some confidence in the agarose electrophoresis results. Homologous sequence comparison can establish a more accurate comparison and lay the foundation for subsequent phenotype prediction and analysis.

Lanes:1, DNA maker(100 bp ladder)(ComWin Biotech Co., Ltd); 2-3, binding product of parental donor strain and primer KPC-2(102 bp); 4-11, parental donor strain and primer Ompk-35 (276 bp); 12-13, parental donor strain and primer Ompk-36 (314 bp); 14-15, parental donor strain and primer Ompk-37 (106 bp); 16-17, parental donor strain and primer NDM-1 (354 bp); 18-19, parental donor strain and primer SME-2 (820 bp); 22-23, parental donor strain and primer SME-2 (820 bp); 20-21, Binding product of parental donor strain and primer VIM-1 (268 bp); 22-23, Binding product of parental donor strain and primer OXA-48(192 bp); 24-25, Binding product of parental donor strain and primer IMP-4(288 bp).

Homology analysis

We performed a multiple sequence comparison with DNAMAN (Version 6, Lynnon Biosoft) and obtained the following results, which are consistent with our conclusions. We find the bases of the target fragment based on the sequences of the upstream and downstream primers we designed at https://card.mcmaster.ca/home and put the base sequence of the target fragment into a new text file. In DNAMAN, the sequencing result files are compared with the text of the target fragment. % Identity refers to the number of identical residues at corresponding positions in the same comparison length of two base sequences or two amino acid sequences as a percentage of the total length. The peak graph file in the sequencing results sent by the sequencing company is opened with Chromas (Version 2.22, Technolysium Pty Ltd), and the four colored waveforms represent the signal intensity of the four bases. In a normal peak map, the peaks and troughs are clear, and the distance between peaks is even. A more ideal sequence result should have no spurious peak interference at the bottom. The first few tens of bp of sequencing results are less reliable, and this part needs to be removed first when splicing sequences or performing sequence comparison to avoid affecting the analysis results. Due to the large number of specimens and financial constraints, the specimens we sent for sequencing were selected from those suspected of containing drug resistance genes. The sequence comparison plots and peak plots of KPC-2, NDM-1, Ompk-35, Ompk-36, and Ompk-37 are shown in Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6.

Klebsiella pneumoniae, one of the three major enterobacteria, is one of the important causative agents of clinical isolation and hospital infections ^[27], with a complex mechanism of drug resistance and different molecular epidemiological characteristics in different regions and countries. Several studies have shown that the main mechanism of Klebsiella pneumoniae resistance to carbapenem antibiotics is carbapenem production ^{[28, 29]}. NDM-1 was first identified in multidrug-resistant Klebsiella pneumoniae in 2009, followed by successive reports of infections caused by carriage of the blaNDM-1 pathogen in several countries ^[30–34], including China. BlaNDM-1 is mainly transmitted by plasmids and can be transmitted between different genera ^[35]. Carriage rates are high in E. coli and relatively low in carbapenem-resistant Klebsiella pneumoniae (CRKP). The carriage rate of blaNDM-1 in this study was 0.6%. This shows that CRKP carrying blaNDM-1 is not prevalent in hospitals.

Deletion of the pore membrane protein-encoding genes blaOmpk-35 and blaOmpk-36 combined with the detection of other carbapenem genes may also lead to an increase in carbapenem antibacterial resistance. In non-carbapenem-producing Klebsiella pneumoniae, deletion of blaOmpk-35 combined with blaOmpk-36 producing ESBL has an important role in the development of carbapenem resistance in Klebsiella pneumoniae ^[36–39]. Klebsiella pneumoniae in this study also involved the resistance mechanisms of pore membrane protein genes blaOmpk-35, blaOmpk-36, and blaOmpk-37 deletion, of which blaOmpk-35 deletion was predominant.

The rate of KPC enzyme production by Klebsiella pneumoniae in China is 20–50%, and there are several reports about KPC-type carbapenems or metalloid-ß-lactamase production by Klebsiella pneumoniae in China. KPC enzymes can hydrolyze broad-spectrum cephalosporins ^[40], of which the KPC-2 type is more commonly reported. In the present study, KPC-2 producing carbapenems was an important mechanism of CRKP resistance. This is generally consistent with our previous reports ^[41–43]. It has been reported in China that patients with isolated cultures of KPC-type carbapenem-producing Enterobacteriaceae had a history of prior carbapenem antibiotic application. Overseas reports have also shown that the use of carbapenems is an independent risk factor for carbapenem-resistant Klebsiella pneumoniae infections ^{[44, 45]}. This requires us to standardize and rationalize the use of antibiotics, strengthen supervision, and eliminate antibiotic abuse. For broad-spectrum antibiotics such as carbapenems, clinical management should be strengthened and clinical guidelines for antibiotic use should be strictly followed to reduce the production of drug-resistant bacteria. This experiment also revealed that a certain proportion of strains carry the drug resistance gene KPC-2 combined with a mutational deletion of the pore membrane protein Ompk-35, Ompk-36, and Ompk-37.

In summary, our Klebsiella pneumoniae isolates had high resistance to -lactams and penicillin, moderate resistance to quinolones, and showed high sensitivity to aminoglycosides, and amikacin could be considered as its preferred therapeutic agent. Carrying the resistance gene KPC-2 and the deletion of the membrane pore protein Ompk35 and Ompk-37 mutations were important causes of CRKP resistance in our infection. It is important that we continue to monitor the sensitivity to carbapenems as the sensitivity to these antibiotics is trending downward year by year.

Ethical Approval and Consent to Participate

Written consent was given by the patients for their information to be stored in the hospital database and used for research. Permission to use the information in the medical records of the patients for research purposes was obtained from the Second Affiliated Hospital of Guilin Medical University. The institute ethics committee of the Second Affiliated Hospital of Guilin Medical University reviewed those relevant ethical issues in this study that were well considered.

Consent for publication

All authors approved the manuscript and this submission.

Availability of data and materials

All data generated or analysed during this study is included in this published article and its supplementary information files.

Competing interests

The authors declare that no conflicts of interest exist.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 81860078) and the Science and Technology Plan Project of Guilin (Grant No. 20210227-8-3).

Authors' contributions

CD Wei, HX Liang, GF Zeng, XF Huang, CD Wei, and HY Chen developed the methodology. Data acquisition: CD Wei, HY Chen, ZY Liu, LJ Xiong, D Wang, S Mo, XF Huang; Analysis and interpretation of data (e.g., statistical analysis, computational analysis): CD Wei, ZY Liu, CD Wei, HY Chen, and XF Huang wrote the manuscript, reviewed it, and/or revised it; CD Wei, HY Chen, and XF Huang oversaw the study. Authors Chuandong Wei and Huoying Chen contributed equally to this manuscript.

Acknowledgements

The authors would like to thank the microbiology laboratory staff who retained the specimens.

Liu, P.; Li, P.; Jiang, X.; Bi, D.; Xie, Y.; Tai, C.; Deng, Z.; Rajakumar, K.; Ou, H. Y., Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae HS11286, a multidrug-resistant strain isolated from human sputum. J Bacteriol 2012, 194 (7), 1841–2.DOI: 10.1128/JB.00043-12. https://doi.org/10.1128/JB.00043-12.
Kus, H.; Arslan, U.; Turk Dagi, H.; Findik, D., [Investigation of various virulence factors of Klebsiella pneumoniae strains isolated from nosocomial infections]. Mikrobiyoloji bulteni 2017, 51 (4), 329–339.DOI: 10.5578/mb.59716. https://doi.org/10.5578/mb.59716.
Becker, L.; Kaase, M.; Pfeifer, Y.; Fuchs, S.; Reuss, A.; von Laer, A.; Sin, M. A.; Korte-Berwanger, M.; Gatermann, S.; Werner, G., Genome-based analysis of Carbapenemase-producing Klebsiella pneumoniae isolates from German hospital patients, 2008–2014. Antimicrob Resist Infect Control 2018, 7, 62.DOI: 10.1186/s13756-018-0352-y. https://doi.org/10.1186/s13756-018-0352-y.
Wyres, K. L.; Lam, M. M. C.; Holt, K. E., Population genomics of Klebsiella pneumoniae. Nat Rev Microbiol 2020, 18 (6), 344–359.DOI: 10.1038/s41579-019-0315-1. https://doi.org/10.1038/s41579-019-0315-1.
Wang, G.; Zhao, G.; Chao, X.; Xie, L.; Wang, H., The Characteristic of Virulence, Biofilm and Antibiotic Resistance of Klebsiella pneumoniae. Int J Environ Res Public Health 2020, 17 (17).DOI: 10.3390/ijerph17176278. https://doi.org/10.3390/ijerph17176278.
Moradigaravand, D.; Martin, V.; Peacock, S. J.; Parkhill, J., Evolution and Epidemiology of Multidrug-Resistant Klebsiella pneumoniae in the United Kingdom and Ireland. mBio 2017, 8 (1).DOI: 10.1128/mBio.01976-16. https://doi.org/10.1128/mBio.01976-16.
Zhang, S.; Yang, Z.; Sun, L.; Wang, Z.; Sun, L.; Xu, J.; Zeng, L.; Sun, T., Clinical Observation and Prognostic Analysis of Patients With Klebsiella pneumoniae Bloodstream Infection. Front Cell Infect Microbiol 2020, 10, 577244.DOI: 10.3389/fcimb.2020.577244. https://doi.org/10.3389/fcimb.2020.577244.
Weng, B.; Zhang, X.; Hong, W.; Yan, C.; Gong, X.; Cai, C., A Case of Sepsis Due to Carbapenem-Resistant Klebsiella pneumoniae in an Extremely Low-Birth Weight Infant Treated with Trimethoprim-Sulfamethoxazole. Infect Drug Resist 2021, 14, 2321–2325.DOI: 10.2147/IDR.S312183. https://doi.org/10.2147/IDR.S312183.
Lu, Q.; Zhu, H. H.; Li, G. H.; Qi, T. T.; Ye, L. J.; Teng, X. Q.; Qu, Q.; He, G. F.; Qu, J., A Comparative Study of the Microbiological Efficacy of Polymyxin B on Different Carbapenem-Resistant Gram-Negative Bacteria Infections. Front Med (Lausanne) 2021, 8, 620885.DOI: 10.3389/fmed.2021.620885. https://doi.org/10.3389/fmed.2021.620885.
Yang, X.; Qi, Y.; Li, G.; Wang, Y.; Lou, Z.; Jiang, Y., Characterization of the genetic environment of blaKPC in Escherichia coli isolates from hospitals in China. FEMS Microbiol Lett 2020, 367 (11).DOI: 10.1093/femsle/fnaa064. https://doi.org/10.1093/femsle/fnaa064.
van Duin, D.; Paterson, D. L., Multidrug-Resistant Bacteria in the Community: Trends and Lessons Learned. Infect Dis Clin North Am 2016, 30 (2), 377–390.DOI: 10.1016/j.idc.2016.02.004. https://doi.org/10.1016/j.idc.2016.02.004.
Khatri, A.; Naeger Murphy, N.; Wiest, P.; Osborn, M.; Garber, K.; Hecker, M.; Hurless, K.; Rudin, S. D.; Jacobs, M. R.; Kalayjian, R. C.; Salata, R. A.; van Duin, D.; Perez, F.; Bonomo, R. A.; Paterson, D. L.; Harris, P. N., Community-Acquired Pyelonephritis in Pregnancy Caused by KPC-Producing Klebsiella pneumoniae. Antimicrob Agents Chemother 2015, 59 (8), 4375–8.DOI: 10.1128/AAC.00553-15. https://doi.org/10.1128/AAC.00553-15.
Ernst, C. M.; Braxton, J. R.; Rodriguez-Osorio, C. A.; Zagieboylo, A. P.; Li, L.; Pironti, A.; Manson, A. L.; Nair, A. V.; Benson, M.; Cummins, K.; Clatworthy, A. E.; Earl, A. M.; Cosimi, L. A.; Hung, D. T., Adaptive evolution of virulence and persistence in carbapenem-resistant Klebsiella pneumoniae. Nat Med 2020, 26 (5), 705–711.DOI: 10.1038/s41591-020-0825-4. https://doi.org/10.1038/s41591-020-0825-4.
David, S.; Reuter, S.; Harris, S. R.; Glasner, C.; Feltwell, T.; Argimon, S.; Abudahab, K.; Goater, R.; Giani, T.; Errico, G.; Aspbury, M.; Sjunnebo, S.; Eu, S. W. G.; Group, E. S.; Feil, E. J.; Rossolini, G. M.; Aanensen, D. M.; Grundmann, H., Epidemic of carbapenem-resistant Klebsiella pneumoniae in Europe is driven by nosocomial spread. Nat Microbiol 2019, 4 (11), 1919–1929.DOI: 10.1038/s41564-019-0492-8. https://doi.org/10.1038/s41564-019-0492-8.
Jain, A.; Utley, L.; Parr, T. R.; Zabawa, T.; Pucci, M. J., Tebipenem, the first oral carbapenem antibiotic. Expert Rev Anti Infect Ther 2018, 16 (7), 513–522.DOI: 10.1080/14787210.2018.1496821. https://doi.org/10.1080/14787210.2018.1496821.
Nicolau, D. P., Carbapenems: a potent class of antibiotics. Expert Opin Pharmacother 2008, 9 (1), 23–37.DOI: 10.1517/14656566.9.1.23. https://doi.org/10.1517/14656566.9.1.23.
Kattan, J. N.; Villegas, M. V.; Quinn, J. P., New developments in carbapenems. Clin Microbiol Infect 2008, 14 (12), 1102–11.DOI: 10.1111/j.1469-0691.2008.02101.x. https://doi.org/10.1111/j.1469-0691.2008.02101.x.
Baughman, R. P., The use of carbapenems in the treatment of serious infections. J Intensive Care Med 2009, 24 (4), 230 – 41.DOI: 10.1177/0885066609335660. https://doi.org/10.1177/0885066609335660.
Hu, F.; Zhu, D.; Wang, F.; Wang, M., Current Status and Trends of Antibacterial Resistance in China. Clin Infect Dis 2018, 67 (suppl_2), S128-S134.DOI: 10.1093/cid/ciy657. https://doi.org/10.1093/cid/ciy657.
Zhanel, G. G.; Lawrence, C. K.; Adam, H.; Schweizer, F.; Zelenitsky, S.; Zhanel, M.; Lagace-Wiens, P. R. S.; Walkty, A.; Denisuik, A.; Golden, A.; Gin, A. S.; Hoban, D. J.; Lynch, J. P., 3rd; Karlowsky, J. A., Imipenem-Relebactam and Meropenem-Vaborbactam: Two Novel Carbapenem-beta-Lactamase Inhibitor Combinations. Drugs 2018, 78 (1), 65–98.DOI: 10.1007/s40265-017-0851-9. https://doi.org/10.1007/s40265-017-0851-9.
Suay-Garcia, B.; Perez-Gracia, M. T., Present and Future of Carbapenem-resistant Enterobacteriaceae (CRE) Infections. Antibiotics (Basel) 2019, 8 (3).DOI: 10.3390/antibiotics8030122. https://doi.org/10.3390/antibiotics8030122.
Garcia-Betancur, J. C.; Appel, T. M.; Esparza, G.; Gales, A. C.; Levy-Hara, G.; Cornistein, W.; Vega, S.; Nunez, D.; Cuellar, L.; Bavestrello, L.; Castaneda-Mendez, P. F.; Villalobos-Vindas, J. M.; Villegas, M. V., Update on the epidemiology of carbapenemases in Latin America and the Caribbean. Expert Rev Anti Infect Ther 2021, 19 (2), 197–213.DOI: 10.1080/14787210.2020.1813023. https://doi.org/10.1080/14787210.2020.1813023.
Tilahun, M.; Kassa, Y.; Gedefie, A.; Ashagire, M., Emerging Carbapenem-Resistant Enterobacteriaceae Infection, Its Epidemiology and Novel Treatment Options: A Review. Infect Drug Resist 2021, 14, 4363–4374.DOI: 10.2147/IDR.S337611. https://doi.org/10.2147/IDR.S337611.
Both, A.; Buttner, H.; Huang, J.; Perbandt, M.; Belmar Campos, C.; Christner, M.; Maurer, F. P.; Kluge, S.; Konig, C.; Aepfelbacher, M.; Wichmann, D.; Rohde, H., Emergence of ceftazidime/avibactam non-susceptibility in an MDR Klebsiella pneumoniae isolate. J Antimicrob Chemother 2017, 72 (9), 2483–2488.DOI: 10.1093/jac/dkx179. https://doi.org/10.1093/jac/dkx179.
Papagiannitsis, C. C.; Giakkoupi, P.; Kotsakis, S. D.; Tzelepi, E.; Tzouvelekis, L. S.; Vatopoulos, A. C.; Miriagou, V., OmpK35 and OmpK36 porin variants associated with specific sequence types of Klebsiella pneumoniae. J Chemother 2013, 25 (4), 250–4.DOI: 10.1179/1973947813Y.0000000075. https://doi.org/10.1179/1973947813Y.0000000075.
Venditti, C.; Butera, O.; Proia, A.; Rigacci, L.; Mariani, B.; Parisi, G.; Messina, F.; Capone, A.; Nisii, C.; Di Caro, A., Reduced Susceptibility to Carbapenems in a Klebsiella pneumoniae Clinical Isolate Producing SCO-1 and CTX-M-15 beta-Lactamases Together with OmpK35 and OmpK36 Porin Deficiency. Antimicrob Agents Chemother 2020, 64 (8).DOI: 10.1128/AAC.00556-20. https://doi.org/10.1128/AAC.00556-20.
Orsi, G. B.; Bencardino, A.; Vena, A.; Carattoli, A.; Venditti, C.; Falcone, M.; Giordano, A.; Venditti, M., Patient risk factors for outer membrane permeability and KPC-producing carbapenem-resistant Klebsiella pneumoniae isolation: results of a double case-control study. Infection 2013, 41 (1), 61–7.DOI: 10.1007/s15010-012-0354-2. https://doi.org/10.1007/s15010-012-0354-2.
Correa, L.; Martino, M. D.; Siqueira, I.; Pasternak, J.; Gales, A. C.; Silva, C. V.; Camargo, T. Z.; Scherer, P. F.; Marra, A. R., A hospital-based matched case-control study to identify clinical outcome and risk factors associated with carbapenem-resistant Klebsiella pneumoniae infection. BMC Infect Dis 2013, 13, 80.DOI: 10.1186/1471-2334-13-80. https://doi.org/10.1186/1471-2334-13-80.
Zulfiqar, S.; Shakoori, A. R., Molecular characterization, metal uptake and copper induced transcriptional activation of efflux determinants in copper resistant isolates of Klebsiella pneumoniae. Gene 2012, 510 (1), 32–8.DOI: 10.1016/j.gene.2012.08.035. https://doi.org/10.1016/j.gene.2012.08.035.
Poirel, L.; Schrenzel, J.; Cherkaoui, A.; Bernabeu, S.; Renzi, G.; Nordmann, P., Molecular analysis of NDM-1-producing enterobacterial isolates from Geneva, Switzerland. J Antimicrob Chemother 2011, 66 (8), 1730–3.DOI: 10.1093/jac/dkr174. https://doi.org/10.1093/jac/dkr174.
Savard, P.; Gopinath, R.; Zhu, W.; Kitchel, B.; Rasheed, J. K.; Tekle, T.; Roberts, A.; Ross, T.; Razeq, J.; Landrum, B. M.; Wilson, L. E.; Limbago, B.; Perl, T. M.; Carroll, K. C., First NDM-positive Salmonella sp. strain identified in the United States. Antimicrob Agents Chemother 2011, 55 (12), 5957–8.DOI: 10.1128/AAC.05719-11. https://doi.org/10.1128/AAC.05719-11.
Lowman, W.; Sriruttan, C.; Nana, T.; Bosman, N.; Duse, A.; Venturas, J.; Clay, C.; Coetzee, J., NDM-1 has arrived: first report of a carbapenem resistance mechanism in South Africa. S Afr Med J 2011, 101 (12), 873–5
Kus, J. V.; Tadros, M.; Simor, A.; Low, D. E.; McGeer, A. J.; Willey, B. M.; Larocque, C.; Pike, K.; Edwards, I. A.; Dedier, H.; Melano, R.; Boyd, D. A.; Mulvey, M. R.; Louie, L.; Okeahialam, C.; Bayley, M.; Whitehead, C.; Richardson, D.; Carr, L.; Jinnah, F.; Poutanen, S. M., New Delhi metallo-beta-lactamase-1: local acquisition in Ontario, Canada, and challenges in detection. CMAJ 2011, 183 (11), 1257–61.DOI: 10.1503/cmaj.110477. https://doi.org/10.1503/cmaj.110477.
Kusradze, I.; Diene, S. M.; Goderdzishvili, M.; Rolain, J. M., Molecular detection of OXA carbapenemase genes in multidrug-resistant Acinetobacter baumannii isolates from Iraq and Georgia. Int J Antimicrob Agents 2011, 38 (2), 164–8.DOI: 10.1016/j.ijantimicag.2011.03.021. https://doi.org/10.1016/j.ijantimicag.2011.03.021.
Campos, J. C.; da Silva, M. J.; dos Santos, P. R.; Barros, E. M.; Pereira Mde, O.; Seco, B. M.; Magagnin, C. M.; Leiroz, L. K.; de Oliveira, T. G.; de Faria-Junior, C.; Cerdeira, L. T.; Barth, A. L.; Sampaio, S. C.; Zavascki, A. P.; Poirel, L.; Sampaio, J. L., Characterization of Tn3000, a Transposon Responsible for blaNDM-1 Dissemination among Enterobacteriaceae in Brazil, Nepal, Morocco, and India. Antimicrob Agents Chemother 2015, 59 (12), 7387–95.DOI: 10.1128/AAC.01458-15. https://doi.org/10.1128/AAC.01458-15.
Tsai, Y. K.; Fung, C. P.; Lin, J. C.; Chen, J. H.; Chang, F. Y.; Chen, T. L.; Siu, L. K., Klebsiella pneumoniae outer membrane porins OmpK35 and OmpK36 play roles in both antimicrobial resistance and virulence. Antimicrob Agents Chemother 2011, 55 (4), 1485–93.DOI: 10.1128/AAC.01275-10. https://doi.org/10.1128/AAC.01275-10.
Sugawara, E.; Kojima, S.; Nikaido, H., Klebsiella pneumoniae Major Porins OmpK35 and OmpK36 Allow More Efficient Diffusion of beta-Lactams than Their Escherichia coli Homologs OmpF and OmpC. J Bacteriol 2016, 198 (23), 3200–3208.DOI: 10.1128/JB.00590-16. https://doi.org/10.1128/JB.00590-16.
Zhang, Y.; Jiang, X.; Wang, Y.; Li, G.; Tian, Y.; Liu, H.; Ai, F.; Ma, Y.; Wang, B.; Ruan, F.; Rajakumar, K., Contribution of beta-lactamases and porin proteins OmpK35 and OmpK36 to carbapenem resistance in clinical isolates of KPC-2-producing Klebsiella pneumoniae. Antimicrob Agents Chemother 2014, 58 (2), 1214–7.DOI: 10.1128/AAC.02045-12. https://doi.org/10.1128/AAC.02045-12.
Venditti, C.; Butera, O.; Meledandri, M.; Balice, M. P.; Cocciolillo, G. C.; Fontana, C.; D'Arezzo, S.; De Giuli, C.; Antonini, M.; Capone, A.; Messina, F.; Nisii, C.; Di Caro, A., Molecular analysis of clinical isolates of ceftazidime-avibactam-resistant Klebsiella pneumoniae. Clin Microbiol Infect 2021, 27 (7), 1040 e1-1040 e6.DOI: 10.1016/j.cmi.2021.03.001. https://doi.org/10.1016/j.cmi.2021.03.001.
Chew, K. L.; Lin, R. T. P.; Teo, J. W. P., Klebsiella pneumoniae in Singapore: Hypervirulent Infections and the Carbapenemase Threat. Front Cell Infect Microbiol 2017, 7, 515.DOI: 10.3389/fcimb.2017.00515. https://doi.org/10.3389/fcimb.2017.00515.
Gu, B.; Bi, R.; Cao, X.; Qian, H.; Hu, R.; Ma, P., Clonal dissemination of KPC-2-producing Klebsiella pneumoniae ST11 and ST48 clone among multiple departments in a tertiary teaching hospital in Jiangsu Province, China. Ann Transl Med 2019, 7 (23), 716.DOI: 10.21037/atm.2019.12.01. https://doi.org/10.21037/atm.2019.12.01.
Yu, X.; Zhang, W.; Zhao, Z.; Ye, C.; Zhou, S.; Wu, S.; Han, L.; Han, Z.; Ye, H., Molecular characterization of carbapenem-resistant Klebsiella pneumoniae isolates with focus on antimicrobial resistance. BMC Genomics 2019, 20 (1), 822.DOI: 10.1186/s12864-019-6225-9. https://doi.org/10.1186/s12864-019-6225-9.
Zhang, P.; Shi, Q.; Hu, H.; Hong, B.; Wu, X.; Du, X.; Akova, M.; Yu, Y., Emergence of ceftazidime/avibactam resistance in carbapenem-resistant Klebsiella pneumoniae in China. Clin Microbiol Infect 2020, 26 (1), 124 e1-124 e4.DOI: 10.1016/j.cmi.2019.08.020. https://doi.org/10.1016/j.cmi.2019.08.020.
Barchiesi, F.; Montalti, R.; Castelli, P.; Nicolini, D.; Staffolani, S.; Mocchegiani, F.; Fiorentini, A.; Manso, E.; Vivarelli, M., Carbapenem-Resistant Klebsiella pneumoniae influences the outcome of early infections in liver transplant recipients. BMC Infect Dis 2016, 16 (1), 538.DOI: 10.1186/s12879-016-1876-5. https://doi.org/10.1186/s12879-016-1876-5.
Di Domenico, E. G.; Cavallo, I.; Sivori, F.; Marchesi, F.; Prignano, G.; Pimpinelli, F.; Sperduti, I.; Pelagalli, L.; Di Salvo, F.; Celesti, I.; Paluzzi, S.; Pronesti, C.; Koudriavtseva, T.; Ascenzioni, F.; Toma, L.; De Luca, A.; Mengarelli, A.; Ensoli, F., Biofilm Production by Carbapenem-Resistant Klebsiella pneumoniae Significantly Increases the Risk of Death in Oncological Patients. Front Cell Infect Microbiol 2020, 10, 561741.DOI: 10.3389/fcimb.2020.561741. https://doi.org/10.3389/fcimb.2020.561741.

No competing interests reported.

supportfigures.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Analysis of Drug Resistance Genotype and Distribution in Klebsiella pneumoniae Isolates from a Tertiary-Care Hospital in Guilin, China

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusions

Figures

Introduction

Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1