CNTNAP2 Associated Neurodevelopmental Disorders: Intellectual Disability and Epilepsy comorbidity in Pakistani population.

Abstract

• Background:

The genetics of neurodevelopmental disorders is partially investigated due to the multiple additive risk factors found to be involved. Emergence of individual genes implicated across multiple diseases suggests that they might share similar underlying driving pathways. The CNTNAP2 gene is an excellent presentation, that has been found in a variety of phenotypes. The role of CNTNAP2 is implicated in a vast number of neural and genetic networks of neurodevelopment which leads to the understanding of regulation and function of this gene. The diverse roles of CNTNAP2 can enhance our understanding of how combinations of individual genetic risk factors can contribute to the complexity of neurodevelopmental disorders.

• Methods:

The present study aims to investigate the role of CNTNAP2 polymorphism as a risk factor for comorbidity of Intellectual Disability and epilepsy in Pakistani population. 170 patients and 175 healthy controls took part in this study from different areas of Pakistan. Genotyping using Tetra-primer ARMS PCR technique was conducted to investigate the association between rs147815978 (G/T) and rs2710102 (A/G) of CNTNAP2 gene and intellectual disability and epilepsy co-occurrence in patients of different age groups.

• Results:

The genotyping data was analysed to trace the effect of CNTNAP2 polymorphism on the comorbidity of ID and EPI diseases in study participants. Probability values less than 0.05 were considered significant for the association of CNTNAP2 rs147815978 and rs2710102. Results suggested a probable role of CNTNAP2 gene polymorphism predisposition to comorbidity of neurodevelopmental disorders in Pakistani population.

• Conclusion:

CNTNAP2 polymorphisms have a significant role in co-occurrence of NDDs due to the underlying shared molecular mechanisms causing neurodevelopment.

• Trial Registration:

Not Applicable for this study. Ethical approval from Ethical Review Committee of Department of Biosciences, Comsats University Islamabad campus was obtained prior to conduction of all procedures.

Introduction:

Neurodevelopmental disorders have clinically diverse and genetically heterogeneous characteristics.(Aspromonte et al. 2019). Collection of severe neurological and neuropsychiatric conditions manifested during childhood and persisting throughout life, are diagnostic parameters for NDD phenotypes. De novo or inherited mutations have been found to play a substantial causal role in the development of these diseases. Combined, NDDs are thought to affect 2–5% of population. (López-Rivera et al. 2020) Comorbidity of these NDDs is a reason to show shared genetic switches that lead to dysfunctional pathways and etiology of NDDs. Patients with ID exhibit increased risk of potentially co-occurring developmental conditions, such as autism spectrum disorders, epilepsy, stereotypic movement disorders, and motor disorders, which substantially affect daily living and well‐being.(Aspromonte et al. 2019). Many studies have suggested that shared molecular pathways could account for the multiple clinical signs that characterize NDDs. An increasing number of patients are reported to harbour dual molecular diagnoses of ID, ASD, and epilepsy. Joint occurrence of two or more of these disorders is often seen. Mutations in these patients can be inherited from one or both parents, which shows genetic factors responsible for the onset of the disease (Parenti et al. 2020). Potential role of CNTNAP2 gene and its polymorphisms is widely traced out in neural development pathways. The Contactin-associated protein-like 2 gene consists of 24 exons with 2.3 Mb size at chromosome 7q35 being the largest gene in human genome.(Rodenas-Cuadrado, Ho, and Vernes 2014). It functions as cell adhesion molecule in activities like migration of neural cells, ramification of dendrites, and transmission of nerve impulse across synapse.(Falsa Perla et al. 2020) Genetic mutations that affect alleles of the CNTNAP2 gene lead to the severity of the phenotypes, characterized by profound Intellectual disability, Epilepsy, language difficulties and autistic traits.(Toma et al. 2018a). CNTNAP2 gene variants express CASPR2 protein, which plays its role in cell adhesive mechanisms in nervous development, synaptic functions and developmental and psychiatric disorders. (Falsa Perla et al. 2020). CNTNAP2 gene is related to the development of neural circuits. CASPR2 clusters K + channels at the nodes of Ranvier in myelinated axons and causes migration and organization of neuronal cells. (Zare, Mashayekhi, and Bidabadi 2017) Earlier findings have suggested that SNPs in the CNTNAP2 gene may be used as genetic markers for predisposition to comorbidities of Intellectual disability and epilepsy. The single-nucleotide polymorphism of CNTNAP2 is suggested to contribute to epileptic seizures and intellectual disabilities.(Shiota et al. 2021) Current literature on the frequencies of these polymorphisms in different populations and their relation with co-occurrence of intellectual disability and epilepsy is still unclear. Therefore, the biological role of the CNTNAP2 gene in neurodevelopmental disorders is currently a study focus area. In this context, the preliminary results of a case-control study are presented here which is performed to investigate effect of CNTNAP2 gene polymorphisms rs147815978 (G/T) and rs2710102 (A/G), for the first time in Pakistani population, affected with Intellectual disability and/or epilepsy. This study suggests that shared molecular pathways of CNTNAP2 gene function can be susceptible mechanisms for co-occurrence of various NDDs.

Materials And Methods:

• Study Participants:

A total of 170 patients with Intellectual Disability and epilepsy and 175 healthy controls were recruited at different hospitals and clinics of Rawalpindi between December 2017 and November 2019. Online calculator was used to calculate the sample size. (http://www.calculator.net/sample-size-calculator.html; World Health Organization (WHO) protocol). All patients were diagnosed and interviewed by neurologic clinicians. Patients were categorised into two categories. Children aged 13 years and less diagnosed with epilepsy and/or intellectual disability and adults aged 18 years above diagnosed with epilepsy and/or intellectual disability were included. Patients without a clear diagnosis of epilepsy and/or intellectual disability were excluded. The exclusion criteria included seizure frequency, hypoxia, prenatal infection, trauma, and accidental diseases. Only an individual without any other nervous system diseases and is with developmental retardation, or family history of intellectual disability and/or epilepsy was eligible for inclusion in the control group. The procedures of this study were approved by the department of Biosciences, Comsats University Islamabad Ethics Committee. Written informed consent was obtained from all guardians of the participants in the study. The clinical information of cases including gender, age, age at onset, disease diagnosis, family history of ID and epilepsy, perinatal and neonatal complications, neurologic and developmental conditions, associated disorders, affected siblings were collected. Participants missing the above-mentioned clinical data were excluded from this study. The participants (n = 170) were further grouped into three categories based on clinical diagnosis: ID only (n = 74), ID with EPI (n = 52), EPI only (n = 44) The neurologic comorbidities included cerebral palsy, microcephaly, Down’s syndrome, anxiety, insomnia, and seizures. Moody or fixed behaviour, interests, and activities stand for impairment in interaction and communication with other individuals. Qualitative assessment of these characteristics was compared to mental age. The developmental comorbidities in this study included speech disorders, dyslexia, delayed development, ADHD, and ASD.

• SNP Selection and Genotyping:

The phenol chloroform technique was used to extract genomic DNA from two millilitres of peripheral blood collected in EDTA tubes (Huang et al., 2015). Two single nucleotide polymorphisms rs147815978 and rs2710102 in CNTNAP2 were targeted and selected by in silico analysis. Primers were designed by the online tool primer3 for tetra primers-amplification refractory mutation system polymerase chain reaction ARMS-PCR. Genotyping of all polymorphisms was conducted using primers of CNTNAP2 rs147815978 and rs2710102 shown in Table 1. The genotyping in 170 individuals with disease as well as their healthy and normal controls was done using the tetra primers-amplification refractory mutation system-PCR method to amplify the targeted SNP regions.

• Primer Designing:

Table 1:

Sequences of primers used for genotyping.

CNTNAP2rs2710102

Forward inner primer (A allele):                Melting temperature

476 GCCTTTTTGTTTTTCCTTCTTTCGCA 501                      67

Reverse inner primer (G allele):

529 CCGATTGGTTAACATTTACTCTGAGAACC 501                   65

Forward outer primer (5' - 3'):

245 GAAAAAAGTGGTAGCCAGTCAGGTTAGC 272                    66

Reverse outer primer (5' - 3'):

722 AGGGCACAAAATGGATGAGTGATAGAAT 695                    66

Product size for A allele: 248

Product size for G allele: 285

Product size of two outer primers: 478

CNTNAP2rs147815978

Forward inner primer (G allele):                Melting temperature

475 GTCTCCTGGTCTTCAGTCACTTTGTGG 501                     67

Reverse inner primer (T allele):

526 TCAATCTCCACATTGCCCAAATTGTA 501                      67

Forward outer primer (5' - 3'):

345 AGCTTTTCTTGTGTGGAACCCTATACGG 372                    67

Reverse outer primer (5' - 3'):

674 CCAAACAAAGCACAACATTAACTCTGGA 647                    67

Product size for G allele: 201

Product size for T allele: 182

Product size of two outer primers: 330

• Statistical Analysis:

Data were expressed for CNTNAP2 rs147815978 and rs2710102 as dominant, heterozygous, and recessive categories for patients and controls based on their comorbidity with intellectual disability and epilepsy. Demographic variables were ethnicity, age group, gender, and other associated diseases. Percentage of variables was calculated for demographic data. (Table 2). Statistical analyses were performed using GraphPad prism software. Odds ratio (OR) was calculated for 95% Cl for CNTNAP2 polymorphisms rs147815978 (alleles GG, GT, and TT) and for rs2710102 (alleles AA, AG, and GG). P-values less than 0.05 were statistically significant. The differences in frequency distributions of genotypes between controls and cases and between patients with and without neurologic and developmental comorbidities were assessed by chi-square test. Association of the targeted SNPs with comorbidity of ID and EPI was calculated and the difference in frequencies of genotypes between patients and control group were analysed by chi-square test for categorical data. The chi-square test was used to assess the deviation from Hardy–Weinberg equilibrium. P-values less than 0.05 were statistically significant. Analysis of variance (ANOVA) was performed to evaluate the significance of difference between the means of both the SNPs in case and control groups for CNTNAP2 gene. 

Results:

The present study evaluated 170 patients and 175 healthy controls for CNTNAP2 polymorphisms. (Figure 1) The result of this study suggests that rs147815978 and rs2710102 polymorphisms were associated significantly with ID and epilepsy comorbidity. Genotypes and allele frequencies with Odds ratio (95% Cl) and P (p < 0.05) values of comorbidity of case and control groups are presented in (Table 3). Significant distribution was seen between case and control genotypes with OR (95% Cl) GG, AA (0.0052), GT, AG (0.0053), and TT, GG (0.0001) for rs147815978 and rs7794745 polymorphism, respectively. A chi-square test was applied to compare the overall frequencies of SNP genotypes between ID and EPI comorbid case and the control group, as well as to verify whether the genotype distributions were in Hardy-Weinberg equilibrium. Significant values of chi-square show the difference between case and control groups, which further confirms that both the SNPs of CNTNAP2 are associated with disease comorbidity. (Table 4) The ANOVA test was used to detect differences in the distribution of genotypes (between cases and controls) in both the SNPs of the CNTNAP2 gene. (Tables 5 and 6) Results showed that the mean values for case and control groups are significantly different and both the SNPs of CNTNAP2 gene polymorphisms are associated with ID and epilepsy comorbidity. (Figure2 and Figure3).

Table 2: 

1. Demographic information for study participants with ID and/or EPI symptoms.

2. Clinical information for study participants with ID and/or EPI symptoms.

Table 3 

Allele and genotype frequencies of rs147815978 and rs7794745 polymorphisms among case and control.

Significant at 5% level of significance (p < 0.05)

Table 4

Table 5

ANOVA RESULTS FOR CNTNAP2 rs147815978

  F ratio (Control)= 70.34209                       F ratio (Case)= 23.12551                  P=0.0000

Table 6

ANOVA RESULTS FOR CNTNAP2 rs2710102

  F ratio (Control)= 25.17739                       F ratio (Case)= 18.31413                  P= 0.00001

Discussion:

Aim of the present study was to investigate the relationship between the comorbidity of intellectual disability and epilepsy and its association with CNTNAP2 polymorphisms. In case-control study, we assessed the role of rs147815978 and rs2710102 CNTNAP2 gene polymorphisms in 170 patients and 175 healthy controls. The results of our study showed that rs147815978 (G/T) and rs2710102 (A/G) were positively associated with ID and epilepsy comorbidity in Pakistani population. CNTNAP2 gene plays a key role in neurodevelopment and its function, if impaired, leads to profound consequences including some kinds of neural dysfunction. Significant association of rs2710102 and intelligence was observed in Japanese’s children.(Shiota et al. 2021) Bi-allelic aberrations in this gene are causative for an autosomal-recessive disorder with epilepsy, severe intellectual disability (ID) and cortical dysplasia (CDFES).(Smogavec et al. 2016) CNTNAP2 was first implicated in the cortical dysplasia-focal epilepsy (CDFE) syndrome, a recessive disease characterized by intellectual disability, epilepsy, language impairments and autistic features. Associated SNPs and heterozygous deletions in CNTNAP2 were subsequently reported in autism, schizophrenia, and other psychiatric or neurological disorders.(Toma et al. 2018b) GABA-ergic interneurons reduction and neurotransmission inhibition may account for observation of seizures in patients even without radiological evidence of brain structural abnormalities.(Freri et al. 2021) 31 rare variants are identified in CNTNAP2 gene in Pakistani population with LI Disorders.(Andres et al. 2021) Homozygous deletion in intron 3 of a Pakistani origin UK based family with comorbidity of ID and EPI was reported.(Watson et al. 2014) All the studies in the past suggested that CNTNAP2 gene variants might be associated with the phenotypes of various neurodevelopmental disorders and their co-occurrence. This strengthen our results that suggest that CNTNAP2 polymorphisms might be playing a causative role in complex neurological disorders in Pakistani population where consanguinity is a dominant tradition.

Conclusion:

CNTNAP2 gene polymorphisms rs147815978 and rs2710102 have been associated with the co-occurrence of Intellectual Disability with epilepsy in a variety of age groups and ethnic background in Pakistani population. These can be used as markers to find and report the comorbidity of NDDs.

Limitations And Future Perspective:

The present study has preliminary findings which do not include any data from modern techniques like Whole Exome Sequencing to have a broader knowledge of causative agents. PCR products amplified are preserved and will be sequenced in the future by NGS to conduct a detailed investigation of the underlying mutations. It will help us design a model that can better explain the translational changes and their role in altering neurogenetic and developmental networks.

Abbreviations

Declarations

Ethical Approval and Consent to take part:

Ethics Review Committee of Department of Biosciences, Comsats University, Islamabad, has supplied ethical approval for the study. Written informed consent was obtained from all guardians of the participants in the study before obtaining blood samples.

Consent for Publication:

All authors have given consent to the content of the manuscript for publication.

Availability of data and materials:

Data and supplementary materials are available on request from the corresponding author(s).

Competing Interests:

There are no competing interests declared by the author(s).

Funding:

No funding was provided by any funding agency. 

Author Contributions:

The author has designed the study, collected the data, performed lab experimentation, analysed the results, written the manuscript, and presented for publication.

ACKNOWLEDGEMENTS:

1. All study participants are acknowledged along with OPDs by the following hospitals and clinics from where they are recruited:

2. Dr. Mubashir Malik, clinic of Neurological and Psychiatric Disorders, Rawalpindi.

3. Holy Family Hospital, Rawalpindi.

4. Benazir Bhutto Hospital, Rawalpindi.

AUTHOR’S INFORMATION: 

Ms. Behjat-Ul-Mudassir PhD Scholar, Department of Biosciences, Comsats University, Islamabad Campus, Islamabad, Pakistan.

Email for correspondence: [email protected]

ORCID: https://orcid.org/0000-0002-3957-9596

References

1. Andres, Erin M. et al. 2021. “Study of Rare Genetic Variants in TM4SF20, NFXL1, CNTNAP2, and ATP2C2 in Pakistani Probands and Families with Language Impairment.” Meta Gene 30: 100966. https://www.sciencedirect.com/science/article/pii/S2214540021001171 (May 29, 2022).

2. Aspromonte, Maria C. et al. 2019. “Characterization of Intellectual Disability and Autism Comorbidity through Gene Panel Sequencing.” Human Mutation 40(9): 1346–63. https://onlinelibrary.wiley.com/doi/abs/10.1002/humu.23822 (March 11, 2020).

3. Falsaperla, Raffaele et al. 2020. “Intronic Variant in CNTNAP2 Gene in a Boy With Remarkable Conduct Disorder, Minor Facial Features, Mild Intellectual Disability, and Seizures.” Frontiers in Pediatrics 8. https://www.frontiersin.org/article/10.3389/fped.2020.00550 (May 9, 2022).

4. Freri, Elena et al. 2021. “Severe Epilepsy in CNTNAP2-Related Pitt-Hopkins-like Syndrome Successfully Treated with Stiripentol.” Seizure - European Journal of Epilepsy 88: 143–45. https://www.seizure-journal.com/article/S1059-1311(21)00128-X/fulltext (May 9, 2022).

5. López-Rivera, Javier A et al. 2020. “A Catalogue of New Incidence Estimates of Monogenic Neurodevelopmental Disorders Caused by de Novo Variants.” Brain 143(4): 1099–1105. https://doi.org/10.1093/brain/awaa051 (December 22, 2021).

6.   Parenti, Ilaria, Luis G. Rabaneda, Hanna Schoen, and Gaia Novarino. 2020. “Neurodevelopmental Disorders: From Genetics to Functional Pathways.” Trends in Neurosciences 43(8): 608–21. http://www.sciencedirect.com/science/article/pii/S0166223620301223 (December 30, 2020).

7. Rodenas-Cuadrado, Pedro, Joses Ho, and Sonja C. Vernes. 2014. “Shining a Light on CNTNAP2: Complex Functions to Complex Disorders.” European Journal of Human Genetics 22(2): 171–78. https://www.nature.com/articles/ejhg2013100 (May 9, 2022).

8. Shiota, Yuka et al. 2021. “A Common Variant of CNTNAP2 Is Associated with Sub-Threshold Autistic Traits and Intellectual Disability.” PLOS ONE 16(12): e0260548. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0260548 (December 21, 2021).

9. Smogavec, Mateja et al. 2016. “Eight Further Individuals with Intellectual Disability and Epilepsy Carrying Bi-Allelic <em>CNTNAP2</Em> Aberrations Allow Delineation of the Mutational and Phenotypic Spectrum.” Journal of Medical Genetics 53(12): 820. http://jmg.bmj.com/content/53/12/820.abstract.

10. Toma, Claudio et al. 2018a. “Comprehensive Cross-Disorder Analyses of CNTNAP2 Suggest It Is Unlikely to Be a Primary Risk Gene for Psychiatric Disorders.” PLOS Genetics 14(12): e1007535. https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007535 (December 30, 2020).

———. 2018b. “Comprehensive Cross-Disorder Analyses of CNTNAP2 Suggest It Is Unlikely to Be a Primary Risk Gene for Psychiatric Disorders.” PLOS Genetics 14(12): e1007535. https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007535 (April 28, 2022).

11. Watson, Christopher M. et al. 2014. “Diagnostic Whole Genome Sequencing and Split-Read Mapping for Nucleotide Resolution Breakpoint Identification in CNTNAP2 Deficiency Syndrome.” American Journal of Medical Genetics Part A 164(10): 2649–55. https://onlinelibrary.wiley.com/doi/abs/10.1002/ajmg.a.36679 (May 29, 2022).

12. Zare, Sahar, Farhad Mashayekhi, and Elham Bidabadi. 2017. “The Association of CNTNAP2 Rs7794745 Gene Polymorphism and Autism in Iranian Population.” Journal of Clinical Neuroscience 39: 189–92. http://www.sciencedirect.com/science/article/pii/S0967586816310736 (December 30, 2020).