The climate in the Sichuan province is warm and humid with a large variety of plant viruses. In 2019, approximately 80 symptomatic leaf samples of cigar tobacco and flue-cured tobacco were collected from farm fields of Deyang and Luzhou city in Sichuan Province in China. The prevalent viral disease symptoms such as mosaic, venial necrosis, mottling, yellowing and necrotic spots were observed on leaves (Fig. 1). These samples were thereafter subjected to the sequencing analysis and virus identification.
Identification of major viruses by High-throughput small RNA sequencing
The small RNA libraries of two symptomatic cigar tobacco pooled samples from Deyang city and a symtomatic flue-cured tobacco pooled sample were constructed and sequenced on an Illumina HiSeq-2000 platform which generated 28765749, 25093608 and 34935454 raw reads, respectively, and submitted to the Sequence Read Archive database at NCBI with the accession number SRR13499486, SRR13499485 and SRR13838825. Adapters and low quality reads were trimmed to obtain 27930450, 21537662 and 28194021 clean reads and the Q20 value were 99.01%, 98.86% and 99.07%, respectively. The clean reads of each library were assembled into contigs through the homology-dependent approach for plant virus identification. These contigs were searched against the non-redundant nucleotide sequence entries of the NCBI database by BLASTn. The results indicated that major viruses infecting flu-cured tobacco and cigar tobacco leaves in Deyang and Luzhou area were PVY, ChiVMV, TVBMV, TMV and CMV. Among witch, there were 27, 29, 2,14 and 33 contigs with the length range from 34 ~ 1720 nt that can be mapped to the genome sequences of PVY, ChiVMV, TVBMV, TMV and CMV (Fig. 2, Table S1).
Phylogenetic analysis
Phylogenetic analysis was performed by MEGA7 based on the partial nucleotide sequences of PVY, ChiVMV, TVBMV, TMV and CMV collected from Deyang and Luzhou city in Sichuan province to investigate the evolutionary development of these viruses. The sequences of PVY-Deyang (MW419411) and PVY-Luzhou (MW419412) were compared to 15 other PVY isolates reported from various district as well as ChiVMV (JX088636.1) and TVBMV (NC-009994.1) as out groups were subjected to sequence alignment and phylogenetic analysis (Fig. 3A). The nucleotide sequences of PVY-Deyang and PVY-Luzhou show high identity with 99.65%. The sequence alignment also indicates that PVY-Deyang and PVY-Luzhou are most closely related with PVY-pt077-pot-18 (MN734254.1) on Solanum lycopersicum from Zhenjiang city of Jiangsu province China with 100.00% and 99.65% sequence identity, respectively. Results of the phylogenetic analysis also show that PVY-Deyang and PVY-Luzhou are distantly related with PVY-AST (JF928460.1) reported from Brazil and PVY-VNP413 (HG810950.1) reported from Viet Nam (Fig. 3A).
The sequences of ChiVMV-Deyang (MW355622) and ChiVMV-Luzhou (MK405594.1) as well as other 13 ChiVMV isolates together with PVY (KJ634023.1) and TVBMV (NC-009994.1) were subjected to sequence alignment and phylogenetic analysis (Fig. 3B). The results show that ChiVMV-Deyang and ChiVMV-Luzhou are most closely related with ChiVMV-Pp4 (KC711056) and Yp-8 (KC7110055) from pepper plants collected from Sichuan province with 99.42% and 99.03% sequence identity, respectively. Sequence of ChiVMV-Deyang also shows high sequence similarity with ChiVMV-Luzhou by 98.74%. While both of the isolates are distantly related with ChiVMV-GD (KU987835.1), Wenchang (GQ981316.1) and Ca (AJ972878.1) isolates from Guandong, Hainan province in South China and South Korea (Fig. 3B).
The sequences of TVBMV-Deyang (MW419414) and TVBMV-Luzhou (MW419413) were compared with 14 other TVBMV isolates as well as the ChiVMV (JX088636.1) and PVY (KJ634023.1) to construct phylogenetic tree (Fig. 3C). TVBMV-Luzhou is closely related with TVBMV-XDB-04 (MG880245.1) and YN9.1(KF444434.1) from tobacco with 99.71% and 97.45% sequence identity, respectively. Interestingly, TVBMV-Deyang is most closely related with TVBMV-YN9.1 (KF444434.1) from tobacco with only 94.03% sequence identity and also shows comparatively lower sequence similarity with TVBMV-Luzhou with 93.01% sequence identity. The results of phylogenetic analysis also indicate that TVBMV-Deyang and TVBMV-Luzhou are distantly related with TVBMV SDWF11 (GU904096.1), YND (EF219408.1), JX (JN630471.1) isolates reported from Shandong province of China (Fig. 3C).
Phylogenetic analysis of TMV-Deyang (MW521350) and TMV-Luzhou (MW521351) were compared with other 18 reported TMV isolates together with a tomato mosaic virus (ToMV) (NC-002692.1) and a tobacco mild green mosaic virus (TMGMV) (NC-001566.1) isolate were used as the out groups (Fig. 3D). The results indicate that TMV-Deyang is closely related with Xiongfan-2 (HE818419.1) and Fumeng (HE818416.1) isolates with 99.75% and 98.95% sequence similarity. While TMV-Luzhou clustered with Xuyong (HE818454.1) as well as Tianzhu-1 (HE818444.1) isolate with 99.90% and 99.15% sequence similarity. The sequences identity of TMV-Deyang and TMV-Luzhou is 98.24% and both of the isolates are distantly related with Ohio V (FR878069.1), Harbin-2 (MH595920.1) and SXFQ (JX993906.1) (Fig. 3D).
The sequences of CMV-Deyang (MW698928) were compared to 20 other CMV isolates reported from various district as well as brome mosaic virus (NC-002028.2) and alfalfa mosaic virus (NC-002025.1) from USA as out groups and were subjected to sequence alignment and phylogenetic analysis (Fig. 3F). No CMV isolates were identified from Luzhou in this investigation. The results showed that CMV-Deyang is most closely related with CMV-RX9 (MH119149.1) and CMV-RX2 (MH119146.1) from Glycine max plants collected from China with 98.93% and 98.78% sequence identity, respectively, while distantly related with Ug90-RNA3 (MG021456.2), CMV-HC-56 (FM999062.1) and CMV-Jol186 (JX025994.1) isolates from Uganda, Thailand and Iran (Fig. 3F).
Specificity, sensitivity and application of multiplex RT-PCR
To simultaneously detect these viruses, we designed specific amplification primers for PVY, ChiVMV, TVBMV, TMV as well as CMV and constructed a multiplex RT-PCR detection system. To determine the sensitivity, a serious of plasmids including pEASY-PVY, pEASY-ChiVMV, pEASY-TVBMV, pCB-TMV-SN (no. MG516107) and pEASY-CMV were diluted from 108 copies to 102 copies, respectively, and amplified by the multiplex RT-PCR using 25 µL reaction system. The results indicated that the detection limit of PVY, ChiVMV, TVBMV, TMV and CMV were 104, 104, 104, 104 and 105 copies, respectively (Fig. 4A-E). Furthermore, we mixed these plasmids at equal ratio and diluted from 108 copies to 102 copies each, and subjected to multiplex RT-PCR analysis. The results showed that 5 virus specific bands can generally be amplified from the mixed templates from 108 to 104 copies each (Fig. 4F), thereby indicating that the developed multiplex RT-PCR was sensitive and specific for simultaneous detection of PVY, ChiVMV, TVBMV, TMV and CMV.
To test the feasibility of the multiplex RT-PCR for simultaneous detection of these viruses in the field. We tested 22 field-collected symptomatic tobacco leaf samples from Deyang and Luzhou tobacco planting areas (Fig. 5A and B). The number of the leaf samples showed in Fig. 5A were consistent with lane number showed in Fig. 5B. The results revealed that detection rate for PVY, ChiVMV, TVBMV, TMV and CMV were approximately 36%, 55%, 45%, 55% and 9%, respectively. Among which, leaf samples (Fig. 5A and B. 1, 6, 7, 11 and 21) were infected by TMV, CMV, ChiVMV, TMV and ChiVMV, respectively. However, the other 17 leaf samples showed synergistic infection by two or more viruses. For example, two samples (Fig. 5A and B. 3 and 8) were synergistically infected by TVBMV and PVY. Leaf samples (Fig. 5A and B. 16, 20 and 22) indicated synergistic infection of ChiVMV and TMV. Additionally, leaf sample number 2 and 5 (TVBMV, ChiVMV and TMV), 9 (TVBMV, PVY and TMV), 10 (ChiVMV, PVY and TMV) and 18 (TVBMV, ChiVMV and PVY) were synergistically infected by three viruses (Fig. 5A and B).
Table 1
Primer list used for phylogenetic analysis and multiplex RT-PCR
primer name
|
sequence
|
amplification size
|
PVY-5719F
|
GGGAAAAATAAATCCAAAAG
|
564 bp
|
PVY-6263R
|
TTCATGCTCCACTTCCTGTT
|
ChiVMV-2441F
|
GGTGAAGGAATTGAAAGTAT
|
1032 bp
|
ChiVMV-3453R
|
TTGATGACCCACTGGTTCCT
|
TVBMV-1071F
|
TCAGCAGCAGAACAATTCTG
|
1374 bp
|
TVBMV-2425R
|
ACCAACTCTATAATGCTTCA
|
TMV-70F
|
ATGGCATACACACAGACAGC
|
1992 bp
|
TMV-2061R
|
CTCCGGATGATCTCCAGCAA
|
CMV − 1257F
|
ATGGACAAATCTGAATCAAC
|
657 bp
|
CMV-1913R
|
CAGGGGTGTTCCCAGTTTGA
|
PVY-6494F
|
GATGGGCATTGTGGATTACC
|
613 bp
|
PVY-7087R
|
TCTGGAAGCCATGCACTTGC
|
ChiVMV-7987F
|
AATGGCAATGCGGTATTCAC
|
842 bp
|
ChiVMV-8809R
|
CGACGGCCTTCGTCTTAACC
|
TVBMV-989F
|
TGTGCGAGGTCGTGATGGGG
|
1253 bp
|
TVBMV-2222R
|
GATAGCATGCAAGTGCAACC
|
TMV-130F
|
TCCTTGGTCAATGATCTAGC
|
485 bp
|
TMV-614R
|
GTATTGTGACAGACAGCGTC
|
CMV-265F
|
TTCCGAGGTCATCCGGAATC
|
995 bp
|
CMV-1240R
|
CCTTGAACTGTTCCATCCAC
|