Candida species and growth conditions
The refrence strains of C. albicans ATCC 90028 and C. tropicalis ATCC 750, two clinical isolates of C. albicans (CaSN1 and CaSN2) and a clinical isolate of C. tropicalis (CtSN1) were used in this study. Clinical vaginal isolates of patients with recurrent vulvovaginal candidiasis, were provided by Microbiology Laboratory, Cellular and Molecular Research Center, Yasuj University of Medical Sciences (Iran). Candida species were plated onto CHROMagar™ Candida (CHROMagar Microbiology, Paris, France) and Sabouraud Dextrose Agar (SDA, Difco Laboratories, USA) plates.
Total protein extraction of Candida species
Total protein were extracted from C. albicans ATCC 90028, CaSN1, CaSN2, C. tropicalis ATCC 750 and CtSN1 and described as CanSp1-5, respectively. Briefly, precultures were incubated in yeast extract peptone dextrose (YEPD) broth medium (containing, 20 g/L Bacto peptone, 10 g/L yeast extract, and 20 g/L dextrose) at 30°C for 18 h. The Candida species cell suspension (1–5 × 106 CFU/mL) used to inoculate fresh human serum at 37°C for 18 h. One handred mg of Candida species cells were collected by centrifugation for 5 min at 5000 rpm. The pellet of cells was then washed twice with ice-cold PBS buffer and once with with sterile Milli-Q water. The cells were re-suspended in 500 µL of 7 M urea, 2 M thiourea, 4% CHAPS and 50 mM DTT buffer containing 1x Protease Inhibitor Mix (GE Healthcare Bio-Science AB, Piscataway, MA, USA). After that, the suspension of cells were sonicated in an UP200H ultrasonic processor (Hielscher, Teltow, Germany) at a frequency of 24 kHz, three times, for 15 s, with pauses of 45 s between sonications. The lysates were separated by centrifugation (4°C, 14,000 rpm, 20 min). The lysates and the remaining cell-free supernatant were sterilized by filtering with a Millipore Ultrafree-15 centrifugal filter device (Millipore, Bedford, MA, USA) for desalting and concentration (Fiorini et al. 2016; Staniszewska et al. 2014; Thomas et al. 2006). A simplified representation of the total protein extraction of Candida species is shown in Fig. 1 (created with BioRender.com).
Total protein quantitation assay
The quantitation of total protein of Candida species (CanSp) were determined using Bradford method (Bradford 1976). A standard curve was prepared by using serially diluted bovine serum albumin (BSA) protein concentrations (10, 20, 30, 40, 50, 60, 70, 80, 90, and 100 µg) in a total volume of 100 µL Milli-Q water. Blank samples were prepared using 100 µL of Milli-Q water. Five mL of Bradford protein reagent (100 mg of Coomassie Brilliant Blue was dissolved in 50 mL of 95% ethanol, mixed with 100 mL of 85% orthophosphoric acid and diluted to a final volume of 1 L with Milli-Q water) was added to each tube and then mixed thoroughly with the standard and exteracted solutions (5 µg). The absorbance was measured at 595 nm using a microplate reader (BioTek, ELx800, Winooski, VT, USA) after incubation at room temperature for 10 min in a dark place. The protein concentration was plotted against the corresponding absorbance, resulting in a standard curve used to measure the total protein concentration in unknown samples.
In addition, the protein concentration of CanSp1-5 was determined by the micro-Kjeldahl method. About 1 mg of each CanSp was digested with with 500 mg potassium sulphate and 2 mL of cupric sulphate/ sulphuric acid Kjeldahl digestion solution at 410°C for 3 h. After cooling, Milli-Q water was added to the hydrolysates before neutralization and titration. The nitrogen content was converted into protein concentration using the coefficient factor 6.25 calculated from the standard curve of serially diluted BSA protein concentrations (Wang et al. 2016).
Cell culture
Human HeLa cell line was obtained from the Pasteur Institute of Iran, Tehran, Iran and maintained in RPMI-1640 (Gibco; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Sigma-Aldrich, St Louis, MO) at 37°C, 5% CO2 and > 90% humidity for 24 h.
Trypan blue dye exclusion assay
Trypan blue exclusion assay was used to determine the number of viable cells present in a cell suspension. A sample of HeLa cells (10 mL) was collected from during the logarithmic growth phase and pipetted into a counting chamber of hemocytometer (HC-B080A Improved Neubauer counting chamber Blood cell counter chamber, Mainland, China). The cell sample was stained 1:1 with 0.4% trypan blue (Sigma) and incubated 3 min at room temperature. Cells excluding trypan blue (viable cells) were counted using phase contrast inverted microscope (Olympus, Corp., Tokyo, Japan) with a hemocytometer (Strober 2015).
Cell viability assay
The HeLa cells with a cell density of 1 × 104 cells/well was seeded in 96-well flat bottom microplates and incubated at 37°C, 5% CO2 and > 90% humidity for 24 h for proper attachment. Each well received increasing concentrations of CanSp1-5 (0, 7.813, 15.625, 31.25, 62.5, 125, 250 and 500 µg/mL) and incubated under the same condition for 24 h. The last two columns were used as controls, i.e., without treatment. The inhibitory effect was assessed using 3-(4, 5-Dimethyl-1, 3-thiazol-2-yl)-2, 5-diphenyl-2H-tetrazol-3-ium bromide (MTT, Sigma) dye. Then 10 µL of 5 mg/mL MTT solution was added into each well and plates were incubated at 37°C for 4 h in a dark place. Dimethyl sulfoxide (150 µL) was added into each well and mixed thoroughly to dissolve formazan crystals. The absorbance was measured at 570 nm using a microplate reader (BioTek). The inhibitory effect was calculated as a percentage of the untreated control value (Kokhdan et al. 2018).
Determination of IC50 and EC50 concentrations
The half maximal inhibitory concentration (IC50) and half maximal effective concentration (EC50) values were calculated from a standard curve on the basis of linear-regression analyses (Kokhdan et al. 2018; Kuete et al. 2011).
Cell apoptosis assay
Aperoximatly 1 × 105 HeLa cells were added onto a 6-well cell culture plate containing coverslips and incubated at 37°C, 5% CO2 and > 90% humidity for 24 h. Following attachment, cells were treated with treated with CanSp1-5 at concentration equal to IC50 and incubated under the same condition for 24 h. The untreated cells in 1% DMSO were used as a negative control. Olympus phase contrast inverted microscope (Japan) was used to visualize the apoptosis in cells (Kokhdan et al. 2018; Motadi et al. 2020).
Nitrite assay
The effect of CanSp1-5 on free radical nitric oxide (NO) synthesis was measured by the formation of nitrite in culture supernatants according to the Griess method. One hundred microliters of treated cell culture supernatants was incubated with 100 µL of Griess reagent (1% (w/v) sulfanilamide /0.1% (w/v) N-(1-naphtyl) ethylenediaminedihydrochloride (Sigma) in 2.5% (v/v) H3PO4) at room temperature for 10 min. Then, the absorbance was measured at 550 nm using a microplate reader (BioTek). The nitrite concentration was determined with reference to a standard curve of sodium nitrite (µM/mL) (Tezuka et al. 2001).
Quantitative reverse transcription PCR (RT-qPCR)
HeLa cells were treated with CanSp1-5 at concentration equal to IC50, and then total RNA was extracted using Kiazol (Kiazist Life Sciences, Iran) according to the manufacturer’s protocol. The reverse transcription reaction was carried out according to the manual using RevertAid First Strand cDNA synthesis kit (Fermentas, St. Leon-Ro,Germany), 2 µg of total RNA as the template and oligo dT primer. The OCT4B and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were selected to amplification whose primer sequences are listed in Table 1. The qRT-PCR reaction was performed by the reverse transcription samples using a Maxima SYBR Green qPCR (Bio-Rad, Munich, Germany). The qRT-PCR reactions were performed in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) in accordance with the following program: 1. 94°C 7 min; 2. 94°C 30 s; 3. 58°C 30 s; 4. 72°C 1 min; 5. repeat steps 2–4 45 times; melting curve analysis from 65 to 95°C, 0.5°C per 5 s increments. Relative quantitative of transcriptional levels of OCT4B gene was normalized with respect to housekeeping gene (GAPDH) and calculated by the ΔΔCt method (Norouzi et al. 2021).
Table 1
Target gene
|
Primer name
|
Sequence (5'-3')
|
Product size (bp)
|
Reference
|
Octamer binding transcription factor 4 B
|
OCT4B
|
F ATGCATGAGTCAGTGAACAG
|
303
|
Li et al. 2015
|
|
|
R CCACATCGGCCTGTGTATAT
|
|
|
Glyceraldehyde-3-phosphate dehydrogenase
|
GAPDH
|
F GAAGGTGAAGGTCGGAGTC
|
226
|
Li et al. 2015
|
|
|
R GAAGATGGTGATGGGATTTC
|
|
|
Statistical analysis
One-way ANOVA was used to analyze data. Tukey’s post hoc comparison was performed to compare gene expressions of the groups (*P < 0.01; **P < 0.001; ***P < 0.0001). All data are expressed as the mean ± S.D. of at least three independent experiments. All analyses were conducted using SPSS 18.0 and GraphPad Prism 7.