Field symptoms of bulb rot in infected F. przewalskii plants
Healthy and diseased F. przewalskii plants grown on a wild fostered field in Zhang County, Gansu Province, China, are shown in Fig. 1. Pathogens infected both the bulbs and the roots, adhering to them and causing partial or entire organ tissue discoloration and decay; these symptoms were more obvious in plants older than 3 years. Tissue destruction in the diseased roots hindered nutrient and water translocation to the shoots leading to plant wilt and, ultimately, death (Fig. 1). However, these latter symptoms were seldom observed in 1- or 2-year-old plants. Diseased plants older than 3 years showed diverse morphologies, and only a few exhibited root symptoms but not shoot and bulb symptoms (Fig. 1d). The infected bulbs were inlayed with yellow-brown, black-brown, or black-green spots on their surfaces (Fig. 1e, h). The lesions were absent in healthy bulbs (Fig. 1f, g, i). As the disease spread, the bulbs decayed, preventing water and nutrient transport from the soil to the aboveground plant parts. Mildly infected plants wilted in the midday sun and recovered at nighttime while severely infected plants died after sun exposure
Bulb diameter, height, and fresh weight were measured to correlate bulb size and rot incidenceto growing-year classification (Fig. 1j, k, l). Bulbs were larger in fifth > fourth > third growing-year (Fig. 1j, k, l) and variance analysis revealed significant differences in bulb diameter (F = 328.632, P༜0.01), height (F = 177.746, P༜0.01), and fresh weight (F = 349.182, P༜0.01) among the three growing-years in both healthy and diseased plants (d.f. = 2, 95). Healthy bulbs’ diameter (F = 9.230, P༜0.01) and fresh weight (F = 10.670, P༜0.01) were significantly higher than those of diseased bulbs, on average (d.f. = 1, 95), but this was not observed for bulb height. A significant interaction between growing-year and plant type (diseased or healthy) was only found in for bulb diameter (F = 3.553, d.f. = 2.95, P༜0.05). No significant differences in bulb height and diameter were detected between diseased and healthy bulbs in the same growing-year according to the t-test (n = 20).
Pathogen Isolation And External Colony Morphology
Fungal pathogens were isolated from diseased 3- to 5-year-old F. przewalskii bulbs and incubated in PDA medium in the dark for 4 days (n = 45; Fig. 2). The fungal isolates varied with bulb age and seven fungal strains (F1-F7) were isolated from the diseased bulbs. All seven strains were identified in the 5-year-old bulbs (Fig. 2a), F1-F6 were found in the 4-year-old bulbs (Fig. 2b), and only F1, F2, F5, and F6 were present in the 3-year-old bulbs (Fig. 2c). Certain blocks from the inoculated bulbs had multiple isolates whereas others had only one and a few had none. The bulb growing-year had no significant effect on the separation frequency of these isolates (F = 0.653, d.f. = 2,42, P = 0.526). However, bulb age was strongly correlated with the isolates themselves (F = 57.084, d.f. = 6,42, P < 0.01), and a significant interaction between growing-year and the isolates was also found (F = 2.552, d.f. = 12.42, P < 0.05). Isolates’ separation frequencies were ranked as F1 > F2 > F5 > F4 > F6 > F3 > F7. At ≤ 50%, F1 showed the highest isolation frequency which was greater than those of F2-F7, and it increased by 53.5% (t = 3.080, P < 0.01, n = 45), 3,200.0% (t = 10.742, P < 0.01, n = 45), 407.7% (t = 6.664, P < 0.01, n = 45), 127.6% (t = 5.692, P < 0.01, n = 45), 1,550.0% (t = 10.298, P < 0.01, n = 45), and 6,500.0% (t = 11.026, P < 0.01, n = 45), respectively (Table 1). F2 and F5 had the second and third highest isolation frequencies. These were significantly lower than that of F1 but significantly higher than those of the other four strains. The isolation frequencies of F3, F4, F6, and F7 were all < 10.0% and there were no significant differences among them.
Table 1
ัIsolated frequency of the strains from 3–5 growing years of Fritillaria przewalskii rot bulbs
Species | Strain codes | Isolated frequency (%) |
3 years | 4 years | 5 years | Mean |
Bionectria ochroleuca | F1 | 46.7 ± 3.9 | 60.0 ± 6.7 | 40.0 ± 7.7 | 48.9 ± 4.3aA |
F3 | 0 | 2.2 ± 2.2 | 2.2 ± 2.2 | 1.5 ± 1.0eD |
F4 | 0 | 8.9 ± 5.9 | 20.0 ± 7.7 | 9.6 ± 4.0dD |
Clonostachys rosea | F6 | 4.4 ± 2.2 | 2.2 ± 2.2 | 2.2 ± 2.2 | 3.0 ± 1.2deD |
Fusarium tricinctum | F5 | 24.4 ± 2.2 | 22.2 ± 5.9 | 17.8 ± 2.2 | 21.5 ± 2.2cC |
Fusarium oxysporum | F2 | 40.0 ± 3.9 | 31.1 ± 5.9 | 24.4 ± 5.9 | 31.9 ± 3.5bB |
F7 | 0 | 0 | 2.2 ± 2.2 | 0.7 ± 0.7eD |
Each experiment data in this table indicators mean ± SEs. Different small and capital letters in the mean column indicate significant and great significant differences at p < 0.05 and p < 0.01, respectively, based on ANOVA-Duncan multiple comparison results. |
External colony morphologies are shown in Fig. 2. The F1 colonies were round with regular edges and vigorous white aerial hyphae (Fig. 2d). The lower surfaces of the colonies were also white (Fig. 2e). The F3 colonies had the same morphology as those of F1 (Fig. 2f) but their lower surfaces had canary yellow patterns (Fig. 2g). The F4 colonies were white and formed rosette patterns (Fig. 2h) and most had white lower surfaces, although a few were canary yellow (Fig. 2i). The F6 colonies were round with white aerial hyphae (Fig. 2j) and gradually developed a deep yellow coloration on their lower surfaces (Fig. 2k). The F2 colonies were round with vigorous lavender aerial hypha (Fig. 2l) and purple lower surfaces (Fig. 2m). The F7 colonies were round (Fig. 2n) with vigorous light pink aerial hyphae (Fig. 2o). The F5 colonies were also round (Fig. 2p) with vigorous fuchsia aerial hyphae, some of which covered with thin white layers. The lower surfaces of the colonies were also fuchsia (Fig. 2q).
Pathogenicity Test Results
Healthy F. przewalskii bulbs were stabbed with cakes of each isolate. Non-stabbed bulbs served as controls (Table 2). Bulbs of all three ages inoculated with the seven strains presented symptoms similar to those observed in the naturally infected F. przewalskii bulbs. Moreover, all strains were isolated from the inoculation sites. A Koch's law analysis indicated that all seven isolated strains were responsible for F. przewalskii bulb rot. By both stabbing and non-stabbing inoculation, F2, F5, and F7 induced the highest bulb rot severity after dark incubation for 4 days. The lesions gradually expanded with incubation time and became bifurcated after 8 days. The incidences of bulb rot induced by F2, F5, and F7 in stabbed bulbs of all ages increased by 75.15%, 76.65%, and 71.44%, respectively, on day 8. Under both the stabbing and non-stabbing conditions, bulb growth-year had no significant effect on the incidences of these isolates (F = 0.207, P = 0.814; F = 0.071, P = 0.931; d.f. = 2,42), however, these incidences were strongly correlated with the isolates themselves (F = 59.349, P < 0.01; F = 10.116, P < 0.01; d.f. = 6,42). Significant interactions between growth-year and isolates were not found (F = 0.446, P = 0.934; F = 0.162, P = 0.999; d.f. = 12,42) under the two inoculation conditions (Table 2). Bulb rot incidences were significantly higher than those in non-stabbed bulbs of the same age (t = 16.097, P < 0.01; t = 15.271, P < 0.01; t = 12.741, P < 0.01; n = 9) (Table 2). The lesions induced by F2, F5, and F7 had completely covered the stabbed bulbs after 10 days of incubation, and 30 days later in the non-stabbed bulbs. However, no lesions were detected in any of the PDA-inoculated controls. The lesions were round or near-circular, moist, and yellow-brown, dark-brown, or blue-black, and their central portions collapsed. The hyphae growing on the non-stabbed bulbs inoculated with F2, F5, and F7 were more vigorous than those on the bulbs infected with the other strains. The F2, F5, and F7 mycelia were thick and mostly white, except for tinges of mauve in F2 and F7 and fuchsia in F5. No lesions were found on the non-stabbed bulbs inoculated with F3, F4, and F6. In contrast, lesions did not appear in the bulbs stabbed with F1, F3, F4, and F6 until the sixth day after inoculation. By the eighth day, the incidences of these isolates increased by 39.09% (t = 13.456, P < 0.01; n = 9), 34.93% (t = 21.930, P < 0.01; n = 9), 40.37% (t = 16.243, P < 0.01; n = 9), and 36.87% (t = 12.914, P < 0.01; n = 9), respectively, compared to the non-stabbed controls (Table 2). All of the lesions produced by F1, F3, F4, and F6 had the same shape but were smaller than those arising from F2, F5, and F7. In the former case, the lesions were moist and yellow-brown but without obvious pitting. They were covered with thin white- to yellow-white hyphae. This morphology indicated very weak pathogenicity.
Table 2
ัPathogenic incidence of the strains from different growing years of Fritillaria przewalskii rot bulbs to the 3–5 growing year health ones
Treatments | Incidence rate of the strains from different growing years of rot bulbs (%) |
3 years | 4 years | 5 years | Means |
Inoculated isolates by bulb stabbing |
F1 | 40.0 ± 5.1 | 42.1 ± 4.8 | 38.9 ± 5.6 | 40.3 ± 3.2bB |
F2 | 95.0 ± 5.0 | 86.8 ± 6.8 | 85.3 ± 7.7 | 89.2 ± 4.4aA |
F3 | 33.3 ± 0.0 | 33.3 ± 0.0 | 38.1 ± 4.8 | 34.9 ± 2.0bB |
F4 | 40.9 ± 4.9 | 38.1 ± 4.8 | 42.1 ± 4.8 | 40.4 ± 3.0bB |
F5 | 94.8 ± 5.3 | 90.0 ± 5.1 | 89.7 ± 10.3 | 91.5 ± 4.6aA |
F6 | 32.2 ± 1.1 | 37.2 ± 3.9 | 41.2 ± 7.8 | 36.9 ± 3.5bB |
F7 | 90.4 ± 5.0 | 86.3 ± 3.0 | 78.2 ± 14.3 | 85.0 ± 5.8aA |
CK(PDA) | 0 | 0 | 0 | 0 (CK)cC |
Inoculated isolates by bulb non-stabbing |
F1 | 0 | 0 | 3.7 ± 3.7 | 1.2 ± 1.5bB |
F2 | 15.0 ± 1.7 | 14.3 ± 7.7 | 12.8 ± 6.6 | 14.0 ± 3.6aA |
F3 | 0 | 0 | 0 | 0bB |
F4 | 0 | 0 | 0 | 0bB |
F5 | 11.1 ± 5.6 | 16.7 ± 0.0 | 16.7 ± 9.6 | 14.8 ± 6.1aA |
F6 | 0 | 0 | 0 | 0bB |
F7 | 14.3 ± 2.4 | 13.9 ± 7.4 | 12.5 ± 6.4 | 13.6 ± 3.6aA |
CK(PDA) | 0 | 0 | 0 | 0 (CK) bB |
Each experiment data in this table indicators mean ± SEs. Different small and capital letters in the mean column of bulb stabbing and non-stabbing groups indicate significant and great significant differences at p < 0.05 and p < 0.01, respectively, based on ANOVA-Duncan multiple comparison results. |
Pathogen Identification
The morphologies of the F1, F3, F4, and F6 colonies on PDA medium are shown in Fig. 5. F1, F3, and F4 resembled Bionectria ochroleuca whereas F6 was similar to Clonostachys rosea. These finding spreliminarily confirmed that they were anamorphs (Fig. 2d-2 k). Detailed external colony morphologies of all isolates are shown in Fig. 2 (d-k). Bionectria ochroleuca mycelia was septate and fairly dense. Conidiophores arising from the mycelia generated branching stalks 18.540.0 µm long, 1.52.5 µm wide, and 10.020.0 µm long. The sporogenic cell was 4.07.5 µm long and 1.02.5 µm wide. The conidia were pale, ellipsoid, and 5.06.5 µm × 2.53.0 µm (Fig. 3a-3 h).
The F2 and F7 colonies on PDA medium were round and mostly mauve or slightly pink. Their hyphae were wooly and white or pink to purple. This colony morphology resembles that of Fusarium oxysporum (Fig. 21, 2 m). The lower surfaces of the colonies were dark purple. The microconidia were oval or kidney-shaped and 5.521.5 µm × 2.55.5 µm in size. The macroconidia were sickle-shaped with two to four separations and were 35.045.0 µm × 3.05.0 µm in size. The spherical chlamydospore was interstitial, coniferous, or terminal and had a diameter of 5.58.0 µm (Fig. 3i-3 l).
The F5 colonies on PDA medium were round and mostly burgundy or slightly white and resembled those of Fusarium tricinctum (Fig. 2p, 2q). The lower surfaces of the colonies were burgundy. The hyphae were like cotton wool and burgundy or white. The microconidia were oval or kidney-shaped and either had one septum or none at all. The macroconidiospores were curved or elliptical and had three to five septa. The chlamydospores were spherical and smooth-walled. They were interspersed and either solitary or clustered (Fig. 3m-3p).
Molecular Biology Identification
The genomic DNAs of isolates F1F7 were extracted and used as templates for the PCR amplification of the ITS region; the sequences obtained were 529, 503, 529, 528, 525, 529, and 528 bp (Table 3), respectively, and registered under GenBank Accession Nos. MH917682-MH917688 (Table 4). The BLAST analysis indicated that the DNA sequence of F2 was highly similar to that of Fusarium oxysporum (Accession Nos. JF807396.1 and MG543757.1). The DNA sequence of F7 was highly homologous with that of Fusarium oxysporum (Accession No. JX669526.1). The identity was over 99% in the local alignment (Table 4, Fig. 4) and 96% in the global alignment (Table 4). These clustered into the same group on the phylogenetic tree (Fig. 11) and F2 and F7 were both considered Fusarium oxysporum. The DNA sequence of F5 was 100% homologous to Fusarium tricinctum (Accession Nos. MG547895.1, MF326625.1, MH071359.1, and KP091283.1) with 100% identity in the local alignment (Fig. 4) and over 47% in the global alignment (Table 4). All of these sequences clustered into the same group on the phylogenetic tree and therefore F5 strain was classified as Fusarium tricinctum. The DNA sequences of F1, F3, and F4 were all 100% homologous with Bionectria ochroleuca (Accessions: GU934503.1, AB470910.1, JF311931.1, and FJ426388.1). The F6 sequence was > 99% homologous with that of Clonostachys rosea (Accession No. KJ941018.1) in the local alignment. All of these sequences clustered together in the same group on the phylogenetic tree, confirming that Clonostachys rosea is an anamorph of Bionectria ochroleuca. The colony morphology corroborated the accuracy of the molecular data. The DNA sequence analysis of the seven strains isolated from F. przewalskii bulb rot lesions revealed that these correspond to the four fungal pathogens known to cause this disease.
TABLE 3 The 18S DNA sequences extracted from ITS region in seven isolates isolated from 3 to 5 growing year rot bulbs of Fritillaria przewalskii
Isolate no.
|
Sequences
|
F1
|
CTCCCAACCCATGTGAaCATACCTACTGTTGCTTCGGCGGGATTGCCCCGGGCGCCTCG
TGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTTAATTCTTGTTTTATTTTGGAATCTT
CTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCAT
CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC
ATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGA
GCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAAGCCCGC
GAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCTCTGCGAAGT
AGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCGTTAAACCCCCAACTTTCCAA
GGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAACCCCCGG
AGGAA
|
F2
|
CTCcCAACCCTGTGAaCATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAA
ACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAA
AACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT
TTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTC
AACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCCCAAATTGATT
GGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTC
GCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATAC
CCGCTGAACTTAAGCATATCAAAACCCCCGGAGGAA
|
F3
|
CTCCCAACCCATGTGAaCATACCTACTGTTGCTTCGGCGGGATTGCCCCGGGCGCCTCG
TGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTTAATTCTTGTTTTATTTTGGAATCTT
CTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCAT
CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC
ATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGA
GCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAAGCCCGC
GAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCTCTGCGAAGT
AGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCGTTAAACCCCCAACTTTCCAA
GGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAACCCCCGG
AGGAA
|
F4
|
CTCCCAACCCATGTGAACATACCTACTGTTGCTTCGGCGGGATTGCCCCGGGCGCCTC
GTGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTTAATTCTTGTTTTATTTTGGAATCT
TCTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCA
TCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTG
AGCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAAGCCCG
CGAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCTCTGCGAAG
TAGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCGTTAAACCCCCAACTTTCCA
AGGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAACCCCGG
AGGAA
|
F5
|
TACCTGATcCGAGGTCaACATTCAGAAGTTGGGGTTTTACGGCATGGCCGCGCCGCGTT
CCAGTTGCGAGGTGTTAGCTACTACGCAATGGAGGCTGCAGCGAGACCGCCAATGTAT
TTCGGGGGCGGCACCGCCCAGAAGGGCAGAGCCGATCCCCAACACCAAACCCGGGGG
CTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCGGAATACCAGCGGGCGCA
ATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAT
TTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTT
ATTTGTTTGTTTTACTCAGAAGTTACAATAAGAAACATTAGAGTTTGGGTCCTCTGGCG
GGCCGTCCCGTTTTACGGGGCGCGGGCTGATCCGCCGAGGCAACATTAAGGTATGTTC
ACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGCCCCCCAACGGAA
A
|
F6
|
CTCCCAaACCCATGTGAaCATACCTACTGTTGCTTCGGCGGGATTGCCCCGGGCGCCTC
GTGTGCCCCGGATCAgGcGCCCGCCTAGGAAACTTAATTCTTGTTTTATTTTGGAATCTT
CTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCAT
CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCACTGAATC
ATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGA
GCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAAGCCCGC
GAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCTCTGCGAAGT
AGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCGTTAAACCCCCAACTTTCCAA
GGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAACCCCGGA
GGAA
|
F7
|
CTCcCAACCCTGTGAaCATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAA
ACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAA
AACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT
TTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTC
AACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATT
GGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTC
GCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATAC
CCGCTGAACTTAAGCATATCAAAACCCCGGAGGAA
|
|
|
|
|
|
Table 4
ัPairwise nucleotide sequence alignment identity (%) among 33 accessions including species Bionectria ochroleuca (Boc), Clonostachys rosea (Cro), Fusarium sp.(F), Fusarium avenaceum (Fav), Fusarium acuminatum (Fac), Fusarium oxysporum (Fox), Fusarium tricinctum (Ftr) retrieved from GenBank compared to seven strains (F1, F2, F3, F4, F5, F6, F7) originally isolated from Fritillaria przewalskii Maxim. rot bulbs with Needleman-Wunsch Global Alignment in NCBI
Accession (genotype) | Species | SEq. length | F1 | F2 | F3 | F4 | F5 | F6 | F7 |
MH917682 (F1) | Boc | 529 | 100 | 78.8 | 100 | 99.8 | 46.9 | 99.4 | 78.4 |
MH917683 (F2) | Fox | 502 | 78.8 | 100 | 78.8 | 78.6 | 48.7 | 78.0 | 99.6 |
MH917684 (F3) | Boc | 529 | 100 | 78.8 | 100 | 99.8 | 46.9 | 99.4 | 78.4 |
MH917685 (F4) | Boc | 528 | 99.8 | 78.6 | 99.8 | 100 | 46.7 | 99.6 | 78.5 |
MH917686 (F5) | Ftr | 525 | 46.9 | 48.7 | 46.9 | 46.7 | 100 | 46.7 | 48.9 |
MH917687 (F6) | Cro | 529 | 99.4 | 78.0 | 99.4 | 99.6 | 46.7 | 100 | 78.0 |
MH917688 (F7) | Fox | 502 | 78.4 | 99.6 | 78.4 | 78.5 | 48.9 | 78.0 | 100 |
AB470910.1 (X1) | Boc | 528 | 98.9 | 77.7 | 98.9 | 99.1 | 46.8 | 98.7 | 77.6 |
FJ426388.1 (DB-5B) | Boc | 540 | 96.7 | 76.0 | 96.7 | 96.9 | 46.3 | 96.5 | 75.9 |
GU934503.1 (OTU430) | Boc | 584 | 89.7 | 70.4 | 89.7 | 89.9 | 46.1 | 89.9 | 70.4 |
JF311931.1 (P295_D3_10) | Boc | 538 | 91.9 | 71.7 | 91.9 | 92.1 | 45.5 | 91.7 | 79.8 |
JF776663.1 (WAC:11486) | Ftr | 561 | 74.3 | 79.9 | 74.3 | 74.4 | 48.5 | 74.4 | 79.8 |
JF807396.1 (K9) | Fox | 517 | 76.1 | 96.3 | 76.1 | 76.2 | 48.8 | 75.9 | 96.3 |
JQ301898.1 (BWH-Z) | Fox | 523 | 75.0 | 95.0 | 75.0 | 75.2 | 49.0 | 74.9 | 95.4 |
JQ690084.1 (ZD) | Ftr | 565 | 74.5 | 80.1 | 74.5 | 74.4 | 48.2 | 74.4 | 79.7 |
JX669525.1 (SY-1) | Fox | 521 | 75.3 | 95.4 | 75.3 | 75.5 | 49.1 | 75.1 | 95.8 |
JX669526.1 (SY-2) | Fox | 519 | 75.6 | 95.8 | 75.6 | 75.7 | 49.1 | 75.7 | 96.2 |
KC767895.1 (cjl40804) | Ftr | 547 | 74.0 | 79.6 | 74.0 | 74.2 | 48.2 | 74.2 | 79.6 |
KF939132.1 (1) | Fav | 553 | 76.0 | 81.7 | 76.0 | 76.1 | 48.8 | 76.1 | 81.6 |
KJ941018.1 (NEFU) | Cro | 559 | 93.8 | 73.5 | 93.8 | 93.9 | 45.8 | 93.9 | 73.5 |
KP091283.1 (LZF1) | F | 538 | 73.9 | 79.5 | 73.9 | 74.0 | 47.6 | 73.9 | 79.5 |
KR817677.1 (6-5-1) | Ftr | 542 | 74.1 | 79.7 | 74.1 | 74.2 | 48.0 | 74.2 | 79.7 |
KU892283.1 (2015-F-366) | Ftr | 545 | 74.3 | 79.9 | 74.3 | 74.4 | 47.8 | 74.4 | 79.9 |
KX058060.1 (fsp15) | Fox | 531 | 72.6 | 78.2 | 72.6 | 72.7 | 47.8 | 72.7 | 78.2 |
KY078213.1 (ZJU-1) | Fox | 520 | 75.5 | 95.6 | 75.5 | 75.6 | 49.3 | 75.3 | 96.0 |
KY365570.1 (D22-2) | Fac | 545 | 74.7 | 80.4 | 74.7 | 74.9 | 48.0 | 74.9 | 80.4 |
LC383470.1 (BRSP02) | Fox | 571 | 69.3 | 87.4 | 69.3 | 69.3 | 48.8 | 69.3 | 87.6 |
MF523230.1 (LD1508081502) | Fac | 544 | 74.7 | 80.4 | 74.7 | 74.9 | 48.2 | 74.9 | 80.4 |
MF326625.1 (IHBF 2204) | Ftr | 542 | 74.3 | 79.9 | 74.3 | 74.4 | 48.2 | 74.4 | 79.9 |
MF457482.1 (KB3) | Fox | 557 | 70.6 | 89.1 | 70.6 | 70.7 | 48.3 | 70.7 | 89.1 |
MF567508.1 (dmSON) | Cro | 613 | 85.5 | 67.1 | 85.5 | 85.6 | 45.7 | 85.6 | 67.0 |
MF663693.1 (VGCR16-3) | Cro | 525 | 98.7 | 77.2 | 98.7 | 98.9 | 46.9 | 98.5 | 77.2 |
MF671812.1 (VGCR15-7) | Cro | 527 | 98.9 | 77.4 | 98.9 | 99.1 | 46.7 | 98.7 | 77.4 |
MF671813.1 (VGCR15-10) | Cro | 527 | 98.9 | 77.4 | 98.9 | 99.0 | 46.7 | 98.7 | 77.4 |
MG543757.1 (LrBF39) | Fox | 519 | 76.0 | 96.2 | 76.0 | 76.1 | 49.2 | 75.9 | 96.2 |
MG547895.1 (no) | Ftr | 569 | 73.6 | 79.1 | 73.6 | 76.1 | 49.2 | 73.8 | 79.0 |
MH071359.1 (PFS1) | Ftr | 550 | 73.6 | 79.2 | 73.6 | 73.8 | 47.9 | 73.8 | 79.2 |
MH071363.1 (PFS6) | Ftr | 666 | 63.7 | 68.3 | 63.7 | 63.6 | 45.6 | 63.6 | 54.4 |
MH424135.1 (CR-BRK1) | Cro | 758 | 69.4 | 54.7 | 69.4 | 69.3 | 42.3 | 69.2 | 54.4 |
MH424143.1 (CZ-44) | Cro | 719 | 73.2 | 57.7 | 73.2 | 73.2 | 43.3 | 73.0 | 57.5 |
Numbers underlined in each column indicate the highest and lowest identities in each bulb rot strains. |