Ethical statement
This statement declares that the sample collection was collected from the naturally infected animals and was carried out as clinical, non-experimental work with completely adheres to the obligation rules of veterinary professionalism. The samples were collected under the supervision of expert veterinarians after the owner's permission. Strictly, the national, international, and institutional guidelines for sampling were intently followed after the ethical approval of the local ethics authorities in animal experimentation at the Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Egypt.
Virus isolation and specimens collection
Samples preparation: The clinical samples (i.e. Vesicular epithelium, Vesicular Fluid, and heart tissues) were collected from naturally infected animals in different notifiable epicenters (86 samples), obtained from Aswan, El-Wadi El-Gadid, Cairo, Giza, Suhag, Asyut, El-Menya, Beni-Suwayf, Kafr El-Sheik, Al-Fayyum, Al-Menofia, Kalyoubia, Daqahlyia, Al-Behera, Al-Gharbia,…etc) under the supervision of GOVS, Egypt. The samples were collected and prepared according to standard guidelines authorized by WOAH[24]. Briefly, in restricted biosafety level II, the tissue samples were ground using sterile sand. The tissue homogenate is subjected to the clarification step by a 10 minutes centrifugation for 3000 rpm at 4°C. The supernatant was aspirated for filtration using syringe filters (0.2nm filter, Corning) and subsequently subjected to a 3 hours incubation at room temperature with 1% of antibiotic solution (i.e. 100 IU/mL of Penicillin and 100 mg/mL of Streptomycin). Afterward, the processed sample suspension was preserved at -80°C till the application.
Virus isolation: In the biosafety level-II (BSL-II), the prepared tested samples were inoculated into the susceptible cell line (i.e. BHK-21 clone 13, adapted in Virology Lab., AHRI, Egypt). With 70-80% confluency, the samples were inoculated. The Virus-inoculated flasks were mediated in a minimum essential medium with Earles salts (E-MEM) and incubated in a 5% CO2 incubator. The flasks were monitored for 18-72 hours to figure the viral cytopathogenic effect out. Three successive inoculations were applied for confirmation of the pathogenic effect of the virus on cells followed by molecular confirmation.
Antigen detection using ELISA: The samples and positive tissue culture suspensions were initially investigated using the solid phase ELISA for the antigen detection of FMDV besides the serotyping distinguishing for O, A, C, Asia1, SAT1-2 (ISZLER, Biotechnology Laboratory, Brescia, Italy). The test procedures were performed according to the manufacturer's instructions.
The molecular investigation of the clinical samples using RT-PCR and Gene Sequencing
FMDV-nucleic acid extraction: In the line with the manufacturer's instructions, the viral genome extraction was carried out using the EasyPure viral-RNA kit (TransGen Biotech, Beijing, China). RNase-free water (30 µL) was added to a 200µL of the processed specimen. 10 minutes are the required time for the elution process at room temperature and the genomic extracts were subsequently subjected to the thermal amplification process directly or were preserved at -20°C for further applications.
The virus's existence in the clinical specimens: Based on the amplification of the most conserved segment of the FMDV-RNA polymerase gene (i.e. 3D), Quantitative Real-time Reverse-Transcription PCR (RT-qPCR) was carried out using pan-FMDV primers/probe set (Table 1) for 40 successive amplification [25]. Briefly, a TransScript® Probe One-Step qRT-PCR SuperMix (TransGen, Beijing, China) was used, and the amplification cycles were comprised of the designed thermal profile including reverse transcription at 45°C for 5 minutes, then a 2 min for initial denaturation was carried out at 94°C, and eventually 40 cycles of 94°C for 5 seconds and 60°C for 30 seconds with real-time exponential fluorescence data collection/each step.
Serotyping using One-Step Reverse-Transcription Polymerase Chain Reaction (RT-PCR) for the tested samples: A serotype-distinguishable protein, VP1 partial genomic analysis was used using three-selective primers for the three serotypes (i.e. A, O, and SAT2). The primers that target the variable region of the 1D codon of the viral RNA were attached in Table 1. The procedures were performed using the EasyScript One-Step RT-PCR SuperMix (TransGen, Beijing, China). Briefly, a 25 µL total volume of reactants (i.e. including 5 µL of extracted RNA, 12.5 µL of master mix, 0.4 of Enzyme mix, 3.1 µL of RNase-free water, 2 µL of the targeting primers (working concentration, 10µM) into the final volume). The thermal profile was carried out at 45°C for 25 minutes for the reverse transcription step, then 94°C for 5 min. Afterward, 40 successive cycles of 94°C for 45 sec. and 60°C for 1 min. and 72°C for 45 sec. Eventually, the final extension was applied at 72°C for 10 min. The PCR products were investigated by running after applying potential into a 1.2% agarose gel electrophoresis.
DNA sequencing: Basically, the modified Sanger method (di-deoxy chain-termination method) was used for the purified PCR product sequencing using the selected primers (Table 1). By conducting of BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher, USA). Forward and reverse primers (3.2 pmol) were used in two different reactions. In a thermocycler (T-100TM Thermal Cycler, Bio-Rad, USA), the thermal cycling was carried out at 96°C/1 minute, then 25 cycles at 96◦C for 10 sec, 50◦C for 5 sec, and 60◦C for 2 min. Ultimately, the sequencing-resulted product was purified and clarified by spinning in Centri-Sep™ Spin Columns (Thermo Fisher, USA) and using the electro-kinetic injection on capillary electrophoresis systems 3500 Genetic analyzers (Applied Biosystems, Japan). The investigated sequences were assembled and edited. The investigated nucleotide sequences were uploaded to GeneBank to allocate the foremost relevant accession numbers. Bioinformatics and computational analysis were performed to estimate the rate of mutation, substitutions, and nucleotide polymorphism, and design the phylogenetic tree. The similarity percentages of the investigated sequences were estimated using the Alignment tool provided by NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Phylogenetic analysis: Using ClustalW/Bio-edit software version 7.1 [26], and MEGA-X-software [27]–[29] for Neighbor-joining phylogenetic tree constructions. The robustness of the tree topology was assessed with 1000 bootstrap for more knowledge about FMDV topotypes as previously described [30], [31].
Table 1: The targeting Primers used in one-step RT-PCR for FMDV-serotyping
Serotype
|
Primer Designation
|
Primer sequence
(5'-3')
|
Ann. Temp.
|
Amplicon Size
|
Reference
|
All serotypes
|
1F
|
GCCTGGTCTTTCCAGGTCT
|
60°C
|
328 bp
|
[32]
|
1R
|
CCAGTCCCCTTCTCAGATC
|
(O forward)
|
O-1C583F
|
GACGGYGAYGCICTGGTCGT
|
60°C
|
842 bp
|
[33]
|
(A forward)
|
A–1C612F
|
TAGCGCCGGCAAAGACTTTGA
|
60°C
|
814 bp
|
[34]
|
SAT2 forward
|
SAT2-Egy-F
|
TGAYCGCAGTACACAYGTYC
|
60°C
|
666 bp
|
[35]
|
Reverse primer for (O, A, and SAT2)
|
EUR–2B52R
|
GACATGTCCTCCTGCATCTGGTTGAT
|
---
|
---
|
[34]
|