Construction of GFP reporter: The GFP coding sequence was amplified by PCR using pEGFP vector (Invitrogen) as DNA template in 2 separate fragments, named “exon 1” and “exon 2”. “Exon 1” was amplified using primers PC 20 (5′ ACGCTGGATCCATGGTGAGCAAGGGCGAGG 3′) and PC 21 (5′ GGAGTGAATTCACTCACCTCGGCGCGGGTCTTG 3′), flanked by BamHI and EcoRI restriction sites. “Exon 2” was amplified using primers PC 28 (5′ GAAACTGCGGCCGCCCACAGGTGAAGTTCGAGGGCGACACCC 3′) and PC 29 (5′ GCCGCTTCTAGATTACTTGTACAGCTCGTCCATGCC 3′), flanked by NotI and XbaI restriction sites. The intron sequence was amplified from AdML precursor, using plasmid pHMS388 (10). Primers used contained EcoRI and NotI restriction sites (PC26: 5′ GAAACTGAATTCACTCCCTCTCAAAAGCGGGC 3′, and PC 27: 5′ GAAACTGCGGCCGCAAAAAAAAGGGACAGGGTCAG 3′).
“Exon 1”, “exon 2” and the intron amplification products were separately cloned into pGEM-T easy vector (Promega), according to manufacturer’s instructions, and sequenced to confirm their integrity. After confirmation of sequence integrity, the fragments were sub-cloned into pcDNA 3.1(+) vector (Invitrogen), using BamHI and XbaI enzymes, resulting in the splicing reporter pGFP-spl. The pcDNA 3.1(+) vector contains ampicillin resistance gene and pUC19 origin of replication, suitable for maintenance in E. coli. It also contains CMV promoter, for high-level expression in mammalian cells, and geneticin resistance marker, allowing for transient selection in cell culture.
To insert snR38A sequence in the pGFP-spl intron, this sequence was firstly amplified from HeLa genomic DNA using primers PC 1: 5’ ATAGCCTCGAGCACAAGCCTATGATGG 3’ and PC 2: 5’ ATGATAAGCTTAAGCCTCAGAATAGA 3’, flanked by XhoI and HindIII restriction sites. The PCR product was then cloned in pGEM-T easy vector, according to manufacturer’s instructions. snR38A fragment was then sub-cloned into the pGEM-intron, and this intron carrying the snR38A was interchanged with the intron in pGFP-spl, to finally construct pGFP-spl-snR38A plasmid.
Cell culture and transfection: HEK-293T cells were cultivated in 100 mm plates in 10 mL of DMEM / F12 with 10% FBS; 3.2 g / L sodium bicarbonate (NaHCO3); in a humidified, controlled atmosphere incubator (5% CO2) at 37 °C. Transfections were performed when cells reached 70–80% confluence. 1.5 µg of each plasmid were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen), according to manufacturer′s instructions. pEGFP was used as a positive control. Transfected cells were selected using up to 1.6 mg/ml of geneticin (G418, Amresco). After selection, cells were collected and subjected to cell extract preparation.
Cell analysis by fluorescence microscopy: Transfected HEK293-T cells were analyzed by fluorescence microscopy to check for GFP expression. 48 h after transfection cells were visualized and photographed in a fluorescence microscope (Axio Vert. A1, Zeiss), at a 50X magnification. Non-transfected cells were used as a negative control. The photos were analyzed with the ImageJ software (1.46r, 32-bit version; Windows), to quantify the fluorescence intensity. For each cell group, 3 photos of different areas of the plates were analyzed, selecting the total area of each photo.
RNA analysis and real-time RT-PCR: Cells were collected and washed in PBS buffer (3.2 mM Na2HPO4, 0.5 mM KH2PO4, 1.3 mM KCl, 135 mM NaCl, pH 7.4). Cell extracts were prepared using buffer A (KCl 10 mM, MgCl2 1.5 mM, Tris-HCl 20 mM [pH 7.5], DTT 0.5 mM) followed by homogenization using Douncer. Total RNA was extracted from cellular extracts using Trizol reagent (Invitrogen), according to manufacturer’s instructions. After Trizol extraction, samples were precipitated using 3 M sodium acetate pH 5.2 and 100% ethanol. After resuspension, samples were used for cDNA synthesis using the Superscript kit (Invitrogen) and random primers. 100 ng of these cDNAs were analyzed by real-time RT-PCR, using SYBR Green® reagent (Thermo) to verify splicing efficiency. Two pairs of primers were used: for the exon junction and exon 2 (“mature RNA”) (primers PC 157: 5′ GCGCCGAGGTGAAGTTC 3′ and PC 156: 5′ GATGCCCTTCAGCTCGATGC 3′) and a pair annealing at both ends of the precursor (“total RNA”) (primers PC 155: 5′ GACGACGGCAACTACAAGAC 3′ and PC 156: 5′ GATGCCCTTCAGCTCGATGC 3′). The “mature RNA” amplicon was detected only when splicing reaction was successful. Importantly, splicing efficiency was measured as a ratio between mature mRNA and total RNA amplifications. Also, β-actin primers were used to normalize reactions (primers PC 168: 5′ ACCTTCTACAATGAGCTGCG 3′ and PC 169: 5′ CCTGGATAGCAACGTACATGG 3′).