Identification of maize kinases down-regulated by drought stress and other perturbations
The Genevestigator database [41] was used to select candidate genes responsive to stress. By analyzing the gene expression of plants subjected to drought treatments, promising targets were selected for further characterization, including Zm00001d028770, which encodes ZmDRIK1. The publicly available maize microarray data from Zheng et al. 2010 [40] was chosen to investigate RLKs showing downregulation under drought and upregulation under rewatering treatments in Han21 and Ye478 drought-tolerant and drought-sensitive maize lines, respectively. As one of the top 10 candidates, ZmDRIK1 showed differential expression log-ratio >2 in all 4 samples (both genotypes and treatment). All other transcriptional expression profiles of ZmDRIK1 under different perturbation conditions were analyzed from experimental data available in the Genevestigator database. The experimental data were retrieved from Genevestigator, analyzed and compiled using GraphPad Prism version 6.01 for Windows (GraphPad Software, La Jolla, USA). Unless otherwise specified, all the expression data were from the mRNA-Seq platform and were from the B73 inbred line.
Plant material and growth conditions
Maize (Zea mays) inbred line B73 were obtained from Maize Genetics Cooperation Stock Center (http://maizecoop.cropsci.uiuc.edu). Seeds were surface sterilized by immersion in 15% sodium hypochlorite solution containing 0.1% Tween 20 for 15 min followed by eight washes in distilled water. The seeds were enrolled in paper towel and incubated at 28°C for 72 h, and the seedlings were subsequently harvested or transplanted to pots containing a mixture of soil and vermiculite 1:1 (w/w) and grown for 15 days in a growth chamber at 28°C and 16/8 hours day/night. Leaves and roots were sampled and immediately frozen in liquid nitrogen before being used for qPCR and Western blot analysis. For the drought stress experiments, seedlings were grown in pots containing a mixture of sphagnum:perlite (7:1 v/v) supplied with PG Mix YARA 14-16-18 under controlled conditions of 25°C for 16 h light and ~ 45% relative humidity. Progressive drought stress was introduced 8 days after sowing by irrigation restriction for 9, 12 or 14 days, while control plants were well-watered. Leaves were harvested, immediately frozen in liquid nitrogen, and stored at -80°C before use.
Cloning, expression and purification of ZmDRIK1 kinase domain (ZmDRIK1-KD)
cDNA from the maize B73 inbreed line prepared from total RNA isolated from young leaves was used as a template for the amplification of a DNA fragment encoding the ZmDRIK1 kinase domain. Two forward primers (drik1-Arg187-F - TACTTCCAATCCATGCGAGCTAAGAAAATGGGAACCG); drik1-Lys217-F - TACTTCCAATCCATGAAACGATCAGAGCTGGAAACGG) and two reverse primers (drik1-Ser514-R - TATCCACCTTTACTGTCAGCTCTCAGAAGTCATAATCTCAAGC); drik1-Pro488-R - TATCCACCTTTACTGTCAAGGCCCTAGCGCGG) were designed. The combination of these primers generated four constructs spanning the ZmDRIK1 kinase domain (residues Arg187-Ser514; Lys217-Ser514; Arg187-Pro492; Lys217-Pro492). Amplicons were treated with T4-DNA polymerase for ligase-independent cloning (LIC) [67] and cloned in pNIC28a-Bsa4 [67]. Confirmation of positive clones was made by colony PCR and sequencing.
Plasmid pNIC28a-Bsa4 harboring each construct was transformed into BL21(DE3)-pRARE, and colonies were inoculated in 30 mL of LB medium and grown overnight in a shaker at 37°C. Cultures were diluted in 1.5 L of TB medium and grown until OD600 reached 1.5-2. Cultures were cooled to 18°C, and protein synthesis was induced overnight by 0.2 mM IPTG. Bacteria were harvested by centrifugation at 5,000 x g; 10 min; 4°C, suspended in 2x binding buffer (1x binding buffer is 50 mM HEPES pH 7.4, 500 mM NaCl, 5% glycerol, 10 mM imidazole, and 1 mM TCEP) with 1 mM of PMSF and stored at -80°C.
The suspended pellets were thawed, and the cells were lysed by sonication for 12 min (5 s ON; 10 s OFF; Amp 30%). One milliliter of 5% polyethyleneimine was added per 30 ml of lysate, and the lysate was then clarified by centrifugation at 40,000 x g; 45 min; 4°C. The supernatant was loaded onto an IMAC column (5 ml HisTrap FF Crude, GE Healthcare, Uppsala, Sweden), and contaminants were washed with a binding buffer with 30 mM imidazole. The recombinant protein was eluted with 300 mM imidazole in binding buffer. Eluted protein was treated with TEV protease to remove the 6xHIS-tag. Contaminants and the tag were removed using nickel beads, and the purified protein was loaded onto a size exclusion HiLoad 16/60 Superdex 200 pg (GE Healthcare, Uppsala, Sweden) column equilibrated with a gel filtration buffer (binding buffer without imidazole). Fractions of purified protein were pooled together and stored at -80°C.
Isothermal calorimetry
Isothermal calorimetry (ITC) was used to determine the interaction between ZmDRIK1-KDR187-S514 with nucleotides and small molecule ligands. For the nucleotide, 50 µM of purified ZmDRIK1-KDR187-S514 (cell) was titrated with 1 mM GTP or the ATP analog AMP-PNP (injectant) in ITC buffer containing 50 mM K-phosphate pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP and 5 mM MgCl2. For the small molecule ligands, 50 µM of ENMD-2076 (cell) was titrated with 300 µM of ZmDRIK1-KDR187-S514 (injectant) in ITC buffer without magnesium. ITC assays were performed in a MicroCal Auto iTC200 (GE/Malvern Panalytical, Northampton, UK), and titrations were carried out at 25°C with a stirring speed of 750 rpm and 300 s between each 2 mL injection. Controls with buffer and ligand alone were performed to verify the dilution heat and were subtracted from protein-ligand data. Protein concentrations used in this experiment were measured using Edelhock method [68]. Data were analyzed using NITPIC, version 1.2.2 and Sedphad, version 12.1b software. Figures were generated in GUSSI version 1.3.2 [69].
Crystallization, data collection, structure determination and refinement
ZmDRIK1-KD were crystallized in the apo form and bound to ENMD-2076. For the apo form, 857 µM of purified ZmDRIK1-KDR187-S514 was centrifuged for 10 min at 21,130 x g at 4°C, and a 150-nL-volume drop was pipetted by mixing purified protein and crystallization solution from the JCSG-plus HT96 (Molecular Dimension, Maumee, USA) crystallization screen at three ratios (2:1, 1:1, 1:2). For cocrystallization, purified ZmDRIK1-KDR187-S514 was incubated with ENMD-2076 at a threefold molar excess for 30 min on ice. Mixtures were centrifuged for 10 min at 21,130 x g at 4°C, and 150-nL-volume drops were pipetted at three ratios (2:1; 1:1; 1:2) using a custom optimization crystallization screen (Molecular Dimension, Maumee, USA). Crystallization plates were incubated at 20°C until crystals appeared. Crystals were cryoprotected in reservoir solution supplemented with 30% glycerol before flash-freezing in liquid nitrogen for data collection. Diffraction data were collected at the Advanced Photon Source (APS) or Diamond Light Source (DLS), integrated using XDS [70] and scaled using AIMLESS from the CCP4 software suite [71]. Molecular replacement (MR) was performed with Phaser [72] using the kinase domain of SUCROSE INDUCED RECEPTOR KINASE 1 (SIRK1) as the search model (PDB ID: 5UV4) [73]. Coot [74] was used for manual model building and refinement. Structure validation was performed using MolProbity [75]. Structure factors and coordinates (Table 1) were deposited in the Protein Data Bank with accession number 6CPY for the apo form and 6EAS for the cocrystal.
Differential scanning fluorimetry (DSF)
A cell-permeable ATP-competitive kinase inhibitor library from Selleckchem (Houston, TX, United States; catalog No. L1200) was screened to identify interactors for ZmDRIK1-KD. One microgram of each purified construct of ZmDRIK1-KD was mixed with DSF buffer (100 mM K-phosphate, 150 mM NaCl, 10% glycerol, and pH 7.5) containing 1:1000 SYPRO Orange Protein Thermal Shift Dye (Life Technologies Corporation, Eugene, USA) in a 384-well plate containing 10 µM of each library compound. As compound stocks were stored at 10 mM in 100% DMSO, a control with 0.1% DMSO was used as a reference. Plates were sealed using optically clear films, and fluorescence intensity data were measured in a temperature gradient from 25 to 95°C at a constant rate of 0.05°C/s in a QuantStudio 6 qPCR instrument (Applied Biosystems, Singapore). Protein melting temperature was calculated based on the Boltzmann function fitting to experimental data, as implemented in the Protein Thermal Shift Software (Applied Biosystems, Singapore). Compounds displaying a positive temperature shift (ΔTm) higher than 2°C compared to the control were considered positive.
Phylogenetic analyses
Amino acid sequences of ZmDRIK1-related plant RLK/Pelle-LRRs were retrieved from maize GDB [76], Phytozome12 [77], PLAZA 4.0 [78], TAIR [79], EnsemblPlants [80], and NCBI Databases [81] (Additional file 7: Table S2). The programs iTAK [82] and PlantsP [83] were used to annotate the kinase groups. Sequences were aligned using ClustalX [84], and the phylogenetic tree was generated with MEGA 6 [85] using the Neighbor-Joining method [86] and 1,000 bootstrap replicates. The evolutionary distances were computed using the Poisson correction method [87] and were expressed as units of amino acid substitutions per site. The analyses included all A. thaliana and Z. mays subfamily LRR-VI-2 representative proteins and orthologues of ZmDRIK1 from other species (Additional file 7: Table S2). The out-group sequences from Arabidopsis are represented by other subfamilies: catalytically inactive BSK8 [46], catalytically active SERK1 [88], BRI1 [89], and CLV1[90]. The RLK/Pelle subfamily groups are classified as proposed by Lehti-Shiu et al. 2009 [8] and 2012 [91].
Quantitative real-time PCR
Total RNA was extracted from the leaves and roots of 3- and 15-day-old B73 maize plants or leaves of drought stressed B73 maize. Samples were powdered in liquid nitrogen, and 100-200 mg powder was mixed with 1 mL of TRIzol (Invitrogen, Carlsbad, USA) and vortexed. After 10 min of incubation at room temperature, 200 μL of chloroform was added and vortexed briefly. Samples were centrifuged for 15 min at 12,000 x g at 4°C, the aqueous phase was collected, and RNA was purified using a PureLink RNA kit (Life Technologies, Carlsbad, USA) according to the manufacturer’s instructions. After checking for RNA quality and integrity by agarose gel, cDNAs were synthesized using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, USA). Five micrograms of total RNA were incubated with oligo dT20 and dNTP for 5 min at 65°C and then cooled on ice. Buffer, DTT and SuperScript enzyme were added and incubated for 60 min at 50°C. The enzyme was inactivated for 15 min at 70°C, and the cDNA was stored at -20°C until use.
Quantitative real-time PCR (qRT-PCR) was performed in a 10 µL reaction mixture using 5 µL of 2x Luna universal qPCR master mix (New England Biolabs), 0.5 µM of each primer (Additional file 8: Table S3) and 3 µL of 20-fold diluted cDNA. qRT-PCR was performed in QuantStudio 6 (Applied Biosystems, Singapore), and the PCR conditions were as follows: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 1 min. To analyze if single products were formed, a melting curve (starting at 60°C and increasing by 0.05°C/s until reaching 95°C) at the end of the qPCR was performed. The βTUB, CYP, and EIF4a genes were used as internal controls. qRT-PCR data were analyzed using QuantStudio Real-time PCR software (version 1.3), and graphics were made in Prism (version 8.0.1). Quantification was performed with the ΔΔCt method of three replicates and expressed as relative mRNA expression. Pairwise comparisons of mRNA levels between different tissues and plant age, or between drought-stressed and rewatered samples, were calculated using a two-tailed Student’s t-test. All data analyses were conducted using GraphPad Prism version 6.01 for Windows (GraphPad Software, La Jolla, USA).