Experimental animals.
The study has been reported in accordance with ARRIVE guidelines (24). C3H/He mice expressing transgenic wild type (WT) MHC-I allele H-2Kb (WTKbC3H) or cytoplasmic tail tyrosine mutant (ΔYKbC3H) have been previously described (17). The ΔYKb H2Db-/- and WTKb H2D-/- strains were generated by crossing H2Kb2Db double knockout (H2K-/-D-/-) with WTKbC3H and ΔYKbC3H strains, respectively. WTKbC3H and ΔYKbC3H strains were originally maintained on a C3H/He background and express MHC-I genes H2Kk and H2Dk as well as the knocked in transgenic H-2Kb gene (ΔYKb or WTKb). The mice were backcrossed onto a H2K-/-D-/- background (H2Kb2Db double knockout) for at least 10 generations while the original line was retired. Progeny of the crosses were genotyped by PCR and phenotyped by flow cytometry to establish the presence of MHC-I alleles H2Kk, Kb, Dk and Db as well as the disrupted H-2Kb and Db genes. PCR to detect presence of knocked in transgenic H-2Kb (ΔYKb or WTKb) used H-2Kb specific oligonucleotides, 5’-TCGCTGAGGTATTTCGTC-3’ and 5’-TTGCCCTTGGCTTTCTG T-3’. Primers used to detect MHC-I alleles H-2Kk and Dk were H2K&D(k)_fwd: 5'- GGAAGCCCCGGTTCATCTCT -3', H2K(k)_rev: 5'-ACAGCCGTACATCCGTTGGAAC-3' and H2D(k)_rev: 5’-CCGGACAACCGCTGG ATC-3’ (25-27). Expression of specific MHC-I molecules on the cell surface of lymphocytes was assessed by flow cytometry. Blood was collected from the saphenous vein in heparin-coated microvette tubes. To isolate peripheral blood leukocytes (PBLs), whole blood was transferred with 200 μL of phosphate-buffered saline (PBS) to BD Falcon 5 mL polystyrene round-bottom tubes. An 800 μL Ficoll gradient was applied and tubes were spun for 15 minutes at 500 x g. PBLs were recovered and washed twice in RPMI complete media (RPMI-1640 supplemented with 10% fetal calf serum). PBLs from progeny of H2Kb2Db double knockout (H2K-/-D-/-) with WTKbC3H and ΔYKbC3H strains were labelled using antibodies specific to extracellular domains of H-2Kb, Kk and Dk, respectively, and phenotyped by flow cytometry to establish the presence of MHC-I alleles H-2Kk, Kb, Dk and Db as well as the disrupted H-2Kb and Db genes.
Twelve-month-old mice were used for all neuronal and synapse morphology experiments. Mice were kept under a 12-hour light/dark cycle and fed standard lab chow and water ad libitum. All animal experiments and methods were performed at the University of British Columbia, Vancouver, BC, Canada and were conducted in compliance with the University of British Columbia Animal Care Committee under the direction of the Canadian Council for Animal Care.
Perfusion and tissue processing.
Mice were anesthetized with a mixture of Ketamine (100 mg/kg) and Xylazine (10 mg/kg) administered intraperitoneally, and transcardially perfused with 1% paraformaldehyde in PBS, followed by 4% paraformaldehyde with 0.125% glutaraldehyde in PBS as described previously (9, 28, 29). The brains were carefully dissected, postfixed overnight at 4°C in 4% paraformaldehyde in PBS with 0.125% glutaraldehyde and cut on a Vibratome (Leica, Buffalo Grove, IL). Brains samples were cut into 200 μm thick sections for neuronal morphology and spine analysis, 250 μm thick sections for electron microscopy (EM) and synapse analysis, and 50 μm sections for Nissl (0.5% cresyl violet in 0.3% acetic acid) to assess cytoarchitecture. All sections were stored at 4 °C in PBS with 0.01% sodium azide until ready for use.
Intracellular dye injections.
For intracellular injections, sections were incubated in 4',6-diamidino-2-phenylindole (DAPI, Sigma, St. Loius, MO) for 5 minutes to reveal the cytoarchitectural features of the pyramidal layer of CA1 of the hippocampus. The sections were then mounted on nitrocellulose membranes and immersed in PBS. Neurons were impaled with a sharp glass micropipette and loaded with 5% Lucifer Yellow in distilled water under a direct current of between 3 and 8 nA for 5-10 minutes, or until dye had completely filled distal processes and no further loading was observed, as described previously (9, 28, 29). Five to ten neurons were loaded per animal and spaced far enough apart from each other to prevent overlapping of dendrites. The sections were then mounted on gelatin-coated glass slides and cover slipped in Fluoromount G (Southern Biotech, Birmingham, AL).
Neuron and dendritic reconstruction.
To be included in the analysis, a loaded neuron had to satisfy the following criteria: (1) reside within the pyramidal layer of the CA1 as defined by cytoarchitectural characteristics; (2) demonstrate complete filling of dendritic tree, as evidenced by well-defined endings; and (3) demonstrate intact tertiary branches, with the exception of branches that extended beyond 50 μm in radial distance from the cell soma(9, 28, 29). Neurons meeting these criteria were reconstructed in three-dimensions (3D) with a 40×/1.4 N.A., Plan-Apochromat oil immersion objective on a Zeiss Axiophot 2 microscope equipped with a motorized stage, video camera system, and Neurolucida morphometry software (MBF Bioscience, Williston, VT). Using Neurolucida Explorer software (MBF Bioscience) total dendritic length, number of intersections, and the length of dendritic material per radial distance from the soma, in 30 μm increments were analyzed in order to assess neuronal morphological diversity and potential differences among animals (30).
Confocal Laser Scanning Microscopy and Spine Acquisition.
Using an approach that precludes sampling bias of spines, dendritic segments were selected with a systematic-random design (9, 28, 29). Dendritic segments, 20-25 mm in length, on secondary and higher order branches and at 50 and 100 mm from the soma, were imaged on the Zeiss LSM 510 confocal microscope (Zeiss, Thornwood, NY) using a 100x/1.4 N.A. Plan-Apochromat objective with a digital zoom of 3.5 and an Ar/Kr laser at an excitation wavelength of 488 nm. All confocal stacks were acquired at 512x512 pixel resolution with a z-step of 0.1 mm and approximately 1 mm above and below the identified dendritic segment, a pinhole setting of 1 Airy unit and optimal settings for gain and offset. On average 3 z-stacks were imaged per apical and basal tree and 5 neurons per animal. In order for a dendritic segment to be optimally imaged it had to satisfy the following criteria: (1) the entire segment had to fall within a depth of 50 mm; (2) dendritic segments had to be either parallel or at acute angles to the coronal surface of the section; and (3) segments did not overlap other segments that would obscure visualization of spines (9, 28, 29). To improve voxel resolution and reduce optical aberration along the Z-axis, the acquired images were deconvolved using an interactive blind deconvolution algorithm (AutoDeblur version 8.0.2; MediaCybernetics, Rockville MD).
Spine Analysis.
After deconvolution, the confocal stacks were analyzed using NeuronStudio software (31, 32) (http://www.mssm.edu/cnic) to examine global and local morphometric characteristics of dendritic spines, such as density, shape (stubby, mushroom, and thin), diameter and head volume. This software allows for automated digitization and reconstructions of 3D neuronal morphology from multiple confocal stacks on a spatial scale and averts the subjective errors encountered during manual tracing using a Rayburst-based spine analysis (31, 32). A spine was labelled thin or mushroom if the ratio of its maximum head diameter to maximum neck diameter was > 1.1. Spines that fit those criteria and had a maximum head diameter of < 0.35 µm were classified as thin spines, and otherwise they were classified as mushroom spines.
Electron microscopy.
Coronal sections encompassing the CA1 region of the hippocampus were prepared for EM as reported previously (9, 29, 33). Briefly, slices were cryoprotected in graded PBS/glycerol washes at 4°C, and manually microdissected to obtain blocks containing the CA1 region. The blocks were rapidly freeze-plunged into liquid propane cooled by liquid nitrogen (-190 °C) in a universal cryofixation system KF80 (Reichert-Jung, Depew, NY) and subsequently immersed in 1.5% uranyl acetate dissolved in anhydrous methanol at -90°C for 24 hours in a cryosubstitution unit (Leica). Block temperatures were raised from -90 to -45°C in steps of 4 °C/hour, washed with anhydrous methanol, and infiltrated with Lowicryl resin (Electron Microscopy Sciences, Hatfield, PA) at -45 °C. The resin was polymerized by exposure to ultraviolet light (360 nm) for 48 hours at -45 °C followed by 24 hours at 0 °C. Block faces were trimmed and ultrathin sections (90 nm) were cut with a diamond knife (Diatome, Hatfield, PA) on an ultramicrotome (Reichert-Jung) and serial sections were collected on formvar/carbon-coated nickel slot grids (Electron Microscopy Sciences).
Quantitative analyses of synapse density.
For synapse quantification, serial section micrographs were imaged at 15,000x on a Hitachi H-7000 transmission electron microscope using an AMT Advantage CCD camera (Advanced Microscopy Techniques, Danvers, MA). Nine sets of serial images across the same set of 5 consecutive ultrathin sections were taken from the stratum radiatum of the hippocampal CA1 field and imported into Adobe Photoshop (version CS5, Adobe Systems, San Jose, CA). To obtain a stereologically unbiased population of synapses for quantitative morphologic analysis, we used a disector approach on ultrathin sections as in previous reports (9, 29, 34). Briefly, all axospinous synapses were identified within the first and last 2 images of each 5-section serial set, and counted if they were contained in the reference image but not in the corresponding look-up image. To increase sampling efficiency, the reference image and look-up image were then reversed; thus each animal included in the current study contributed synapse density data from a total of 18 disector pairs. The total volume examined was 11.317 μm3, and the height of the disector was 180 nm. Axospinous synapse density (per μm3) was calculated as the total number of counted synapses from both images divided by the total volume of the disector. The criteria for inclusion as an axospinous synapse included the presence of synaptic vesicles in the presynaptic terminal and a distinct asymmetric PSD separated by a clear synaptic cleft. The synapse density was calculated as the total number of counted synapses divided by the total volume of the disectors used. For a synapse to be scored as perforated, it had to display two or more separate PSD plates. Other ultrastructural synaptic parameters including PSD length and maximum spine HD were determined using a method previously described (29, 34). Briefly, all axospinous synapses in the middle portion of three serial sections were identified. Then, for each synapse, the longest PSD length and spine HD in 3 serial sections was identified and measured. For perforated synapses, the lengths of all PSD segments were summed and the total length was used in the statistical analyses.
Statistical Analysis.
For all the morphology studies, mean values from single cells were obtained and then averaged for each animal and were used for comparison of means. Synapse densities, PSD length, and synapse head diameter were analyzed using a one-way ANOVA with Bonferroni’s post-hoc tests comparing each genotype to the other. All data were represented as mean ± SEM. All statistical analyses were carried out using Prism software (GraphPad).