Effect of Lactobacillus brevis (MG000874) on Antioxidant Related Genes Expression of liver and kidney in d-galactose Induced Oxidative stress Mice Model”

DOI: https://doi.org/10.21203/rs.3.rs-2059603/v1

Abstract

Oxidative stress connected with several stress-associated diseases. Potent radical-scavenging activity of Latic acid bacteria had been stated due to its ridiculous antioxidant activity. This work designed to find the defensive effects of Lactobacillus brevisMG000874 against oxidative injuries induce by d-galactose in vivo and as well as to explore the gene expression changes in oxidative stress induce mice. D-galactose (D-gal) induction (300mg/BW) in mice raised the levels of SOD (superoxide dismutase) and CAT (catalase) determined by spectrophotometer. In addition, Lactobacillus brevis MG000874 altered gene expression of oxidative stress marker at the messenger RNA (mRNA) levels was determined by RT-PCR. In the mouse model, L. brevis MG000874 significantly improved the GST, GPX, SOD, CAT and B-actin levels in kidney, and liver of the D-gal-induced mice. Moreover, the histological investigation indicated that Lactobacillus brevis MG000874 effectively relieved kidney and liver damage in mice induced by D-gal. L. brevis MG000874 as a powerful antioxidant mediator endorsed fitness and lessened the risk of stress-linked diseases.

Introduction

Aging is a time-dependent irresistible natural physiological decline phenomenon in organism life which insinuates with many physiological and metabolic dysfunctions. Free radical philosophy is one of the most demanding action mechanism in aging cases. Though the manifestation of aging cannot be eluded completely, but it can postpone by scientific approaches (Stroustrup 2018). The aging phenomenon is mysterious and complicated, numerous literature has presented the significant role of oxidative stress in accelerating aging. The stability of reactive oxygen species (ROS) and antioxidants become unstable with the escalation of age, which leads to oxidative damage of lipids, proteins, DNA, and a progressive increase in the chance of mortality and morbidity (Liguori et al. 2018).

It has been proposed that long life may be associated with several elements, for instance inheritances, surroundings and configuration of gut microbiota (Zhao et al. 2011; Biagi et al. 2015). Probiotics comprising Lactobacillus and Bifidobacterium have appealed considerable attention due to their vital role in health promotion. The important purpose of isolating probiotics from all over the world is the production of healthy organisms, particularly with prolonged existence (Woo et al. 2014). The antioxidant capability of lactic acid bacteria (LAB) and their constituents (e.g., proteins and exopolysaccharides) is normally specified and considered as standard for assessment of probiotic functions (Li et al. 2015). Assessment of antioxidant properties comprises in vitro oxidation reaction system (free radicals scavenging, metal ions chelation, and lipid peroxidation inhibition) (Kumar et al. 2019), and in vivo animal confirmation by detecting alteration in the antioxidant enzyme system, e.g. CAT (Catalase), GPX (Glutathione peroxidase), SOD (Superoxide dismutase), and MDA (Malondialdehyde) (Hassani et al. 2018; Lin et al. 2018). Zhang et al. (2010) studied a hyper lipidemic model rat, and demonstrated that Lactobacillus casei helped in reduction of lipid peroxidation by alleviating oxidative stress in liver and serum of the rat. Kanno et al. (2012) reported that Lactobacillus plantarum 7FM10 isolated from plants exhibited superoxide radical and 2,2-diphenyl-1-picrylhydrazyl (DPPH) scavenging capabilities in vitro. Therefore, selection of LAB having quenching ability of free radicals becomes more significant in investigating the mechanism of antioxidant. Literature revealed that high concentration of D-galactose (D-gal) helped in the generation of ROS by accumulation of advanced glycation end products, as a result oxidative stress and cellular damage produced in the tissues (Shwe et al. 2018; Du et al. 2019). To date, several reports pertaining to antioxidant evaluation of LAB have been published; however, a systematic evaluation of the antioxidant mechanism from the gene expression level of mice, has been reported rarely. In our previous study, we investigated the L. brevis MG000874’s effect on antioxidant enzyme system by inducing d-galactose (Noureen et al. 2019). The current study was therefore to examine the effect of the L. brevis MG000874 on the gene expression of oxidative stress markers in D-gal induced mice. 

Material And Method

Hydrogen peroxide (H2O2) (Daejung, Siheung-si, Korea), pyrogallol (sigma), D-galactose, (Germany), ascorbic acid (Germany), RNA extraction kit, Syber green master mix, and cDNA extraction kit were procured from local dealer. 

Bacterial culture

The strains of bacteria were incubated at 37°C by culturing in MRS broth (pH 6.6 ±02) overnight. For further study, bacterial cells were made by following Lin and Yen (1999) method.

In vivo evaluation of antioxidant prospective 

Sixty days old male albino mice (Mus musculus, Weight: 40± 2 g, n=60) was set aside in cages under schematized circumstances (temperature 22± 2°C, dampness 45± 5%, 12 hour light/ dark cycles). During the experiments, open access was provided for water and food. The mice were indiscriminately distributed after one week of acclimatization into six groups. These groups were negative control group (N): no treatment, probiotic cells, treatment group with L. brevis MG000874 (B), positive control (G): D-galactose treatment group (300mg/BW), ascorbic acid treatment group (A), D-galactose and L. brevis MG000874 treatment group (BG), D-galactose and ascorbic acid treatment group (AG)

Dose setting

L. brevis (MG000874) and ascorbic acid were given via gastric gavage (Shen et al. 2011: Noureen et al. 2019). D-gal was injected at the dose of 300 mg kg-1 BW/ day through subcutaneous route for 5 weeks; on the behalf of many pilot studies for quick aging process (data not included). Anaesthetized the Animals after five weeks of treatment. Organ index and tissues (Kidney and Liver) were prepared by following Noureen et al (2019). 

Estimation of antioxidants

The antioxidant level in the liver and kidney were estimated through SOD and CAT. The detailed procedure of above parameter has been described in previous studies (Noureen et al. 2019).

 Histopathological studies

For the histopathological study, fixed tissues in formalin were processed through Hematoxylin and Eosin staining (Qui et al. 2017). Slides observed in the light microscope having fitted camera (Labomed, USA).

Extraction of RNA and preparation of CDNA 

RNA was extricated from tissues following TRIzol method (Chomczynski and Sacch 2006). The purity and quantity of attaining RNA (Ribonucleic acid) were estimated through ND-1000 (Nanodrop, Thermo Fisher Scientific). CDNA (Complementary DNA) was made through Synthesis Kit (First-Strand CDNA kit).

Real-time PCR (Rt PCR)

RNA expression of SOD, CAT, GST, GPX and ß-actin was investigated by means of RT-PCR. Each primer sequence’s detail was provided in Table 1.  Concisely, qPCR reaction mixture (20 µl) contained CDNA (01 µl), primer (1.4 µl), SYBR Green master mix (12.5 µl) and nuclease-free water (9.5 µl). 40 cycles of qPCR were done on an RT-PCR system (Bio-Rad CFX): 3 min denaturation at 95 °C, 10 s, annealing at 54-59 °C and 30 s elongation at 72 °C. The expression of mRNA was determined by average quantification cycle (Cq) values. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) was used as a reference gene (Eissa et al. 2016). The expression was calculated by following

Normalized expression ratio (NER) = 2-ΔΔCt 

ΔΔCt = ΔCt(SOD) - ΔCt(GAPDH)

ΔCt(SOD) = Sample Ct(SOD) - reference sample Ct(SOD)  

ΔCt(GAPDH) = Control Ct(GAPDH) - reference of control Ct(GAPDH) 

Statistical analysis 

One-way ANOVA was performed for group comparison (P-values ˂0.05, significant: Tukey’s test) by using ‘IBM SPSS 21.0. Tests were done in triplicate and their outcomes were displayed as standard error of means (SEM). 

Results

Organ index 

Table 2 revealed that the indexes of liver and kidney in the stress group (G) were significantly lesser than those in the normal group (N: p < 0.05), presenting that induction of d-galactose was the cause of organ stress or aging. However, the liver and the kidney index of treated groups BG and AG were significantly higher than those in the G group showed more observable effects on inhibiting organ aging.

SOD and CAT activities in Liver and Kidney tissues

The activities of SOD and CAT in the liver and Kidney of the d-galactose   group (G) were the lowest (Figure 1). Following treatment with L. brevis MG000874 (BG), or ascorbic acid (AG), the activities of SOD, and CAT were improved. Particularly, these activities in mice treated with L. brevis MG000874 (B) or ascorbic acid (A) group were very close to normal group (N), illustrating that of L. brevis MG000784 and ascorbic acid were better at delaying the stress factor.

Histological examination of mice liver and kidney

The liver photomicrograph was displayed in Figure 2. Liver cell morphology of normal group (N) was consistent, no infection traces found, the size and staining were even, the cell line was organized in sequence and the central vein was spread radially. Although, in comparison to d-galactose group (G), hepatocytes were messy and showed uneven morphology, cell inflammation, deficiency of cell margin and a rough shape of the central vein. Those mice treated with L. brevis MG000874 or ascorbic acid displayed less injury. In the L. brevis MG000874 treated group (BG), liver damage was less than d-galactose group (G), and thus, the efficacy of L. brevis MG000874 in inhibiting liver deterioration was better. 

The kidney photomicrograph were shown ( Figure 3) that the Bowman‘s capsule of N and B group had normal distal convoluted tubules, vascular pole, renal parenchyma, inner cellular layer of podocytes and outer squamous capsular cells. Glomerulus had no traces of proteinaceous substances in urinary spaces (Fig 2a & c). In stress group (G), degeneration of renal parenchyma, some cellular necrosis of tubular epithelial and pyknotic nuclei, disappearance of proximal and distal convoluted tubules spaces were detected. Morphology of kidney tissue in L. brevis MG000874 treatment group (BG) and ascorbic acid treatment group (AG) was significantly improved and revealed similar micrographs as normal group (N).

Liver gene expression content

SOD, CAT, GST, GPX and B- actin gene expression of liver tissues was determined by RT-PCR (Figure 4). In normal control group (N), the expression levels of SOD, CAT, GST, GPX and B-actin were the highest. However, in the d-gal group (G), the mRNA expression levels of the above genes were reversed. In treatment group BG and AG, the expression of SOD, CAT, GST, GPX and B- actin was significantly improved (p < .05).                                                

Kidney gene expression content

The gene expression level of Kidney tissue was presented in Figure 5. The mRNA expression of SOD, CAT, GST, GPX and B- actin of the normal group (N) in comparison to d-gal group (G) was lowest. In treatment group with ascorbic acid (AG), or L. brevis MG000874 (BG), the mRNA expression of SOD, CAT, GPX, GST and B- actin was increased. The expression of L. brevis MG000874 alone treatment group (B) was highest in comparison to N group, which was stronger than that of ascorbic acid.

Discussion

Lactic acid bacteria (LABs) are very important acidic bacteria, renowned their distinct physiological roles, have special enzymes, and produces many substances during fermentation. They have a great influence on human life and are commonly utilized in many industries like poultry, livestock and food production (Landete et al. 2017; Ramos et al. 2020). LABs strains isolated from different sources like plants and animals that may have antioxidant activity (Kenfack et al. 2018; Rezaei et al. 2020; Unban et al. 2021). This trait is strain and species specific. Therefore, we aimed at finding the antioxidant potential of the L. brevis MG000874 strain isolated from animal. In the mice model, the constant sub cut d-galactose injection has been revealed to stimulate stress by increase production of the free radicals and a depletion of the antioxidant activity leading to oxidative stress. The stress-affiliated mechanisms may be damaged by the extraordinary production of reactive free species (Ge et al. 2021). Thus, we designated the d-galactose-induced oxidative stress mice model to find the effects of the L. brevis MG000874 as antioxidant on gene expression of stress markers in liver and kidney. In our previous study, we injected the 150mg/Kg/body weight d-galactose in mice for inducing oxidative stress at eight weeks (Noureen et al. 2019). In the current study, we selected the high dose of d-galactose 300mg/kg/BW for quicker result. At this dose the aging sign and symptoms was appeared within four weeks in mice model. An important and basic indicators in biomedical research for observing the stress effects are the organ index in mice. In the stress body, atrophy of the liver is more noticeable (Xu et al. 2016). An immune organ of animal is liver and its atrophy may source of immune deficiency (Knolle and Gerken 2000). Literature revealed that the liver index of oxidative stress mice was considerably decreased as compared to the normal mouse liver (Sang et al. 2017). The metabolic organ is the kidney, and a decrease in kidney index has a great influence on the metabolic ability (Xu et al. 2018). Thus, alterations in the organization of mouse organ can be noted in organ index and are significantly important for evaluating the successful induction of oxidative stress in mice (Bonthius et al. 2015; Sang et al. 2017). The outcomes of this study presented that d-gal caused the atrophy of organs and induction of oxidative stress in mice. Oxidative stress processing was efficiently postponed by treating with L. brevis MG000874 (109 cfu/kg), proposing the noticeable anti-stress effect of L. brevis MG000874. Histopathological inspection is the microscopic study of the cells, tissues or organ morphology in order to verify the body changes (Di et al. 2016; Qian et al. 2018). This study revealed that liver and kidney tissues of the d-gal group in comparison to normal group were deteriorated. In treatment with L. brevis MG000874 (BG) or ascorbic acid (AG), the morphological abnormalities of the liver and kidney tissues was considerably upgraded, and the upgrading impact of L. brevis MG000874 was the most noticeable. Tissue morphology of L. brevis MG000874 treated group was very close to the normal group (N). 

During the process of bio-oxidation, a huge quantity of ROS is generated in the body. The stability of ROS is attained by numerous antioxidant defence systems, containing, SOD, CAT, GST, GSH, and vitamins. Their synergistic influence transforms excessive ROS into O2 and H2O2 molecules (Zhang et al. 2008). LABs have specific antioxidant ability for quenching free radicals, which can support the antioxidant enzymes. Antioxidant activity is a strain specific feature. Additionally, during the metabolic process of the body, LABs prevent the oxidation process by discharged of antioxidant enzymes such as SOD (Lobo et al. 2010; Feng et al. 2016). In this study, the L. brevis MG000874 significantly elevated the SOD activity and CAT activity in kidney and liver tissue of the treated mice. The experimental outcomes confirmed that the induction of d-gal causes the cellular oxidative stress, resulted in decrease SOD and CAT activity in liver and kidney tissues. Ascorbic acid or L. brevis MG000874 was good in the antioxidant effect during the measurement of SOD and CAT stress indicators in tissues.

To further enlighten the antioxidant, this research has observed the changes in SOD, CAT, GST, GPX and B-actin expression levels of. In animals, SOD is universally expressed as mitochondrial antioxidant enzyme and helps in controlling free radical’s production by keeping healthy (Zhao et al. 2018). CAT functions as scavenging O- free radicals and stimulating the disintegration of H2O2 by preventing oxidation damage (Selvaratnam and Robaire 2016). Literature revealed that the oxidative stress causes the tissue atrophy by dropping SOD and CAT expression (Hart et al. 2015). The outcomes of this study revealed that mRNA expression levels of SOD and CAT in the liver and kidney tissues of the d-gal control group were significantly reduced (p < 0.05), representing that d-gal subcutaneous injection in mice might cause oxidative stress. Though, mRNA expression levels were significantly improved in treatment with L. brevis MG000874 (p < 0.05). GST is a broad spectrum antioxidant. GPx may be used to regulate the intracellular hydro peroxide level in the gastrointestinal tract (Yan and Chen 2006). ß-actin is main structural proteins of cytoskeleton which play a significant part in retaining the shape of the cell (Mousa et al. 1979). We found that GST, GPX and ß-actin expression levels were positively upregulated by L. brevis MG000874 in d-gal-induced model mice. These reports indicated that L. brevis MG000874 could perform as antioxidant which might directly hunt ROS. 

Lastly, histological investigation verified that cellular inflammation, and apoptosis of hepatocytes were greater in the d-gal alone group and treatment with L. brevis MG000874 showed normal hepatocytes with congested sinusoids in liver. While in kidney, disintegration of renal parenchyma, some cellular necrosis and vanishing of tubules spaces were identified in the stress group as compared to L. brevis MG000874 treatment group (BG). L. brevis MG000874 (probiotic) possessed a renal hepatic protective influence through raising activities of antioxidant enzymes (i.e., SOD, CAT) on d-gal inducted stress (BG) and maintaining the cellular structure. These consequences were also connected to the stimulation of the antioxidant defence system by boosting SOD, CAT, GST, GPX and ß-actin controlled gene expression. Our findings further proposed that L. brevis MG000874 could maintain the intracellular redox balance in the livers and kidney of D-gal-treated mice by renewing the activities of antioxidant enzymes.

Conclusion

The current investigation found that L. brevis MG000874 has an antioxidants effect. Induction of D-gal initiated the oxidative stress, reduced the antioxidant enzyme activity. Supplementation of L. brevis MG000874 or ascorbic acid resulted in body weight gain, and organ index, restored the antioxidant defense system by increasing the antioxidant enzyme activity and upregulating the gene expression. As a whole, these finding verified that L. brevis MG000874 promoted the antioxidative gene expression and cellular antioxidative responses in vivo. Therefore, L. brevis MG000874 will have the potential to be further explored as an antioxidant functional food in the prevention of more stress-related diseases.

Declarations

Authors Contribution

Saleha Noureen: conceptualization, methodology, analysis, data curation and writing - original draft. Tanveer Hussain: Analysis,   Aasma Noureen: reviewing and editing, Ahmed E. Altyar: reviewing and editing.

Funding

 This research was funded by NAHE Higher Education Commission of Pakistan through grant no 532/IPFP-II (Batch-I)/SRGP/NAHE/HEC/2020/130.

Data availability 

All data generated or analyzed during this study are included in this published article (and its Supplementary information files).

Ethics approval and consent to participate: The protocol for these experiments was approved by the Animal Ethics Committee of Virtual University of Pakistan. 

Consent for publication: Not applicable

Competing interests: The authors declare no competing interests

References

  1. Biagi E, Zama D, Nastasi C, Consolandi C, Fiori J, Rampelli S, Turroni S, Centanni M, Severgnini M, Peano C, De Bellis G (2015) Gut microbiota trajectory in pediatric patients undergoing hematopoietic SCT. BMT 50:992-998. DOI: 10.1038/bmt.2015.16.
  2. Bonthius JDJ, Winters Z, Karacay B, Bousquet SL, Bonthius DJ (2015) Importance of genetics in fetal alcohol effects: Null mutation of the nNOS gene worsens alcohol-induced cerebellar neuronal losses and behavioral deficits. Neurotoxicol 46:60-72. DOI: 10.1016/j.neuro.2014.11.009.
  3. Chomczynski P, Sacchi N (2006) The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat protoc 1:581-585. doi:10.1038/nprot.2006.83.
  4. Claiborne AL (2018) Catalase activity. In CRC handbook of methods for oxygen radical research ed. Greenwald R.A. pp. 283-284. Boca Raton, FL: CRC press.
  5. Di Meo S, Reed TT, Venditti P, Victor VM (2016) Role of ROS and RNS sources in physiological and pathological conditions. Oxid Med Cell Longev 2016:1-44. DOI: 10.1155/2016/1245049.
  6. Du HM, Wang YJ, Liu X, Wang SL, Wu SM, Yuan Z, Zhu XK (2019) Defective central immune tolerance induced by high-dose D-galactose resembles aging. Biochem 84:617-626. DOI: 10.1134/S000629791906004X
  7. Eissa N, Hussein H, Wang H, Rabbi MF, Bernstein CN, Ghia JE (2016) Stability of reference genes for messenger RNA quantification by real-time PCR in mouse dextran sodium sulfate experimental colitis. PloS One 11:e0156289. DOI:10.1371/journal.pone.0156289
  8. Feng Y, Yu YH, Wang ST, Ren J, Camer D, Hua YZ, Zhang Q, Huang J, Xue DL, Zhang XF, Huang XF (2016) Chlorogenic acid protects D-galactose-induced liver and kidney injury via antioxidation and anti-inflammation effects in mice. Pharm Biol 54:1027-1034. DOI: 10.3109/13880209.2015.1093510
  9. Ge Q, Yang B, Liu R, Jiang D, Yu H, Wu M, Zhang W (2021) Antioxidant activity of Lactobacillus plantarum NJAU-01 in an animal model of aging. BMC Microbiol 21:1-9. DOI: 10.1186/s12866-021-02248-5
  10. Hart P, Mao M, de Abreu A, Fricano K, Ekoue D, Minshall R, Diamond A, Bonini M (2015) MnSOD/SOD2 upregulation sustains the Warburg effect via mitochondrial ROS and AMPK‐dependent signaling in cancer. The FASEB J 29:884-62. DOI: 10.1038/ncomms7053
  11. Hassani S, Maqbool F, Salek-Maghsoudi A, Rahmani S, Shadboorestan A, Nili-Ahmadabadi A, Amini M, Norouzi P, Abdollahi M (2018) Alteration of hepatocellular antioxidant gene expression pattern and biomarkers of oxidative damage in diazinon-induced acute toxicity in Wistar rat: a time-course mechanistic study. EXCLI J 17:57. DOI: 10.17179/excli2017-760
  12. Kanno T, Kuda TAnC, Takahashi H, Kimura B (2012) Radical scavenging capacities of saba-narezushi, Japanese fermented chub mackerel, and its lactic acid bacteria. LWT-Food Sci Technol 47:25-30. DOI: 10.1016/j.lwt.2012.01.007
  13. Kenfack CHM, Ngoufack FZ, Kaktcham PM, Wang YR, Zhu T, Yin L (2018) Safety and antioxidant properties of five probiotic Lactobacillus plantarum strains isolated from the digestive tract of honey bees. Am J Microbiol Res 6:1-8. DOI: 10.12691/ajmr-6-1-1
  14. Knolle PA, Gerken G (2000) Local control of the immune response in the liver. Immunol rev 174:21-34. DOI: 10.1034/j.1600-0528.2002.017408.x
  15. Kumar R, Gupta A, Ganguly R, Pandey AK (2019) In-vitro Models to Assess Antioxidant Potential. In Phytochem: An in-silico and in-vitro Update (pp. 237-250). Springer, Singapore. https://link.springer.com/chapter/10.1007/978-981-13-6920-9_12
  16. Landete JM, Gaya P, Rodríguez E, Langa S, Peirotén Á, Medina M, Arqués JL (2017) Probiotic bacteria for healthier aging: immunomodulation and metabolism of phytoestrogens. BioMed Res Int 2017:1-14. DOI: 10.1155/2017/5939818
  17. Li JJ, Zhu Q, Lu YP, Zhao P, Feng ZB, Qian ZM, Zhu L (2015) Ligustilide prevents cognitive impairment and attenuates neurotoxicity in D-galactose induced aging mice brain. Brain Res 1595:19-28. DOI: 10.1016/j.brainres.2014.10.012.
  18. Liguori I, Russo G, Curcio F, Bulli G, Aran L, Della-Morte D, Gargiulo G, Testa G, Cacciatore F, Bonaduce D, Abete P (2018) Oxidative stress, aging, and diseases. Clin Interv Aging, 13:757. DOI: 10.2147/CIA.S158513.
  19. Lin X, Xia Y, Wang G, Xiong Z, Zhang H, Lai F, Ai L, (2018). Lactobacillus plantarum AR501 Alleviates the Oxidative Stress of D‐Galactose‐Induced Aging Mice Liver by Upregulation of Nrf2‐Mediated Antioxidant Enzyme Expression. J Food Sci 83:1990-1998. DOI: 10.1111/1750-3841.14200.
  20. Lobo V, Patil A, Phatak A, Chandra N (2010) Free radicals, antioxidants and functional foods: Impact on human health. Pharmacogn Rev 4:118. DOI: 10.4103/0973-7847.70902.
  21. Marklund S, Marklund G, (1974) Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47:469-474. DOI: 10.1111/j.1432-1033.1974.tb03714.x
  22. Noureen S, Riaz A, Arshad M, Arshad N (2019) In vitro selection and in vivo confirmation of the antioxidant ability of Lactobacillus brevis MG 000874. J Appl Microbio 126:1221-1232. DOI: 10.1111/jam.14189.
  23. Qian YU, Zhang J, Zhou X, Yi R, Mu J, Long X, Pan Y, Zhao X, Liu W (2018) Lactobacillus plantarum CQPC11 isolated from sichuan pickled cabbages antagonizes d-galactose-induced oxidation and aging in mice. Molecules 23(11):3026. DOI: 10.3390/molecules23113026
  24. Qiu Y, Ai PF, Song JJ, Liu C, Li ZW (2017) Total flavonoid extract from Abelmoschus manihot (L.) medic flowers attenuates d-galactose-induced oxidative stress in mouse liver through the Nrf2 pathway. J Med Food 20:557-567. DOI: 10.1089/jmf.2016.3870
  25. Ramos OY, Basualdo M, Libonatti C, Vega MF (2020) Current status and application of lactic acid bacteria in animal production systems with a focus on bacteria from honey bee colonies. J Appl Microbiol 128:248-1260. https://doi.org/10.1111/jam.14469
  26. Rezaei M, Noori N, Shariatifar N, Gandomi H, Basti AA, Khaneghah AM (2020) Isolation of lactic acid probiotic strains from Iranian camel milk: technological and antioxidant properties. LWT 132:109823-109831. https://doi.org/10.1016/j.lwt.2020.109823.
  27. Sang Y, Zhang F, Wang H, Yao J, Chen R, Zhou Z, Yang K, Xie Y, Wan T, Ding H (2017) Apigenin exhibits protective effects in a mouse model of d-galactose-induced aging via activating the Nrf2 pathway. Food funct 8:2331-2340. https://doi.org/10.1016/j.jff.2020.103957.
  28. Selvaratnam JS, Robaire B (2016) Effects of aging and oxidative stress on spermatozoa of superoxide-dismutase 1-and catalase-null mice. Biol Reprod 95:60-1. DOI: 10.1095/biolreprod.116.141671
  29. Shen Q, Shang N, Li P (2011) In vitro and in vivo antioxidant activity of Bifidobacterium animalis 01 isolated from centenarians. Curr Microbiol 62:1097-1103. DOI: 10.1007/s00284-010-9827-7
  30. Shwe T, Pratchayasakul W, Chattipakorn N, Chattipakorn SC (2018) Role of D-galactose-induced brain aging and its potential used for therapeutic interventions. Exp Gerontol 101: 13-36. DOI: 10.1016/j.exger.2017.10.029
  31. Stroustrup N (2018) Measuring and modeling interventions in aging. Curr Opin Cell Biol 55:129-138. DOI: 10.1016/j.ceb.2018.07.004
  32. Unban K, Chaichana W, Baipong S, Abdullahi AD, Kanpiengjai A, Shetty K, Khanongnuch C (2021) Probiotic and antioxidant properties of lactic acid bacteria isolated from indigenous fermented tea leaves (Miang) of north thailand and promising application in synbiotic formulation. Fermentation 7:195. https://doi.org/10.3390/fermentation7030195
  33. Woo JY, Gu W, Kim KA, Jang SE, Han MJ, Kim DH (2014) Lactobacillus pentosus var. plantarum C29 ameliorates memory impairment and inflammaging in a D-galactose-induced accelerated aging mouse model. Anaerobe 27:22-26. DOI: 10.1016/j.anaerobe.2014.03.003
  34. Xu C, Li E, Suo Y, Su Y, Lu M, Zhao Q, Qin JG, Chen L (2018) Histological and transcriptomic responses of two immune organs, the spleen and head kidney, in Nile tilapia (Oreochromis niloticus) to long-term hypersaline stress. Fish Shellfish Immunol 76:48-57. DOI: 10.1016/j.fsi.2018.02.041
  35. Xu LQ, Xie YL, Gui SH, Zhang X, Mo ZZ, Sun CY, Li CL, Luo DD, Zhang ZB, Su ZR, Xie JH (2016) Polydatin attenuates d-galactose-induced liver and brain damage through its anti-oxidative, anti-inflammatory and anti-apoptotic effects in mice. Food Funct 7:4545-4555. DOI: 10.1039/c6fo01057a
  36. Yan W, Chen X (2006) GPX2, a direct target of p63, inhibits oxidative stress-induced apoptosis in a p53-dependent manner. J Biol Chem 281:7856-7862. DOI: 10.1074/jbc.M512655200
  37. Zhang X, Zhang A, Jiang B, Bao Y, Wang J, An L (2008) Further pharmacological evidence of the neuroprotective effect of catalpol from Rehmannia glutinosa. Phytomed 15: 484-490. DOI: 10.1016/j.phymed.2008.01.001
  38. Zhang Y, Du R, Wang L, Zhang H (2010) The antioxidative effects of probiotic Lactobacillus casei Zhang on the hyperlipidemic rats. Eur Food Res Technol 231:151-158. DOI: 10.1007/s00217-010-1255-1
  39. Zhao J, Tian F, Yan S, Zhai Q, Zhang H, Chen W (2018) Lactobacillus plantarum CCFM10 alleviating oxidative stress and restoring the gut microbiota in d-galactose-induced aging mice. Food Funct 1:917-924. DOI: 10.1039/C7FO01574G
  40. Zhao L, Xu W, Ibrahim SA, Jin J, Feng J, Jiang J, Meng J, Ren F (2011) Effects of age and region on fecal microflora in elderly subjects living in Bama, Guangxi, China. Curr Microbiol 62:64-70. DOI: 10.1007/s00284-010-9676-4

Tables

Table 1

Target genes and reference gene’s primer set 

Gene

Primer sets

Annealing Temp. (°C)

Total SOD

(F) 5ꞌ AGGATTAACTGAAGGCGAGCAT 3ꞌ 

(R) 5ꞌ TCTACAGTTAGCAGGCCAGCAG 3ꞌ

55

CAT

(F)  5ꞌ ACGAGATGGCACACTTTGACAG 3ꞌ 

(R)  5ꞌ TGGGTTTCTCTTCTGGCTATGG 3ꞌ

55

GPX

(F)  5ꞌAAGGTGCTGCTCATTGAGAATG 3ꞌ 

(R)  5ꞌ CGTCTGGACCTACCAGGAACTT3ꞌ

59

GPX

(F)  5ꞌAAGGTGCTGCTCATTGAGAATG 3ꞌ 

(R)  5ꞌ GTCCTGACCACGTCAACATAG 3ꞌ

55

ß-ACTIN

(F)  5ꞌ CTCTCAGCTGTGGTGGTGAA 3ꞌ 

(R) 5ꞌAGCCATGTACGTAGCCATCC 3ꞌ

55

GAPDH

(F)  5ꞌ TGCAGTGGCAAAGTGGAGAT 3ꞌ 

(R)  5ꞌ TTTGCCGTGAGTGGAGTCAT 3ꞌ

54

  

Table 2

The effect of treatment of organ index

                                                                                              Groups

Parameters

N

B

A

G

BG

AG

Body Weight

40.00±1.15a

41.66±2.23a

41.02±0.88a

33.0±0.57b

37.66±0.66ab

37.01±0.88ab

Kidney index

0.24±0.01ab

0.28±0.01a

0.27±0.01ab

0.20±0.01c

0.24±0.01ab

0.23±0.01bc

Liver index

5.95±0.76b

6.33±0.08a

6.23±0.08a

4.9±0.06c

5.55±0.12b

5.53±0.12b

Data represent Mean ± SEM. Values having different superscript alphabet letter in same tier significantly vary at 𝑃< 0.05. N: normal group, G: d-galactose treatment group, A: ascorbic acid treatment group, B: L. brevis MG000874 treatment group, BG: galactose and L. brevis MG000874 treatment group, AG: galactose and ascorbic acid treatment group