Autophagy inhibits inflammation via down-regulation of p38 MAPK/mTOR signaling cascade in endothelial cells

doi:10.21203/rs.3.rs-2064260/v1

Download PDF

Research Article

Autophagy inhibits inflammation via down-regulation of p38 MAPK/mTOR signaling cascade in endothelial cells

https://doi.org/10.21203/rs.3.rs-2064260/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Autophagy, an intracellular process of self-digestion, has been shown to modulate inflammatory responses. In the present study, we determined the effects of autophagy on inflammatory response induced by supernatant of psoriatic dermal mesenchymal stem cells (p-DMSCs). Human umbilical vein endothelial cells (HUVECs) were treated with supernatant of p-DMSCs cultures to induce inflammation and treated with rapamycin (RAPA) to induce autophagy. Expression levels of mRNA for inflammatory cytokines and BIRC2 were compared in HUVECs with vs. without induction of autophagy with rapamycin (RAPA) by PCR, while cell apoptosis was assessed by flow cytometry and caspase-3 activity assay kit. We found that induction of autophagy with RAPA decreased expression levels of IL6, IL8 and CCL20, in addition to reduction in inflammation-induced apoptosis in HUVECs; Expression levels of LC3, p62, p-p38 MAPK (Thr180/Tyr182), p-mTOR (Ser2445) and p-ULK1 (Ser555) proteins were measured by Western blotting. We found RAPA increased LC3Ⅱ, while decreasing p62 expression. Likewise, expression levels of p-p38 MAPK and p-mTOR proteins were markedly decreased by the treatment with RAPA; Finally, we evaluated thenitric oxide (NO) content, NO synthase (NOS) activity and cell angiogenesis. RAPA treatment increased the NO content and the NOS activity, and inhibited angiogenesis. Through the experimental results, we speculated that induced of autophagy can improve the function of endothelial cells in psoriasis, suggesting approaches to induce autophagy can be used to ameliorate psoriasis.

Autophagy

Inflammatory

HUVECs

p38 MAPK/mTOR

Autophagy is an evolutionarily conserved catabolic process that degrades cytoplasmic materials and provides a substrate for energy metabolism during nutrient deficiency and metabolic stress in order to maintain cellular homeostasis and adapt to adverse environments (Jiao Liu et al, 2020; Younis Hazari et al, 2020; Beth Levine et al, 2008; Lorenzo Galluzzi et al, 2014; Romana T Netea-Maier et al, 2016). Alterations of autophagy are associated with a number of inflammatory diseases, including psoriasis (Dennis J Wu et al, 2017; Xue Mei Li et al, 2020). A large number of studies have shown that autophagy and autophagy-related proteins are involved in immune regulation, such as intracellular bacterial clearance, secretion of inflammatory cytokines, antigen presentation and lymphocyte development (Dennis J Wu et al, 2017; Yuan Cao et al, 2019). Autophagy is initiated by inducing autophagy genes for microtubule-associated protein light chain 3 (LC3), Beclin-1 and other autophagy related proteins, which all play an important role in the maintenance cell homeostasis under physiological and pathological conditions (Douglas R Green et al, 2011; Beth Levine et al, 2011; Qiuhong Zhang et al, 2013).

The regulation of autophagy is a very complex process. Mammalian target of rapamycin (mTOR), phospinositide 3-kinase (PI3K)/ Akt, MAPK and other pathways are considered as major regulatory pathways of autophagy and have been widely studied (Zhifen Yang et al, 2010; Zhifen Yang et al, 2010). Mammalian rapamycin mechanistic target is a typical inhibitor of autophagy, which is related to growth factor nutrient and energy signals. Rapamycin can inhibit mTOR complex 1 (mTORC1), which effectively inhibits autophagy by phosphorylating ULK1. In addition to regulation of autophagy, the mTORC1 signaling pathway also regulates various processes in innate immune cells through various mechanisms such as metabolic protein translation and antigen presentation (Jung Hwa Ko et al, 2017). In addition, mitogen-activated protein kinase (MAPK) signaling pathway regulated cell growth and differentiation. MAPK pathway is also considered to be the main regulation pathway of autophagy (Xinbing Sui et al, 2014).

Psoriasis is a chronic, multifactorial, immune-mediated skin disease (Alan Menter, 2016). Psoriasis is considered as a systemic disease because psoriatic inflammation is involved both cutaneous and extracutaneous tissues (Zeinab Aryanian et al, 2021). Previous studies demonstrated that abnormal autophagy contributes dermal angiogenesis (Felix Locker et al, 2018), neovascularization, and extravasation of inflammatory cells into the lumen in psoriasis (K A Rubina et al, 2017). Since autophagy deficiency can induce the production of proinflammatory cytokines by increasing the expression of p62 (María-José Barrera et al, 2021), inflammation in psoriatic endothelial cells could also be linked to altered autophagy. Therefore, we studied here the regulatory role of autophagy in inflammation, apoptosis and endothelial cell function in vitro.

Materials

Materials and sources were as following: EBM-2 (Lonza, Germany,lot NO.: 9MB833), rapamycin (Solarbio, Beijing, Lot. No.: 1018N033),trypsin solution (Gibco Invitrogen, New York, USA, lot NO.: 1563418),eECL Western Blot Kit (CWBIO, Beijing, China, Lot NO.:20507), SB203580 (Med Chem Express, New Jersey, CAS No.: 152121-47-6), Chloroquine (CQ) (Med Chem Express, New Jersey, CAS No.: 54-05-7), BD matrigel (Corning, NewYork, USA, lot No.: 6172007), Annexin V-FITC/PI Apoptosis Assays Kit (KeyGenBio TECH, Nanjing, China, Cat. NO.: KGA107), capase-3 Kit (Beyotime, Shanghai, China, Lot NO.: 070320200803), NO Kit (JianCheng, Nanjing, China, NO.: A013-2-1), NOS Kit (JianCheng, Nanjing, China, NO.: A014-2-2), DAPI (Solarbio, China, lot-no.20170412). Antibodies against β-actin, LC3, p62 were obtained from Abcam (Cambridge, England). p38 MAPK (8690), p-p38 MAPK (Thr180/Tyr182; 4511), ULK1 (8054), p-ULK1 (Ser555, 5869), mTOR (2983) and p-mTOR (Ser2445; 5536) were obtained from Cell Signaling Technology (Bossdun, USA ).

Cell culture and treatment

Human umbilical vein endothelial cells (HUVECs) and psoriatic dermal mesenchymal stem cells (p-DMSCs) were cultured as described previously (Ling Zhou et al, 2021). Supernatant of p-DMSCs culture was collected and stored in 4℃ refrigerators. HUVECs at about 70%-80% confluency were treated with p-DMSC supernatant for 4h (p-HUVEC). Prior to the treatment with p-DMSC supernatant, autophagy of HUVECs was induced by incubation of HUVECs with 200nM rapamycin (RAPA) in EBM-2 for 1h (R-p-HUVEC).

Quantitative RT-PCR (qRT-PCR)

Quantitative RT-PCR was used to assess the expression levels of IL6, IL8, CCL20 and BIRC2 in HUVECs with and without RAPA treatment, as described previously (Ruixia Hou et al, 2013). Total RNA was extract from control, p-HUVEC and R-p-HUVEC. RNA was reversely transcribed into cDNA. For the PCR assay, cDNA was mixed with QuantiTect SYBR Green PCR Master Mix, primers, and RNase-Free Water, and tested on Step One™. Primers information is shown in Table 1.

Table 1

Primers used for RT-PCR
Gene	Primers
β-actin IL-6 IL-8 CCL20 BIRC2	For: GCAAATGCTTCTAGGCGGACT Rev: CAATCTCATCTCGTTTTCTGCG For: GAC AAA GCC AGA GTC ATT CAG AG Rev: TTG GAT GGT CTT GGT CCT TAG CC For: TTGGCAGCCTTCCTGATTTC Rev: AACTTCTCCACAACCCTCTGCA For: ATTGTGCGTCTCCTCAGTAAAAA Rev: TGTGATGCTTAAACAAAGCAAAC For: GAATCTGGTTTCAGCTAGTCTGG Rev: GGTGGGAGATAATGAATGTGCAA

Immunofluorescence

Cells on chamber slide were washed with PBS for 3 times, followed by fixation with 4% paraformaldehyde and permeation with 0.5%Triton x-100 for 20min at room temperature. After blocking with serum, cells were incubated with primary antibody LC3 (1:1000) overnight at 4℃. Afterward cells were incubation with secondary antibody for 1h. After DAPI staining, immunofluorescence staining was observed under an immunofluorescence microscope.

Western Blotting

Total protein was extracted from HUVECs for Western blot analysis. Cells were collected and lysed with ice-cold lysis buffer. Protein samples were bathed in metal bath for 10min at 95℃. LC3 was detected by traditional Western Blot. Briefly, a total of 20µg protein was loaded for Western blot assay. Electrophoresis was carried out using 12% separation glue and the transfer condition was 70V for 1.5h. Blotting was incubated overnight with LC3 rabbit primary antibody at 4℃, followed by washing with Tris-buffered saline containing 0.1% Tween for 3 times. The membrane was then incubated with a second antibody conjugated to horseradish peroxidase for 1h at room temperature. eECL Western Blotting reagent was used to detect the labeled proteins. Imaging was performed using the Protein Simple Fluor Chem Q imaging system (Protein Simple, USA).

Protein Simple was used to detect the expression levels of p62, p38 mitogen-activated protein kinase (p38 MAPK), phosphorylated p38 MAPK, unc-51 like kinase 1 (ULK1), phosphorylated ULK1, mammalian target of rapamycin (mTOR) and phosphorylated mTOR. Protein samples and monoclonal antibodies against p62, p38 MAPK, p-p38 MAPK, ULK1, p-ULK1, mTOR, p-mTOR (antibody ratio 1:100) were added according to manufacturer's instructions, tested on WES system.

Apoptosis was detected by flow cytometry

After digestion and collection, cells were washed twice with PBS and centrifugated at 2000rpm for 5min. The cells were resuspended with 500µL Binding Buffer, followed by addition of 5µL Annexin V-FITC and 5µL Propidium Iodide. After incubation at room temperature for 5-15min in dark, apoptosis was detected by flow cytometry.

Measurement of caspase-3 activity

The cells were collected and the protein was extracted by adding 100µL lysate per 2*10⁶ cells. Protein concentrations were measured by Bradford's method and caspase-3 activity was detected with caspase-3 activity assay kit according to the manufacturer’s instructions.

NO/NOS

Expression of NO and NOS activity were detected with respective kits. Assay was performed according to the manufacturer’s protocol. The absorbance of OD value was measured at wavelength of 550nm with a microplate reader.

Angiogenesis experiment

The angiogenesis experiment was performed as described previously (Ling Zhou et al, 2018). Precooled tip was used to add BD matrigel glue to 96-well plate, 50µL/well. Afterward the cells were digested and inoculated with 1*10⁴cells/cm² for 24h, and then cultured at 37℃and 5% CO₂ for 6h. Under the microscope, five fields were randomly selected to count the numbers of junction and mesh. The data were expressed as percentages of control, and the control was set at 100%.

Statistic analysis

One way ANOVA with Tukey’ s multiple comparisons was used to determine significant differences when three or more groups were compared, while an unpaired t test was used to determine significance between two groups. p < 0.05 was considered statistically significant. All analyses were performed using SPSS.

1. Induction of autophagy alleviates inflammation induced by supernatant of p-DMSCs

Because activation of autophagy can inhibit inflammation in croakers (Bo Yang et al, 2021), we first assessed here whether induction of autophagy can also inhibit inflammation in HUVECs. HUVEC inflammation was induced by incubation with supernatant of psoriatic mesenchymal stem cell culture (p-DMSC supernatant) for 4h. As seen in Fig. 1a, addition of p-DMSC supernatant to HUVEC culture significantly increased expression levels of mRNA for IL-6, IL-8 and CCL20, whereas induction of autophagy with RAPA lowered the expression levels of IL-6, IL-8 and CCL20 mRNA to the levels comparable to that of the controls. To ascertain whether RAPA induces autophagy, we measured expression levels of autophagy-associated biomarkers in the HUVEC cultures. As expected, RAPA treatment markedly increased the ratio of LC3I/LC3II protein (Fig. 1b, c), while decreasing p62 expression (Fig. 1d, e). In parallel, RAPA treatment increased fluorescence intensity of LC3 (Fig. 1f, g). The results show that RAPA induces autophagy, likely contributing to the alleviation of the p-DMSCs supernatant-induced inflammation in HUVECs.

2. Autophagy inhibits inflammation-induced apoptosis

Autophagy and apoptosis, different forms of cell death, interact with each other. Autophagy can antagonize apoptosis by promoting cell survival (Masakazu Hamada et al, 2017). We next determined whether autophagy can inhibit apoptosis of HUVECs. Flow cytometry showed a significant increase in p-HUVEC apoptosis (both early and late apoptosis) compared to the controls (Fig. 2a-d). Induction of autophagy with RAPA (R-p-HUVEC) significantly reduced apoptosis (both early and late apoptosis). Correspondingly, expression levels of BIRC2 mRNA, an inhibitor of apoptosis, were dramatically increased in R-p-HUVEC compared with p-HUVEC (Fig. 2e). In contrast, caspase-3 activity was significantly decreased following the treatment of p-HUVECs with RAPA (Fig. 2f), indicating an inhibition of apoptosis. These results indicate that autophagy inhibits inflammation-induced apoptosis in HUVECs.

3. Autophagy inhibits inflammation through the p38 MAPK/mTOR pathway

p38 MAPK pathway plays an important role in autophagy (Yannan Liu et al, 2019; Yingli He et al, 2018). ULK is the only core protein with serine/threonine kinase activity in autophagy signaling pathway. ULK1 complex acts as a bridge between upstream nutrient or energy receptor mTOR and downstream autophagosome in vivo. Phosphorylated ULK1 has long been considered a key regulator of autophagy (Chenyao Wang et al, 2018). To assess the involvement of p38 MAPK-mTOR-ULK1 signaling in the regulation of inflammation by autophagy, we measured expression levels of LC3, p62, p38 MAPK, p-p38 MAPK (Thr180/Tyr182), mTOR, p-mTOR (Ser2448), ULK1 and p-ULK1 (Ser555). p-HUVEC displayed significantly higher expression levels of LC3Ⅱ (Fig. 3a, b) and p62 (Fig. 3c) compared with controls. RAPA treatment increased the ratio of LC3Ⅱ/LC3I in R-p-HUVEC while decreasing p62 expression, indicating an induction of autophagy. Chloroquine (CQ) can inhibit autophagy by lysosomal acidification and subsequently blocks the fusion of the autophagosome with lysosome, leading to the accumulation of autophagosome. Inhibition of autophagy with CQ increased both the ratio of LC3Ⅱ/ LC3I and p62 expression (Fig. 3a-c), indicating autophagy initiation is normal, but autophagy flow is disrupted. Inhibition of p38 MAPK with SB203580 increased LC3Ⅱ protein expression while decreasing p62 expression, indicating enhanced autophagy (Fig. 3a-c). In addition, the expression levels of both p-p38 MAPK and p-mTOR in R-p-HUVEC and SB-R-p-HUVEC were significantly decreased compared with p-HUVEC (Fig. 3d, f), and the expression of p-p38 MAPK in SB-R-p-HUVEC was significantly decreased compared with R-p-HUVEC (Fig. 3d), indicating that p38 MAPK is a negative regulator of autophagy. In contrast, inhibition of autophagy with CQ increased expression levels of p-mTOR in RAPA-treated p-HUVECs (Fig. 3f). On the other hand, p38 MAPK inhibitor increased the expression of p-ULK1 in RAPA-treated p-HUVEC while autophagy inhibitor, CQ, decreased p-ULK1 (Fig. 3e). The results show that RAPA-induced autophagy negatively regulates inflammation through the p38 MAPK/mTOR pathway.

4. Induction of autophagy improves the function of inflamed endothelial cells

Dysfunctions in psoriatic endothelial cells include increased pro-inflammatory response, decreased vasodilation, vasogenesis and thrombosis (Laura Mercurio et al, 2020). The decreased vasodilation is attributable to the reduced production of nitric oxide (NO) (Billie K Alba et al, 2018). Therefore, we detected NO content and NOS activity in HUVECs. As can be seen in Fig. 4a & b, both NO content and NOS activity declined significantly in p-HUVECs vs. normal controls. Induction of autophagy with RAPA significantly increased both NO content and NOS activity in p-HUVECs, while inhibition of autophagy reversed the effect of RAPA on both NO content and NOS activity, indicating that autophagy increases NO content and NOS activity in p-HUVECs.

Finally, we assessed whether the influence of autophagy on HUVEC function is reflected in angiogenesis, an abnormality in psoriasis. Our results showed that the numbers of both junction and mesh were increased and mean mesh areas were decreased in p-HUVECs in comparison to normal controls (Fig. 4c, d). Inhibition of autophagy overcame the effect of RAPA on the formations of junction and mesh, mean mesh areas in p-HUVECs. In contrast, neither the numbers of junction nor mesh or mean areas of mesh differed significantly in R-p-HUVECs treated with or without p38 MAPK inhibitor. Taken together, these results demonstrate that autophagy improves the function of inflamed endothelial cells via inhibition of p38 MAPK.

The psoriasis-involved skin is characterized by increased blood vessels and angiogenesis, suggesting the pathogenic role of blood vessels and endothelial cells in psoriasis. So far, the studies on the role of endothelial cells in the pathogenesis of psoriasis are limited although regulation of CARD14⁺ ECs in production of cytokines and chemokines (IL-8 and CXCL1 etc.) has been documented (Jamie L Harden et al, 2014). However, the pathomechanisms of endothelial cell inflammation in psoriasis have not been well defined. Since it is difficult to culture psoriatic endothelial cells from psoriatic skin, we established a psoriatic endothelial cell model by incubation of HUVECs with the culture supernatant of p-DMSCs. This model exhibits some phenotypes of psoriatic endothelial cells such as increased expression levels of IL-6, IL-8 and CCL20. We show here that altered autophagy contributes, at least in part, to the development of inflammation in psoriatic endothelial cells.

Autophagy, also called programmed type II death, is a conserved degradation of the cells, removing unnecessary or dysfunctional components through a lysosome-dependent regulated mechanism, which is different from apoptotic programmed typeⅠdeath (Yufeng Xi et al, 2020; Dmitri V Krysko et al, 2008). Autophagy and inflammation are highly intertwined cellular processes (Beth Levine et al, 2011). Autophagy exerts anti-inflammatory property by regulating innate immune signaling pathway and inflammatory body activity (Vojo Deretic et al, 2013; James Harris et al, 2011). Moreover, autophagy can also be activated during the occurrence of inflammation. Autophagy not only affects the relief of infectious diseases and the pathological process of inflammatory diseases, but also can inhibit inflammatory response to the damages of non-infectious tissues (Vojo Deretic et al, 2018). Growing evidences indicate that autophagy dysfunction not only causes psoriasis, but also aggravates the inflammation in the pathogenesis of psoriasis. Autophagy-related proteins regulate multiple immune functions, including secretion of inflammatory cytokines, bacterial clearance and lymphocyte development. Because of the possible pathogenic role of autophagy in psoriasis, it could be a target in the treatment of psoriasis (Hongpeng Lv et al, 2021). Correspondingly, in the present study, we demonstrate induction of autophagy inhibits inflammation and apoptosis in HUVECs.

The mechanism by which autophagy inhibits inflammation are not clear. But evidence points to the involvement of p38 MAPK/mTOR signaling pathway. MAPK is an important cellular transduction pathway, regulating cell growth and differentiation. Recent studies have shown that p38 MAPK, an intracellular signal transduction molecule, regulates a variety of inflammatory responses, including the expression of pro-inflammatory cytokines, leukocyte adhesion and chemotaxis. MAPK signaling pathways are involved in the regulation of autophagy (Shu-Ting Pan et al, 2015). Autophagy is a catabolic pathway regulated by a complex signal network. p38 MAPK is a stress-activated protein kinase because it is frequently activated in response to inflammatory responses induced by various environmental stresses (e.g., REDOX stress, UV irradiation of cytokines, heat shock and osmotic shock), which is a key process in the host defense system. Moreover, p38 MAPK regulates cell cycle, promoting apoptosis, differentiation and senescence (Yan Zhao et al, 2020) and inhibits basic autophagy by blocking Atg9 (Jemma L Webber et al, 2010). Furthermore, ULK1 is a key upstream regulator of autophagy (Yingli He et al, 2018). p38α MAPK can directly phosphorylate ULK1 and inhibit ULK1 kinase activity, leading to destruction of ULK1 functional complex with ATG13, consequently resulting in reduced autophagy. In the present study, we showed that p38 MAPK was activated by inflammation, and induction of autophagy reduced the phosphorylation of p38 MAPK. Additionally, mTOR is a serine/threonine protein kinase and a key negative regulator of autophagy initiation (Andrea Williams et al, 2008). It phosphorylates an important autophagy protein ULK1 and inhibits its activity, thereby preventing the formation of ULK1-ATG13-FIP200 complex and inhibiting autophagy (Ian G Ganley et al, 2009). Finally, mTOR signaling pathway inhibits autophagy by phosphorylating the transcription factor EB and preventing its nuclear translocation from expressing autophagy genes (Rei Unno et al, 2020). Our results showed that either induction of autophagy or inhibition of p38 MAPK lowered expression levels of p-mTOR. Thus, autophagy-induced inhibition of inflammation is in part via inhibition of p38 MAPK-mTOR-ULK1 signaling pathways.

Considering the correlation between NO/NOS and endothelial cell function, we assessed the expression levels of NO and the activity of NOS. NO, synthesized by NOS, has a variety of physiological and pathological functions. NO is essential for maintaining microvascular endothelial cell function and vascular homeostasis by inducing vasodilation and inhibiting platelet adhesion and aggregation (Hiroki Saito et al, 2018). Under inflammatory conditions, the physiological activity of eNOS may be impaired, leading to a so-called uncoupled state characterized by the production of superoxide O2⁻ instead of NO (Susanne Karbach et al, 2014). Therefore, the bioavailability of NO in patients with psoriasis is reduced, leading to systemic microvascular dysfunction. Reduced bioavailability of nitric oxide impaired endothelium-dependent vasodilation (Susanne Karbach et al, 2014). The results of the present study showed that induction of autophagy increased NO expression and NOS activity, and stimulated endothelial angiogenesis. In agreement with our findings, other studies showed that autophagy stimulates No production (Cezar Rangel Pestana et al, 2015), but the specific mechanism remains to be elucidated.

In this study, we established a psoriatic endothelial cell model to investigate the effects of autophagy on inflammation and apoptosis of HUVEC. Induction of autophagy can inhibit inflammation and apoptosis, while improving endothelial cell functions in HUVECs treated with p-DMSC supernatant, mediated in part by p38 MAPK/mTOR signaling pathway. Induction of autophagy can improve the function of endothelial cells in psoriasis, potentiating the utility of approaches to enhance autophagy in the treatment of psoriasis.

p-DMSCs

Psoriatic dermal mesenchymal stem cells

HUVECs

Human umbilical vein endothelial cells

LC3

Light chain 3

p38 MAPK

p38 Mitogen-activated protein kinase

ULK1

unc-51 like kinase 1, mTOR:mammalian target of rapamycin, RAPA:Rapamycin

Chloroquine

Nitric oxide

EGM-2

Endothelial cell growth medium-2.

Ethics approval and consent to participate

Ethical approval for the experiments was obtained from the Medical Ethics Committee of Taiyuan City Centre Hospital, and all subjects provided informed consent.

Consent for publication

Not applicable.

Availability of data

All data are available upon request.

Competing interests

The authors declare no conflict of interest.

Funding

This project was supported by the National Natural Science Foundation of China (grant no.81773336, 81803146, 81472888).

Authors’ contributions

LZ, JW and KZ designed the study and approved the final version. JL, XN, RH collected the clinical data. LZ and JL performed the experiments and analyzed the data. LZ and JW, HH and JL assembled and interpreted the data, wrote the manuscript. LZ and KZ are responsible for the integrity of this work and revised the manuscript. JL and JL assisted with cell culture, immunostaining and microscopy. LZ, JW and KZ take responsibility for the integrity of the data and the accuracy of the data analysis. All authors read and approved the final manuscript.

Jiao Liu, Feimei Kuang, Guido Kroemer, Daniel J Klionsky, Rui Kang & Daolin Tang (2020) Autophagy-Dependent Ferroptosis: Machinery and Regulation. Cell Chem Biol. 16; 27(4): 420–435. doi: 10.1016/j.chembiol.2020.02.005.
Younis Hazari, José Manuel Bravo-San Pedro, Claudio Hetz, Lorenzo Galluzzi & Guido Kroemer (2020) Autophagy in hepatic adaptation to stress. J Hepatol. 72(1):183–196. doi: 10.1016/j.jhep.2019.08.026.
Beth Levine & Guido Kroemer (2008) Autophagy in the pathogenesis of disease. Cell. 132(1):27–42. doi: 10.1016/j.cell.2007.12.018.
Lorenzo Galluzzi, Federico Pietrocola, Beth Levine & Guido Kroemer (2014) Metabolic control of autophagy. Cell. 159 (6): 1263–1276. doi: 10.1016/j.cell.2014.11.006.
Romana T Netea-Maier, Theo S Plantinga, Frank L van de Veerdonk, Johannes W Smit & Mihai G Netea (2016) Modulation of inflammation by autophagy: Consequences for human disease. Autophagy. 12 (2): 245–260. doi: 10.1080/15548627.2015.1071759.
Dennis J Wu & Iannis E Adamopoulos (2017) Autophagy and autoimmunity. Clin Immunol. 176: 55–62. doi: 10.1016/j.clim.2017.01.007.
Xue Mei Li, Kyung Eun Jung, Su Hyuk Yim, Dong Kyun Hong, Chang Deok Kim, Jeong Yeon Hong, Ho Jung Lee, Sung Yul Lee, Jung Eun Kim & Chang Wook Park (2020) Autophagy Suppresses Toll-Like Receptor 3-Mediated Inflammatory Reaction in Human Epidermal Keratinocytes. Biomed Res Int. 2020: 4584626. doi: 10.1155/2020/4584626.
Yuan Cao, Jihua Chen, Guofeng Ren, Yahui Zhang, Xiuying Tan & Lina Yang (2019) Punicalagin Prevents Inflammation in LPS-Induced RAW264.7 Macrophages by Inhibiting FoxO3a/Autophagy Signaling Pathway. Nutrients. 11(11): 2794. doi: 10.3390/nu11112794.
Douglas R Green, Lorenzo Galluzzi & Guido Kroemer (2011) Mitochondria and the autophagy-inflammation-cell death axis in organismal aging. Science. 333(6046):1109–1112. doi: 10.1126/science.1201940.
Beth Levine, Noboru Mizushima & Herbert W Virgin (2011) Autophagy in immunity and inflammation. Nature. 469(7330):323 – 35.doi: 10.1038/nature09782.
Qiuhong Zhang, Rui Kang, Herbert J Zeh 3rd, Michael T Lotze & Daolin Tang (2013) DAMPs and autophagy: cellular adaptation to injury and unscheduled cell death. Autophagy. 9(4):451–458. doi: 10.4161/auto.23691.
Zhifen Yang & Daniel J Klionsky (2010) Eaten alive: a history of macroautophagy. Nat. Cell Biol. 12(9): 814–822. doi: 10.1038/ncb0910-814
Zhifen Yang & Daniel J Klionsky (2010) Mammalian autophagy: core molecular machinery and signaling regulation. Curr Opin Cell Biol. 22(2): 124–131. doi: 10.1016/j.ceb.2009.11.014.
Jung Hwa Ko, Sun-Ok Yoon, Hyun Ju Lee & Joo Youn Oh (2017) Rapamycin regulates macrophage activation by inhibiting NLRP3 inflammasome-p38 MAPK-NFκB pathways in autophagy- and p62-dependent manners. Oncotarget. 8 (25): 40817–40831. doi: 10.18632/oncotarget.17256.
Xinbing Sui, Na Kong, Li Ye, Weidong Han, Jichun Zhou, Qin Zhang, Chao He & Hongming Pan (2014) p38 and JNK MAPK pathways control the balance of apoptosis and autophagy in response to chemotherapeutic. Cancer Lett. 344(2):174–179. doi: 10.1016/j.canlet.2013.11.019.
Alan Menter (2016) Psoriasis and Psoriatic Arthritis Overview. Am J Manag Care. 22 (8 Suppl): s216-224.
Zeinab Aryanian, Iraj Jafaripour, Edris Kohneshin, Roghayeh Pourkia, Mohammad Taghi Hedayati Goudarzi, Soudabeh Tirgar Tabari, Azar Shirzadian Kebria, Farbod Zahedi Tajrishi & Mohammad Mostafa Ansari Ramandi (2021) Echocardiographic and electrocardiographic assessments in patients with psoriasis. Caspian J Intern Med. 12(2):162–166. doi: 10.22088/cjim.12.2.162.
Felix Locker, Silvia Vidali, Barbara S Holub, Julia Stockinger, Susanne M Brunner, Sabine Ebner, Andreas Koller, Andrea Trost, Herbert A Reitsamer, David Schwarzenbacher, Roland Lang & Barbara Kofler (2018) Lack of Galanin Receptor 3 Alleviates Psoriasis by Altering Vascularization, Immune Cell Infiltration, and Cytokine Expression. J Invest Dermatol. 138 (1): 199–207. doi: 10.1016/j.jid.2017.08.015.
K A Rubina, V Yu Sysoeva, E I Zagorujko, Z I Tsokolaeva, M I Kurdina, Ye V Parfyonova & V A Tkachuk (2017) Increased expression of uPA, uPAR, and PAI-1 in psoriatic skin and in basal cell carcinomas. Arch Dermatol Res. 309 (6):433–442. doi: 10.1007/s00403-017-1738-z.
María-José Barrera, Sergio Aguilera, Isabel Castro, Soledad Matus, Patricia Carvajal, Claudio Molina, Sergio González, Daniela Jara, Marcela Hermoso & María-Julieta González (2021) Tofacitinib counteracts IL-6 overexpression induced by deficient autophagy: implications in Sjögren's syndrome. Rheumatology (Oxford). 60(4):1951–1962. doi: 10.1093/rheumatology/keaa670.
Ling Zhou, Juanjuan Wang, Jiannan Liang, Hui Hou, Jiao Li, Juan Li, Yue Cao, Junqin Li & Kaiming Zhang (2021) Psoriatic mesenchymal stem cells stimulate the angiogenesis of human umbilical vein endothelial cells in vitro. Microvasc Res. 136: 104151. doi: 10.1016/j.mvr.2021.104151.
Ruixia Hou, Guohua Yin, Peng An, Chunfang Wang, Ruifeng Liu, Yuanwen Yang, Xin Yan, Junqin Li, Xinhua Li & Kaiming Zhang (2013) DNA methylation of dermal MSCs in psoriasis: identification of epigenetically dysregulated genes. J Dermatol Sci. 72 (2):103–109. doi: 10.1016/j.jdermsci.2013.07.002.
Ling Zhou, Xuping Niu, Jiannan Liang, Junqin Li, Jiao Li, Yueai Cheng, Yanfeng Meng, Qiang Wang, Xiaoli Yang, Gang Wang, Yu Shi, Erle Dang & Kaiming Zhang (2018) Efficient differentiation of vascular endothelial cells from dermal-derived mesenchymal stem cells induced by endothelial cell lines conditioned medium. Acta Histochem. 120 (8):734–740. doi: 10.1016/j.acthis.2018.08.004.
Bo Yang, Renlei Ji, Xueshan Li, Wei Fang, Qiuchi Chen, Qiang Chen, Wei Xu, Kangsen Mai & Qinghui Ai (2021) Activation of Autophagy Relieves Linoleic Acid-Induced Inflammation in Large Yellow Croaker (Larimichthyscrocea). Front Immunol. 12: 649385. doi: 10.3389/fimmu.2021.649385.
Masakazu Hamada, Hiroyasu Kameyama, Soichi Iwai & Yoshiaki Yura (2017) Induction of autophagy by sphingosine kinase 1 inhibitor PF-543 in head and neck squamous cell carcinoma cells. Cell Death Discov. 3: 17047. doi: 10.1038/cddiscovery.2017.47.
Yannan Liu & Daidi Fan (2019) Ginsenoside Rg5 induces G2/M phase arrest, apoptosis and autophagy via regulating ROS-mediated MAPK pathways against human gastric cancer. Biochem Pharmacol. 68: 285–304. doi: 10.1016/j.bcp.2019.07.008.
Yingli He, Hua She, Ting Zhang, Haidong Xu, Lihong Cheng, Manuel Yepes, Yingren Zhao & Zixu Mao (2018) p38 MAPK inhibits autophagy and promotes microglial inflammatory responses by phosphorylating ULK1. J Cell Biol. 217(1): 315–328. doi: 10.1083/jcb.201701049.
Chenyao Wang, Huafei Wang, Deyi Zhang, Wenwen Luo, Ruilong Liu, Daqian Xu, Lei Diao, Lujian Liao & Zhixue Liu (2018) Phosphorylation of ULK1 affects autophagosome fusion and links chaperone-mediated autophagy to macroautophagy. Nat Commun. 9 (1):3492. doi: 10.1038/s41467-018-05449-1.
Laura Mercurio, Cristina M Failla, Lorena Capriotti, Claudia Scarponi, Francesco Facchiano, Martina Morelli, Stefania Rossi, Gianluca Pagnanelli, Cristina Albanesi, Andrea Cavani & Stefania Madonna (2020) Interleukin (IL)-17/IL-36 axis participates to the crosstalk between endothelial cells and keratinocytes during inflammatory skin responses. PLoS One. 15 (4): e0222969. doi: 10.1371/journal.pone.0222969.
Billie K Alba, Jody L Greaney, Sara B Ferguson & Lacy M Alexander (2018) Endothelial function is impaired in the cutaneous microcirculation of adults with psoriasis through reductions in nitric oxide-dependent vasodilation. Am J Physiol Heart Circ Physiol. 314(2): H343-H349. doi: 10.1152/ajpheart.00446.2017.
Jamie L Harden, Steven M Lewis, Katherine C Pierson, Mayte Suárez-Fariñas, Tim Lentini, Francesca S Ortenzio, Lisa C Zaba, Raphaela Goldbach-Mansky, Anne M Bowcock & Michelle A Lowes (2014) CARD14 expression in dermal endothelial cells in psoriasis. PLoS One. 9(11): e111255. doi: 10.1371/journal.pone.0111255.
Yufeng Xi, Rong Ju & Yujia Wang (2020) Roles of Annexin A protein family in autophagy regulation and therapy. Biomed Pharmacother. 130: 110591. doi: 10.1016/j.biopha.2020.110591.
Dmitri V Krysko, Tom Vanden Berghe, Eef Parthoens, Katharina D'Herde & Peter Vandenabeele (2008) Methods for distinguishing apoptotic from necrotic cells and measuring their clearance. Methods Enzymol. 442: 307–341. doi: 10.1016/S0076-6879(08)01416-X.
Beth Levine, Noboru Mizushima & Herbert W Virgin (2011) Autophagy in immunity and inflammation. Nature. 469 (7330):323–335. doi: 10.1038/nature09782.
Vojo Deretic, Tatsuya Saitoh & Shizuo Akira (2013) Autophagy in infection, inflammation and immunity. Nat Rev Immunol. 13(10): 722–737. doi: 10.1038/nri3532.
James Harris, Michelle Hartman, Caitrionna Roche, Shijuan G Zeng, Amy O'Shea, Fiona A Sharp, Eimear M Lambe, Emma M Creagh, Douglas T Golenbock, Jurg Tschopp, Hardy Kornfeld, Katherine A Fitzgerald & Ed C Lavelle (2011) Autophagy controls IL-1beta secretion by targeting pro-IL-1beta for degradation. J Biol Chem. 286 (11):9587–9597. doi: 10.1074/jbc.M110.202911.
Vojo Deretic & Beth Levine (2018) Autophagy balances inflammation in innate immunity. Autophagy. 14 (2):243–251. doi: 10.1080/15548627.2017.1402992.
Hongpeng Lv, Xin Liu, Weiwen Chen, Shiju Xiao, Yunrun Ji, Xuyang Han, Yafan Li, Xiaoxu Wang, Guangzhong Zhang & Ping Li (2021) Yangxue Jiedu Fang Ameliorates Psoriasis by Regulating Vascular Regression via Survivin/PI3K/Akt Pathway. J Immunol Res. 2021: 4678087. doi: 10.1155/2021/4678087.
Shu-Ting Pan, Yiru Qin, Zhi-Wei Zhou, Zhi-Xu He, Xueji Zhang, Tianxin Yang, Yin-Xue Yang, Dong Wang, Jia-Xuan Qiu & Shu-Feng Zhou (2015) Plumbagin induces G2/M arrest, apoptosis, and autophagy via p38 MAPK- and PI3K/Akt/mTOR-mediated pathways in human tonguesquamous cell carcinoma cells. Drug Des Devel Ther. 9: 1601–1626. doi: 10.2147/DDDT.S76057.
Yan Zhao, Huina Wu, Xiaoyan Xing, Yuqian Ma, Shengping Ji, Xinyue Xu, Xin Zhao, Sensen Wang, Wenyan Jiang, Chunyan Fang, Lei Zhang, Fang Yan & Xuejian Wang (2020) CD13 Induces Autophagy to Promote Hepatocellular Carcinoma Cell Chemoresistance Through the P38/ Hsp27/ CREB/ ATG7 Pathway. J Pharmacol Exp Ther. 374 (3): 512–520. doi: 10.1124/ jpet.120.265637.
Jemma L Webber & Sharon A Tooze (2010) New insights into the function of Atg9. FEBS Lett. 584(7):1319–1326. doi: 10.1016/j.febslet.2010.01.020.
Andrea Williams, Sovan Sarkar, Paul Cuddon, Evangelia K Ttofi, Shinji Saiki, Farah H Siddiqi, Luca Jahreiss, Angeleen Fleming, Dean Pask, Paul Goldsmith, Cahir J O'Kane, Rodrigo Andres Floto & David C Rubinsztein (2008) Novel targets for Huntington's disease in an mTOR-independent autophagy pathway. Nat Chem Biol. 4(5):295–305. doi: 10.1038/nchembio.79.
Ian G Ganley, Du H Lam, Junru Wang, Xiaojun Ding, She Chen & Xuejun Jiang (2009) ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy. J Biol Chem. 284 (18): 12297–12305. doi: 10.1074/jbc.M900573200.
Rei Unno, Tsuyoshi Kawabata, Kazumi Taguchi, Teruaki Sugino, Shuzo Hamamoto, Ryosuke Ando, Atsushi Okada, Kenjiro Kohri, Tamotsu Yoshimori & Takahiro Yasui (2020) Deregulated MTOR (mechanistic target of rapamycin kinase) is responsible for autophagy defects exacerbating kidney stone development. Autophagy. 16(4):709–723. doi: 10.1080/15548627.2019.1635382.
Hiroki Saito, Shigeo Godo, Saori Sato, Akiyo Ito, Yosuke Ikumi, Shuhei Tanaka, Tomoaki Ida, Shigemoto Fujii, Takaaki Akaike & Hiroaki Shimokawa (2018) Important Role of Endothelial Caveolin-1 in the Protective Role of Endothelium-dependent Hyperpolarization Against Nitric Oxide-Mediated Nitrative Stress in Microcirculation in Mice. J Cardiovasc Pharmacol. 71(2):113–126. doi: 10.1097/FJC.0000000000000552.
Susanne Karbach, Philip Wenzel, Ari Waisman, Thomas Munzel & Andreas Daiber (2014) eNOS uncoupling in cardiovascular diseases–the role of oxidative stress and inflammation. Curr Pharm Des. 20 (22): 3579–3594. doi: 10.2174/13816128113196660748.
Susanne Karbach, Andrew L Croxford, Matthias Oelze, Rebecca Schüler, Daniel Minwegen, Joanna Wegner, Lija Koukes, Nir Yogev, Alexei Nikolaev, Sonja Reißig, Alexander Ullmann, Maike Knorr, Maximilian Waldner, Markus F Neurath, Huige Li, Zhixiong Wu, Christoph Brochhausen, Jürgen Scheller, Stefan Rose-John, Carolin Piotrowski, Ingo Bechmann, Markus Radsak, Philipp Wild, Andreas Daiber, Esther von Stebut, Philip Wenzel, Ari Waisman & Thomas Münzel (2014) Interleukin 17 drives vascular inflammation, endothelial dysfunction, and arterial hypertension in psoriasis-like skin disease. Arterioscler Thromb Vasc Biol. 34(12): 2658–2668. doi: 10.1161/ATVBAHA.114.304108.
Cezar Rangel Pestana, Jorge Camargo Oishi, Heloísa Sobreiro Salistre-Araújo & Gerson Jhonatan Rodrigues (2015) Inhibition of autophagy by chloroquine stimulates nitric oxide production and protects endothelial function during serum deprivation. Cell Physiol Biochem. 37(3):1168–1177. doi: 10.1159/000430240.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Autophagy inhibits inflammation via down-regulation of p38 MAPK/mTOR signaling cascade in endothelial cells

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

NO/NOS

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1