Identification and initial characterization of Hfq-associated sRNAs in Histophilus somni strain 2336

doi:10.21203/rs.3.rs-2066234/v1

Background

Small RNAs (sRNA), in association with the global chaperone regulator Hfq, positively or negatively regulate gene expression in bacteria. For this study, Histophilus somni sRNAs that bind to Hfq were first identified and then partially characterized to initiate understanding their role in regulation of virulence factors, which is unknown in H. somni.

Results

The Hfq-associated sRNAs in H. somni were first identified by co-immunoprecipitation using anti-Hfq antibody, followed by sRNA sequencing. Sequence analysis of the sRNA samples identified 180 putative sRNAs, out of which 17 were present in pathogenic strain 2336, but not in non-pathogenic strain 129Pt. Bioinformatic analyses depicted that the sRNAs HS9, HS79, and HS97 bound to the 5′-untranslated region (5′-UTR) of many genes involved in virulence/biofilm formation. Furthermore, multi-sequence alignment of these sRNA candidates revealed that these sRNAs could interact with sigma-54, which is a transcription factor linked to important bacterial traits, including motility, virulence, and biofilm formation. Northern blotting was used to determine the approximate size, abundance and any alternate splice products of sRNAs. Two bands of ~ 115 bp and ~ 60 bp were identified for sRNA HS9, sRNA HS79 had three bands of ~ 80 bp, ~ 130 bp and ~ 300 bp, and two bands of ~ 140 bp and ~ 200 bp were identified for HS97. All three sRNA candidates were confirmed to bind Hfq, as determined by electrophoretic mobility shift assays using sRNAs synthesized by in vitro transcription and recombinant Hfq. The exact transcriptional start site of the sRNA candidates were determined by RNA ligase-mediated rapid amplification of cDNA ends, followed by cloning and sequencing.

Conclusions

In this study, a number of Hfq-associated sRNAs were identified and characterized in the bovine pathogen, H. somni 2336. Analysis of these sRNAs showed that they may be driven by environmental factors and mayave important regulatory roles in H. somni virulence and biofilm formation.

sRNA

Histophilus somni

Hfq

Regulation

Biofilm

Virulence

Histophilus somni is one of the major etiologic agents responsible for bovine respiratory disease (BRD) complex, and is also responsible for multiple systemic diseases, including septicemia, thrombotic meningoencephalitis, myocarditis, arthritis, infertility, and abortion [1–5]. BRD is the result of complex interactions between H. somni, the environment, host, and other bacterial and viral pathogens [6]. Genome sequences, complete or partial, have been obtained for over 65 H. somni strains (NCBI, GenBank), which have enabled whole genome comparisons to be made that provide understanding the differences and similarities in the number and composition of genes involved in metabolism, virulence, and pathogenesis [7]. H. somni strain 2336, a respiratory disease isolate, has a genome of 2.2 Mbp harboring 2044 predicted open reading frames (ORFs), of which only 1569 have an assigned biological function [8].

Bacterial small RNAs (sRNAs) are a class of regulatory RNAs ranging in size from 40 to 500 nucleotides [9]. sRNAs function primarily as post-transcriptional regulators by binding to specific mRNA targets altering their stability and/or translation, or by interacting with proteins and modulating their activity [10]. The sRNA interactions are often mediated by RNA chaperones such as Hfq, which assist in annealing and stabilizing sRNA and the sRNA-target complex [11]. Functional characterization of several known sRNAs indicated that post-transcriptional regulation, mediated by sRNAs, play crucial roles in a variety of biological processes including expression of outer membrane proteins [12], iron homeostasis [13], quorum sensing [14], and bacterial virulence [15]. According to the sRNA database sRNA map, more than 900 sRNAs have been identified so far in microbial genomes, of which most are transcribed from the intergenic regions [9]. In Escherichia coli, more than 100 sRNA regulators have been reported, of which the majority act in association with Hfq [16]. In recent years, sRNAs have been identified in many more bacterial species including Vibrio cholerae, Pseudomonas aeruginosa, Staphylococcus aureus, Streptomyces coelicolor, Salmonella enterica, Mycobacterium tuberculosis, Bacillus subtilis, Listeria monocytogenes, and others. [17–23]. The sRNAs found in genomes of bacterial pathogens are reported to control various housekeeping activities and functions required for pathogenesis [24].

It is difficult to identify all the functional elements in the genome, particularly sRNAs, with the current genome annotation programs. Several characteristics of sRNAs make them difficult to identify by straightforward computational and experimental approaches [25]. Thus, very little is known about the non-coding RNAs in the bovine pathogen H. somni. An RNA sequencing-based experimental annotation of the H. somni 2336 genome lead to the identification of novel small RNA candidates [8]. In this study, we isolated sRNAs that bound to an epitope-tagged H. somni Hfq protein and sequenced these Hfq-bound RNAs to identify Hfq-binding sRNAs with high specificity. Bioinformatic analysis and partial characterization of these sRNAs predicted that many of the sRNAs are involved in virulence and biofilm formation in H. somni. This is the first report that describes the identification and preliminary characterization of novel Hfq-associated sRNA candidates using the described approach to discover non-coding sRNAs in H. somni.

Enrichment of Hfq-associated transcripts by co-immunoprecipitation

H. somni 2336 cells were grown in CTT broth to early stationary phase. The cell extract was incubated with Hfq coupled to magnetic beads through anti-Hfq IgG to bind extracted sRNAs, as described in Materials and Methods. The successful recovery and quality of the sRNAs were confirmed by RNA gel electrophoresis (Fig. 1), followed by analysis using Agilent 4200 TapeStation system (Agilent Technologies, Inc., Santa Clara, CA). cDNA libraries were constructed from the 6 sRNA preparations that had the greatest sRNA concentration and least salt contamination, followed by deep sequencing using Illumina technology.

Transcriptome-wide analyses of RNA sequencing results

Illumina sequencing generated a total of 20 million reads of 100 bp length for each cDNA library. The size of sequencing reads were good enough for mapping analysis (≥20 bp) having an average quality score of >32. Two of the sRNA samples from which a large number of reads were obtained (>185,000) were considered for further analysis. The mapping of the reads to the H. somni 2336 reference genome (GenBank accession number NC_010519.1) was performed by Geneious Prime^® 2021.0.3 (http://www.geneious.com). Alignment of the reads to the H. somni genome showed an abundance of rRNA, tRNA and tmRNA, with a portion of the reads mapped to intergenic regions.

Analysis of the intergenic regions of the H. somni genome

The aligned RNA-seq based transcriptome map was examined in comparison to the H. somni genome, and intergenic regions in the genome were identified. Promoters and terminators were predicted to confirm the identified transcripts using online tools. A total of 180 sRNA candidates were identified at the intergenic regions (Table 2), out of which 47 were already reported in H. somni 2336 [8]. It was also determined that 17 of the known H. somni sRNA candidates were unique to strain 2336. The denotations for the 5’ and 3’ ends (start# and end#) for the sRNAs in Table 2 refer to the boundaries of transcriptionally active regions in the H. somni genome. Of these, three were housekeeping sRNAs (ssrS, ffs and rnpB), which are well characterized in other bacterial strains [26-28]. The majority of the identified sRNA candidates (70%) were shorter than 200 bp (size range 50-596 bp). Promoters and rho-independent terminators were predicted for 143 and 95 sRNAs, respectively. The depth of coverage of one of the H. somni strain 2336 novel sRNAs viewed in Geneious Prime^® is shown in Fig. 2.

The sequencing data was screened manually using Geneious Prime^®. The sequence comparison of the sRNA candidates were comparable with those previously reported for H. somni 2336 [8], with those sRNAs that bind to the ribosome binding site of mRNAs (α-RBS), and with those sRNAs that regulate metabolism of lysine and glycine. The sRNAs isrK, tmRNA, and gcvB were also identified. isrK is one of the sRNAs that showed greater sequence coverage in H. somni 2336. tmRNA encoded by the ssrA gene was also highly expressed in the H. somni sequence map. Multi-sequence alignment of the H. somni sRNA candidate HS166 (gcvB) showed 99% identity to that of the homologous sRNA in P. multocida (Fig. 3A). The comparative sequence analysis of HS166 to gcvB of P. multocida and E. coli revealed two conserved sequences (R1 and R2) reported earlier [29] (Fig. 3B). Functional characterization of the above-mentioned sRNAs is needed in order to determine the exact role of these regulatory entities in H. somni 2336.

Identification and characterization of novel sRNAs in H. somni 2336

The potential non-coding intergenic regions of the H. somni 2336 genome were identified using Geneious Prime^TM. A total of 10 sRNA candidates (HS9, HS11, HS14, HS26, HS72, HS79, HS86, HS97, HS98, and HS147) were considered for further characterization based on preliminary bioinformatics analysis. All of these 10 sRNAs displayed sequence similarity to the well-studied quorum sensing regulatory sRNAs (Qrrs) in Vibrio species with HS147 having the most similarity to Qrr1 of V. anguillarum [30]. Multisequence analysis revealed that many of these sRNAs could interact with the sigma-54 transcription factor (encoded by rpoN), which is known to bind to Qrrs in Vibrio species to control quorum sensing and virulence [31]. For the candidates HS14, HS26, and HS98, 9 out of 11 bp of the conserved consensus bases in the sigma 54 binding motif were identical [32] (Table 3). In the case of HS9, HS11, and HS72, 8 of the 11 bases matched the conserved consensus bases in the sigma 54 binding motif. For the candidates HS86 and HS97, 7 of the 11 bp were identical to the consensus bases in the sigma 54 binding motif. The sRNA candidate HS1 showed the greatest sequence similarity to DsrA, which controls the alternative sigma factor RpoS in E. coli [33]. RpoS contributes to virulence in many pathogens either by directly regulating the expression of virulence factors or by enhancing bacterial survival against host defense systems [34]. Multi-sequence alignment depicted that HS11 and HS14 had the highest sequence similarity to the sRNA rprA, which plays an important role in biofilm formation in many Gram-negative bacteria [35]. rprA regulates the expression of the master biofilm regulator genes csgD, ydaM (the latter encodes for diguanylate cyclase, which controls the expression of csgD), and rpoS (encoding a stress transcription factor), all of which are involved in biofilm formation [35, 36].

Target predictions for the sRNA candidates

Target predictions for the sRNA candidates were performed using IntaRNA [37], which indicated that many of the sRNAs could bind to the 5′-untranslated region (5′-UTR) of several genes involved in virulence or biofilm formation in H. somni. A total of 9 sRNAs could bind to the 5’-UTR of a LuxR family candidate HS_0042 (nitrate/nitrite response regulator) with HS11 having the greatest sequence similarity (Fig. 4). The sRNA candidate, HS97 displayed the greatest sequence similarity to the 5’-UTR of another LuxR family candidate HS_0901 (regulatory protein, sigma-70 region 4 type 2) of H. somni. Many of the sRNAs shortlisted could bind to the 5’-UTR of uspE (encoding a stress response regulator), uspA (encoding a stress protein), and narQ (encoding a nitrite/nitrate sensor kinase) of H. somni. UspE is a global regulator that plays an important role in virulence and biofilm formation in H. somni [38]. The stress protein UspA contributes to stress resistance and virulence in Salmonella [39]. The nitrate sensor protein NarQ along with the nitrate response regulator NarP controls biofilm formation by regulating the expression of CsgD, the master biofilm regulator [40]. Thus, preliminary analysis of the Hfq-associated sRNAs from H. somni shows that they may contribute to important regulatory roles in virulence and biofilm formation in H. somni.

Northern blotting to verify the presence of selected sRNA candidates

Based on the sequence similarity to currently known sRNAs that affect virulence in Gram-negative bacteria, three sRNA candidates (HS9, HS79, and HS97) were further studied. Northern blotting was used to determine the approximate size and the expression level of the sRNAs, and to determine if they make any splice products. Northern blots demonstrated two bands of ~115 bp and ~60 bp for sRNA HS9, three bands of ~80 bp, ~130 bp, and ~300 bp for HS79, and two bands of ~140 bp and ~200 bp for HS97 (Fig. 5). The multiple bands for the sRNAs in the Northern blots indicated post-transcriptional splicing or multiple transcripts were synthesized from the same promoter.

Determination of the transcriptional start site of selected sRNA candidates

Two of the sRNA candidates, HS79 and HS97, were further characterized by 5’-RLM-RACE. The advantage of RLM-RACE over conventional RACE is that the former only amplifies the primary transcripts, and not the processed products. The potential bands (indicated with an oval shape) in Fig. 6A were excised, cloned, and sequenced to determine the transcriptional start sites. For sRNA HS79, the transcriptional start site identified matches well with one of the bands (~300 bp) observed by Northern blotting. For HS97, the position of the transcriptional start site matched the band with a size of ~140 bp in the Northern blot. Further analysis of the promoter region of the sRNAs with the online software BPROM (Softberry Inc.) revealed additional transcriptional start sites upstream of the transcriptional start site determined by RLM-RACE (Fig. 6B,C), which may correlate with the multiple bands detected by Northern blotting.

EMSA to confirm the interaction of selected sRNAs with recombinant Hfq

To confirm the binding of sRNAs with Hfq, recombinant Hfq was expressed and purified, and then treated with in vitro transcribed sRNAs HS9, HS79, and HS97 by EMSA (Fig.7). The data indicated that all three sRNAs specifically bound to the recombinant Hfq, and the intensity of the band shift in EMSA was in accordance to the concentration of recombinant Hfq added.

Prediction of secondary structures of selected sRNAs

Once the 5’ and 3’ termini of the sRNA transcripts were assigned by RLM-RACE, and by Northern blotting and bioinformatics analysis, the resulting sequences were further analyzed for the prediction of secondary structures by RNAfold web server [41]. The predicted secondary structure of the sRNAs HS79 and HS97 are shown in Fig.8. These sRNAs contained single stranded unpaired regions rich in adenosine and uridine and these AU-rich regions have been reported to be putative binding sites for Hfq in other bacteria [42]. The complex RNA-fold structures with several stem loops along with the multiple target genes predicted by IntaRNA [37] is indicative of the potential of these sRNAs to control diverse biological processes.

Despite recent advancements in sequencing technologies for the identification of bacterial non-coding RNAs, the role of sRNAs as post-transcriptional regulators in H. somni is poorly understood. In 2012, Kumar et al. [8] identified a number of sRNAs in H. somni based on an RNA-Seq based transcriptome map. In that study, RNA was isolated from H. somni cells, sequenced, reads were mapped to the H. somni genome sequence, and the intergenic regions were analyzed to identify potential sRNAs. A total of 94 sRNAs were identified in the H. somni genome, out of which many sRNAs were unique to H. somni strain 2336 compared to the non-virulent strain 129 Pt [8]. In our current study, the global regulatory protein Hfq-associated sRNAs were isolated by co-immunoprecipitation with anti-Hfq antibody, followed by sequencing and bioinformatics analysis to identify potential sRNA candidates in H. somni. Hfq is widely known to regulate important bacterial traits including quorum sensing, virulence, pathogenesis, biofilm formation etc. in many Gram-negative bacteria [43-45]. Thus, the identification and characterization of sRNAs associated with Hfq is valuable information on the post-transcriptional regulation of genes involved in virulence and pathogenesis in H. somni. Out of the 180 intergenic regions identified in this study, 47 have been previously reported [8].

Northern blotting was carried out to determine the approximate size, abundance, and splice products of any of the selected sRNAs. EMSA experiments with selected sRNA candidates confirmed that these sRNAs specifically bound to Hfq. Promoters and rho-independent terminators were predicted for a total of 143 and 95 sRNAs respectively. Transcriptional start sites were determined for selected sRNAs, which further enabled the structural prediction of sRNAs. A large number of sRNAs did not provide any information on rho-independent terminators with online prediction tools and further analysis is needed to categorize them under either novel sRNAs or novel genes.

A number of sRNAs, including isrK, tmRNA, gcvB and those that regulate metabolism of lysine and glycine were identified in this study and it is in accordance with the previous H. somni study [8]. Most of these sRNAs are known to play important regulatory roles in virulence, pathogenesis, acid resistance, thermotolerance, and osmotic stress response in many Gram-negative bacteria [46-51]. In Salmonella typhimurium, isrK is expressed in the stationary phase under conditions known to regulate invasion, including pH, low magnesium levels, and low oxygen [46]. tmRNA contributes to virulence and pathogenesis in many bacterial pathogens including Legionella pneumophilia, Salmonella enterica Serovar Typhimurium, Francisella tularensis, Pseudomonas aeruginosa, and others [47-50]. tmRNA is important in the regulation of thermotolerance, osmotic stress, and the optimal production of virulence determinants in these pathogens [47-50]. gcvB is known to regulate a number of amino acid transport systems as well as amino acid synthesis genes in a number of pathogenic bacteria, including Yersinia pestis, Haemophilus influenzae, Vibrio cholerae, Salmonella typhimurium, Klebsiella pneumoniae, and Pasteurella multocida [52-57]. GcvB plays important regulatory roles in oxidative stress, biofilm formation, and lipid A and lipopolysaccharide modifications in Gram-negative bacteria [58-61]. gcvB potentially controls ~1% of the mRNAs expressed in E. coli and Salmonella [61, 62]. In E. coli, gcvB up-regulates the oxidative stress response regulator, OxyR [58]. gcvB also plays a crucial role in acid resistance by upregulating the levels of the alternate sigma factor RpoS [51]. In addition, lipid A and lipopolysaccharide (LPS) modifications are under the control of gcvB, thereby altering LPS structure and the potential virulence phenotype [60, 61]. The master biofilm regulator, CsgD is also under the regulation of gcvB in E. coli [59]. In P. multocida, another bovine respiratory pathogen that is closely related to H. somni, the overexpression of gcvB results in increased lag phase growth [57]. However, growth rate and biofilm formation were not affected in a gcvB deletion mutant of P. multocida, in contrast to that in E. coli [57]. Further characterization of gcvB in H. somni is needed to understand the regulatory role of gcvB in the virulence of this respiratory pathogen.

A number of novel sRNAs identified showed sequence similarity to those sRNAs regulating quorum sensing, virulence, and biofilm formation in Gram-negative bacteria. Target prediction of the sRNAs revealed a number of interesting gene candidates including the LuxR family candidate HS_0042 (nitrate/nitrite response regulator), narQ (encoding a nitrite/nitrate sensor kinase), LuxR family candidate HS_0901 (regulatory protein, sigma-70 region 4 type 2), uspE (encoding a stress response regulator), and uspA (encoding a stress protein). The stress protein UspA plays a crucial role in the regulation of stress resistance and virulence in Salmonella [39]. Our group has reported that UspE is a global regulator controlling virulence and biofilm formation in H. somni [38]. The LuxR family candidate HS_0901 (regulatory protein, sigma-70 region 4 type 2) and LuxR family candidate HS_0042 (nitrate/nitrite response regulator) are yet to be characterized in H. somni. Recently, Martín-Rodríguez et al. reported that NarQ, along with nitrate response regulator NarP, plays a regulatory role in biofilm formation by uropathogenic E. coli [40]. Thus, the functional characterization of the nitrate response regulator HS_0042 (LuxR family candidate) may identify its role in the regulatory network of biofilm formation in H. somni. In addition, further studies on the sRNAs that are associated with these important regulatory genes would facilitate future studies to develop new promising strategies to effectively prevent diseases due to H. somni. Furthermore, NarQ and NarP regulates the expression of nitrate and nitrite reductases depending on the availability of nitrate/nitrite in E. coli [63, 64]. The expression of quorum sensing genes are also under the influence of environmental factors such as external pH, antibiotic stress etc. in bacteria [65]. Thus, the sRNA target genes UspA, UspE, NarQ, HS_0042 (nitrate/nitrite response regulator) etc. likely respond to environmental factors acting on the expression of regulatory RNAs in H. somni.

In this study a total of 180 H. somni strain 2336 putative sRNAs, including numerous novel sRNAs, were identified that are associated with the global regulatory protein Hfq under the growth conditions tested. We also identified highly conserved noncoding sRNAs, including the housekeeping sRNAs ssrS, ffs, and rnpB, and tmRNA. Bioinformatic analysis revealed that many of the sRNA candidates showed similarity to sRNAs involved in the regulation of quorum sensing, virulence factors, and biofilm formation in other bacterial pathogens. A number of sRNA candidates could interact with the 5’-UTR of genes controlling biofilm formation in H. somni strain 2336. In addition, the sRNA targets identified support the role of environmental factors on the expression of sRNAs in H. somni. Some of the sRNA candidates were characterized by Northern blotting, RLM_RACE, and EMSA. This is the first study in which Hfq-associated sRNAs were identified and characterized in H. somni. Further functional characterization of these Hfq-associated sRNAs may shed light into the post-transcriptional regulatory network, and the role of Hfq and sRNAs in the virulence and pathogenicity of H. somni.

Bacterial strains and culture conditions

The bacterial strains and plasmids used in this study are shown in Table 1. H. somni strain 2336 was cultivated on Columbia agar (BD Difco^TM,Franklin Lakes, NJ) supplemented with 5% sheep blood, and incubated in 5% CO₂ at 37 ℃ overnight. Planktonic cultures of H. somni 2336 were cultured in Columbia broth (BD Difco^TM) supplemented with 0.1% Trizma base and 0.01% thiamine monophosphate [66] (CTT), and incubated at 37 ℃ with shaking at 180 rpm. E. coli was cultivated in Luria-Bertani medium (BD Difco^TM) at 37 ℃ with ampicillin (100 µg/ml) added for growth of recombinant strains.

DNA manipulations

Standard cloning procedures were carried out in this study as described earlier [67]. Oligonucleotides were purchased from Integrated DNA Technologies (IDT, Research Triangle Park, NC) and the oligonucleotides used in this study are presented in Table 1. The genomic DNA from H. somni 2336 and the plasmid DNA from E. coli were isolated using the MasterPure™ DNA purification kit (Biosearch Technologies, Middleton, WI) and Zyppy plasmid miniprep kit (Zymo Research, Irvine, CA), respectively. The plasmids were introduced into E. coli by heat shock [68]. Phusion^® High-Fidelity DNA Polymerase (New England Biolabs (NEB), Ipswich, MA) was used for polymerase chain reaction (PCR) amplification of DNA fragments. The DNA fragments were eluted and purified from the gel using the Zymogen gel DNA recovery kit (Zymo Research). Restriction and DNA modifying enzymes were purchased from NEB. The nucleotide sequences of recombinant strains were confirmed by sequencing (Psomagen, Inc., Brooklyn, NY).

Overexpression and purification of hexahistidyl-tagged Hfq (His6-Hfq)

For the overexpression of His₆-Hfq, the complete coding region of Hfq (291 bp) of H. somni 2336 was amplified by PCR using the primer pair Hfq_overex_F/ Hfq_overex_R, and subcloned into the His-tag expression vector pET101/DTopo yielding pET-hfq. The recombinant plasmid was introduced into E. coli One Shot™ BL21 Star™ (DE3) cells (Invitrogen, Carlsbad, CA) by transformation. The overexpression of Hfq was induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at an OD₆₀₀ of 0.6, and incubation of the culture was continued for 5 h at 37 ℃. Induced cells were harvested by centrifugation (5000 x g for 15 min) and lysed by sonication (QSonica Sonicators, Newtown, CT) in lysis buffer [50 mM NaH₂PO₄ (pH 8), 500 mM NaCl, and 10 mM imidazole]. After centrifugation, the soluble supernatant was collected, mixed with nickel-nitrilotriacetic acid-agarose solution (Qiagen, Germantown, MD), followed by loading into a polypropylene column (Thermo Fisher Scientific, Waltham, MA). The column was washed with wash buffer [50 mM NaH₂PO₄ (pH 8), 500 mM NaCl, and 20 mM imidazole] multiple times and the Hfq protein was eluted using elution buffer with varying imidazole concentration (100-300 mM imidazole). The purified Hfq was dialyzed overnight against phosphate buffered saline (PBS), pH 7.4, to remove imidazole and stored at -80 ℃. The purification of over-expressed Hfq was confirmed by SDS-PAGE followed by Western blotting (data not shown) with horseradish peroxidase (HRP)-conjugated antibody (SeraCare, Milford, MA) to the V5 epitope of the recombinant protein.

Production of antibodies to Hfq

Three female Sprague Dawley rats (Charles River Laboratories, Kingston, NY) were acclimated at the Long Island University vivarium for 7 days prior to any procedures. Food and water were provided ad libitum. The rats were injected subcutaneously (anesthesia was not required) with an emulsion containing 30 µg of purified recombinant Hfq mixed with 120 µl of PBS and 150 µl of Freund’s complete adjuvant (Thermo Fisher Scientific). Before the injection, 300 µl of peripheral blood was collected from the tail vein to obtain pre-immune serum while the animals were restrained in a restraining tube. A control group was not required as the rats were only used to produce antibodies for isolating Hfq-bound sRNA. Three weeks later, 300 µl of blood was collected to determine the serum antibody titer, followed by a booster injection containing 30 µg of purified Hfq in Freund’s incomplete adjuvant (Thermo Fisher Scientific), as described above. The animals were boosted a third time three weeks later with 100 µg of purified Hfq in TiterMax Gold adjuvant (Sigma Aldrich, St. Louis, MO); blood was collected to determine the antibody titer. A fourth booster injection was given intravenously 3 weeks later with 300 µg of purified Hfq in PBS. None of the rats died during these procedures or demonstrated any clinical symptoms requiring intervention. The rats were euthanized with CO₂ and exsanguinated by cardiac puncture 3 days after the fourth booster. The blood was allowed to clot, and the sera stored at -20 ℃. An antibody titer to Hfq of greater than 1:10,000 was confirmed by enzyme-linked immunosorbent assay (ELISA), as described previously [29].

Procedures on animals were approved by the Long Island University Institutional Animal Care and Use Committee under protocol ID number 2021-001, February 17, 2021.

Isolation of Hfq-associated sRNA

Hfq-associated sRNAs were co-immunoprecipitated, as previously described [21]. Anti-Hfq IgG was isolated from the serum using the ImmunoPure^®Melon^TMgel IgG spin purification kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. After dialysis against coupling buffer, the purified IgG was coupled to PIERCE^TM NHS-activated magnetic beads (Thermo Fisher Scientific), as recommended by the manufacturer, and stored at 4 ℃ until used. Briefly, 300 µl of magnetic beads were mixed with 300 µl of anti-Hfq IgG (0.439 mg/ml) in coupling buffer, followed by incubation for 1-2 h at room temperature with gentle rotation. The beads were collected using a magnetic stand, washed with ultrapure water, and incubated in quenching buffer for 2 h. The collected beads were washed multiple times with ultrapure water and storage buffer before being suspended in 300 µl of storage buffer (Thermo Fisher Scientific). Hfq and associated sRNAs were co-precipitated from cell extracts of H. somni after growing the bacteria to stationary phase. Following centrifugation (5000 x g for 15 min) the bacteria were washed in binding/washing buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.05% Tween 20, and protease inhibitor tablets (Thermo Fisher Scientific)] followed by sonication to lyse the bacteria (4 times 15-sec bursts at high intensity on ice with 1-min intervals). The unbroken cells were removed by centrifugation at 14,500 X g for 45 min, and the supernatant was collected. The co-immunoprecipitation of Hfq and associated sRNAs was carried out according to the protocol given for PIERCE^TM NHS-activated magnetic beads (Thermo Fisher Scientific). Briefly, 25 µl of antibody-coupled magnetic beads were mixed with 500 µl of diluted cell extract and incubated with gentle rotation at room temperature for 1-2 h. The beads were collected with a magnetic stand, washed with binding buffer 4 times, followed by washing with ultrapure water. The Hfq and associated sRNAs were eluted with 100 µl of elution buffer. The Hfq-associated sRNAs were separated from Hfq using TRIzol^TM LS reagent (Invitrogen) according to the manufacturer’s protocol.

RNA sequencing and data analysis

The RNA samples were processed for cDNA library construction and sequencing at the Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN. The cDNA libraries were prepared using the TruSeq small RNA preparation kit (Illumina Baltimore, Baltimore, MD) and the sequencing was performed using Illumina NextSeq 75 cycles High Output kit (Illumina) following the manufacturer’s protocol. Reads were adapter-trimmed and quality filtered using Trimmomatic 0.38. An average base quality score of 20 over a window of 3 bases was set as the cutoff threshold. Cleaned reads were mapped to the H. somni 2336 reference genome sequence retrieved from NCBI (NC_010519.1) using Geneious Prime^® 2021.0.3 (http://www.geneious.com). Geneious Prime® 2021.0.3 with default parameters generated the read coverage and read counts per gene. All intergenic regions of >30 bp were considered for read count analysis. The promoter and rho-independent terminators of the intergenic regions were predicted by BPROM (Softberry Inc., Mt. Kisco, NY) and ARNold [70], respectively. sRNA secondary structures were predicted by RNAfold webserver with default parameters [41].

The complete RNA sequences are accessible through NCBI BioProject under accession number PRJNA845786 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA845786).

RNA extraction

Total RNA and microRNA were extracted from H. somni cells using Qiagen RNeasy® Mini Kit (Qiagen) and mirVana^TM miRNA isolation kit (Life Technologies, Carlsbad, CA) respectively, following the manufacturer’s protocol. The quality and quantity of the RNAs were evaluated by NanoDrop (Thermo Fisher Scientific) and gel electrophoresis.

In vitro RNA transcription

The DNA sequences of the sRNAs HS9, HS79, and HS97 were amplified from H. somni genomic DNA by PCR using forward primers harboring a T7 promoter sequence at the 5’-end. The PCR products were used as template for the synthesis of sRNAs HS9, HS79, and HS97 using MAXIscript^® Kit (Invitrogen), according to the manufacturer’s instructions. Briefly, the template DNA was mixed with transcription buffer, deoxyribonucleotide triphosphates (dNTPs) and T7 RNA polymerase enzyme mix, and incubated for 1 h at 37℃. The transcribed product was treated with DNAse to remove the DNA template, followed by purification of the RNA using RNeasy® MinElute® Cleanup Kit (Qiagen) according to the manufacturer’s protocol. The specificity and quality of the transcribed RNAs were confirmed by TBE (Tris/Borate/Ethylenediaminetetraacetic acid)-Urea gel (15%) gel electrophoresis.

Northern blotting

Based on the sequence similarity to currently known sRNAs that affect virulence in other Gram-negative bacteria, three sRNA candidates (HS9, HS79, and HS97) were selected for further studies. Northern blotting of the sRNA candidates were conducted using North2South^® Chemiluminescent Hybridization and Detection Kit (Thermo Fischer Scientific) according to the manufacturer’s protocol. Briefly, the miRNA isolated from H. somni cells was loaded onto a TBE-Urea gel (15%) and run at a constant voltage of 180 V for 85 min until the bromophenol blue tracking dye reached the bottom of the gel. As a size marker, a low range ssRNA ladder (New England Biolabs, MA, USA) was also loaded. Following electrophoresis, the RNA gels were rinsed in five gel volumes of 0.5x TBE buffer for 30 min. RNA was then transferred onto nylon membranes (Biodyne^TM Precut Nylon Membranes, Thermo Fisher Scientific) at 20 V for 90 min, using Trans-Blot SD Semi-Dry Transfer Cell (Biorad, Hercules, CA). Finally, the RNA was cross-linked to the membrane by baking at 80 ℃ for 15 min before the hybridization process. Pre-hybridization and hybridization procedures were carried out according to the manufacturer’s protocol. For the hybridization, denatured (boiled) biotinylated probes (30 ng per ml) were added to the hybridization buffer and incubated overnight with shaking at 42 ℃. The membranes were washed and developed according to the manufacturer’s protocol, followed by imaging with ChemiDoc Imaging System (Biorad).

RNA Ligase-Mediated (RLM)-Rapid Amplification of cDNA Ends (RACE)

RLM-RACE was performed using FirstChoice^® RLM-RACE Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. Briefly, total RNA extracted from H. somni cells was treated with Calf Intestine Alkaline Phosphatase (CIP) for 1 h at 37 ℃, and purified by ethanol precipitation. The purified RNA was treated with Tobacco Acid Pyrophosphatase (TAP) for 1 h at 37 ℃. The treated RNA was ligated to the RNA adaptor sequence at the 5’-end with T4 RNA ligase by incubating at 37 ℃ for 1 h. The ligation product was reverse-transcribed with M-MLV Reverse Transcriptase at 42 ℃ for 1 h. The cDNAs were amplified by nested PCR (according to the RLM_RACE Kit instructions) and the PCR products were visualized by agarose gel electrophoresis, purified, cloned into pUC19, and the recombinant clones were sequenced to identify transcriptional start sites.

Electrophoretic Mobility Shift Assay (EMSA)

EMSA was carried out to confirm the interaction of three sRNAs (HS9, HS79, and HS97) with the recombinant Hfq. The reaction buffer (15 µl) contained binding buffer [10 mM Tris-HCl (pH 7.4)], 6% glycerol, 50 µg/ml BSA and 0.75 µg Baker’s yeast tRNA. Two hundred ng of in vitro transcribed sRNAs and recombinant Hfq (varying concentrations of 0.65 µM – 5 µM) were added to the reaction mixture and incubated at RT for 30 min. The reaction mixtures were electrophoresed on a pre-run (100 V for 20 min) Novex^TM retardation gel (6% native polyacrylamide gel) (Thermo Fisher Scientific) in 0.5x TBE buffer at 100 V for 90 min followed by staining with GelGreen^® nucleic acid gel stain (Biotium, Fremont, CA) and visualization.

Ethics approval and consent to participate

The animals were procured from Charles River Laboratories (Kingston, NY). All procedures with animals were carried out in accordance to the “GUIDE” for the care and use of Laboratory Animals. The procedures involving animals were approved by Long Island University Institutional Animal Care and Use Committee under protocol ID number 2021-001, February 17, 2021.

The following ARRIVE essential guidelines for use of animals were followed:

1. Study Design: Controls were not applicable or needed for only the production of antibodies to obtain Hfq-bound sRNA.

2. Sample size: We have followed the guidelines. The fewest number of animals to provide adequate antisera were used.

3. Inclusion and Exclusion Criteria: All 3 rats obtained were acceptable and included in the study. None were excluded due to ill health or complications during the study.

4. Randomization: Not applicable for this study

5. Blinding: Not applicable for this study

6. Outcome measures: 6a) Done; serum antibody titers were measured at regular intervals after injecting rats with antigen. This is mentioned in the methods session under ‘production of antibodies to Hfq’. 6b, Not applicable for this study.

7. Statistical Methods; Included in the text (with reference for the method followed).

8. Experimental Animals: Described in Methods.

9. Experimental Procedures: Now described in more detail in Methods.

10. Results: Not applicable for this study, except to state that a high antibody titer (>1:10,000) was obtained, and IgG isolated.

Consent for publication

Not applicable

Availability of data and materials

The complete RNA sequence datasets generated and/or analyzed during the current study are available in the NCBI BioProject repository under accession number PRJNA845786 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA845786).

The datasets generated and/or analyzed during this study are available from the corresponding author upon reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This work was supported by USDA-NIFA grant 2017-67015-26797 to TJI, and funds from Long Island University.

Author’s contributions

BS and DC performed most of the experiments, analyzed the data, and wrote the first draft of the manuscript. RJ did the bioinformatic analysis of the sequencing data. CC provided guidance and valuable suggestions for the work. TJI obtained the funding, designed the study, carried out some of the experiments, and edited the manuscript. All authors read and approved the final draft of the manuscript.

Acknowledgements

We thank Christopher McAllister for assistance with inoculation, bleeding, and sedation of the rats.

Gogolewski RP, Leathers CW, Liggitt HD, Corbeil LB. Experimental Haemophilus somnus pneumonia in calves and immunoperoxidase localization of bacteria. Vet Pathol. 1987;24(3):250-6.
Corbeil LB, Gogolewski RP, Stephens LR, Inzana TJ. Haemophius somnus: antigen analysis and immune responses. In: Donachie W, editor. Haemophius somnus, Actinobacillus, and Pasteurella. New York: Plenum Press; 1995. p. 63-73.
Stephens LR, Little PB, Wilkie BN, Barnum DA. Infectious thromboembolic meningoencephalitis in cattle: a review. J Am Vet Med Assoc. 1981;178(4):378-84.
Widders PR, Paisley LG, Gogolewski RP, Evermann JF, Smith JW, Corbeil LB. Experimental abortion and the systemic immune response to "Haemophilus somnus" in cattle. Infect Immun. 1986;54(2):555-60.
Corbeil LB, Blau K, Prieur DJ, Ward AC. Serum susceptibility of Haemophilus somnus from bovine clinical cases and carriers. J Clin Microbiol. 1985;22(2):192-8.
Ellis JA. The immunology of the bovine respiratory disease complex. Vet Clin North Am Food Anim Pract. 2001;17(3):535-50.
Siddaramappa S, Challacombe JF, Duncan AJ, Gillaspy AF, Carson M, Gipson J, et al. Horizontal gene transfer in Histophilus somni and its role in the evolution of pathogenic strain 2336, as determined by comparative genomic analyses. BMC Genomics. 2011;12:570.
Kumar R, Lawrence ML, Watt J, Cooksey AM, Burgess SC, Nanduri B. RNA-seq based transcriptional map of bovine respiratory disease pathogen "Histophilus somni 2336". PLoS One. 2012;7(1):e29435.
Huang HY, Chang HY, Chou CH, Tseng CP, Ho SY, Yang CD, et al. sRNAMap: genomic maps for small non-coding RNAs, their regulators and their targets in microbial genomes. Nucleic Acids Res. 2009;37(Database issue):D150-4.
Storz G, Altuvia S, Wassarman KM. An abundance of RNA regulators. Annu Rev Biochem. 2005;74:199-217.
Wagner EGH, Romby P. Small RNAs in bacteria and archaea: who they are, what they do, and how they do it. Adv Genet. 2015;90:133-208.
Guillier M, Gottesman S. Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs. Mol Microbiol. 2006;59(1):231-47.
Masse E, Vanderpool CK, Gottesman S. Effect of RyhB small RNA on global iron use in Escherichia coli. J Bacteriol. 2005;187(20):6962-71.
Lenz DH, Miller MB, Zhu J, Kulkarni RV, Bassler BL. CsrA and three redundant small RNAs regulate quorum sensing in Vibrio cholerae. Mol Microbiol. 2005;58(4):1186-202.
Romby P, Vandenesch F, Wagner EG. The role of RNAs in the regulation of virulence-gene expression. Curr Opin Microbiol. 2006;9(2):229-36.
Zhang A, Wassarman KM, Rosenow C, Tjaden BC, Storz G, Gottesman S. Global analysis of small RNA and mRNA targets of Hfq. Mol Microbiol. 2003;50(4):1111-24.
Saito S, Kakeshita H, Nakamura K. Novel small RNA-encoding genes in the intergenic regions of Bacillus subtilis. Gene. 2009;428(1-2):2-8.
Livny J, Brencic A, Lory S, Waldor MK. Identification of 17 Pseudomonas aeruginosa sRNAs and prediction of sRNA-encoding genes in 10 diverse pathogens using the bioinformatic tool sRNAPredict2. Nucleic Acids Res. 2006;34(12):3484-93.
Pichon C, Felden B. Small RNA genes expressed from Staphylococcus aureus genomic and pathogenicity islands with specific expression among pathogenic strains. Proc Natl Acad Sci U S A. 2005;102(40):14249-54.
Swiercz JP, Hindra, Bobek J, Bobek J, Haiser HJ, Di Berardo C, et al. Small non-coding RNAs in Streptomyces coelicolor. Nucleic Acids Res. 2008;36(22):7240-51.
Sittka A, Lucchini S, Papenfort K, Sharma CM, Rolle K, Binnewies TT, et al. Deep sequencing analysis of small noncoding RNA and mRNA targets of the global post-transcriptional regulator, Hfq. PLoS Genet. 2008;4(8):e1000163.
Mandin P, Repoila F, Vergassola M, Geissmann T, Cossart P. Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets. Nucleic Acids Res. 2007;35(3):962-74.
Arnvig KB, Young DB. Identification of small RNAs in Mycobacterium tuberculosis. Mol Microbiol. 2009;73(3):397-408.
Dorman CJ, Smith SGJ. Regulation of virulence gene expressin in bacterial pathogens. In: Groisman EA, editor. The Principle of Bacterial Pathogenesis. Massachusetts: Academic Press; 2001. p. 76-132.
Livny J, Waldor MK. Identification of small RNAs in diverse bacterial species. Curr Opin Microbiol. 2007;10(2):96-101.
Brown S, Fournier MJ. The 4.5 S RNA gene of Escherichia coli is essential for cell growth. J Mol Biol. 1984;178(3):533-50.
Jain SK, Gurevitz M, Apirion D. A small RNA that complements mutants in the RNA processing enzyme ribonuclease P. J Mol Biol. 1982;162(3):515-33.
Keiler KC, Waller PR, Sauer RT. Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science. 1996;271(5251):990-3.
Sharma CM, Darfeuille F, Plantinga TH, Vogel J. A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites. Genes Dev. 2007;21(21):2804-17.
Hammer BK, Bassler BL. Regulatory small RNAs circumvent the conventional quorum sensing pathway in pandemic Vibrio cholerae. Proc Natl Acad Sci U S A. 2007;104(27):11145-9.
Lilley BN, Bassler BL. Regulation of quorum sensing in Vibrio harveyi by LuxO and sigma-54. Mol Microbiol. 2000;36(4):940-54.
Dombrecht B, Marchal K, Vanderleyden J, Michiels J. Prediction and overview of the RpoN-regulon in closely related species of the Rhizobiales. Genome Biol. 2002;3(12):RESEARCH0076.
Sledjeski D, Gottesman S. A small RNA acts as an antisilencer of the H-NS-silenced rcsA gene of Escherichia coli. Proc Natl Acad Sci U S A. 1995;92(6):2003-7.
Dong T, Schellhorn HE. Role of RpoS in virulence of pathogens. Infect Immun. 2010;78(3):887-97.
Mika F, Busse S, Possling A, Berkholz J, Tschowri N, Sommerfeldt N, et al. Targeting of csgD by the small regulatory RNA RprA links stationary phase, biofilm formation and cell envelope stress in Escherichia coli. Mol Microbiol. 2012;84(1):51-65.
Majdalani N, Chen S, Murrow J, St John K, Gottesman S. Regulation of RpoS by a novel small RNA: the characterization of RprA. Mol Microbiol. 2001;39(5):1382-94.
Mann M, Wright PR, Backofen R. IntaRNA 2.0: enhanced and customizable prediction of RNA-RNA interactions. Nucleic Acids Res. 2017;45:435-9.
Pan Y, Subhadra B, Sandal I, Dickerman A, Inzana TJ. The role of uspE in virulence and biofilm formation by Histophilus somni. Vet Microbiol. 2021;263:109267.
Liu WT, Karavolos MH, Bulmer DM, Allaoui A, Hormaeche RD, Lee JJ, et al. Role of the universal stress protein UspA of Salmonella in growth arrest, stress and virulence. Microb Pathog. 2007;42(1):2-10.
Martín-Rodríguez AJ, Rhen M, Melican K, Richter-Dahlfors A. Nitrate Metabolism Modulates Biosynthesis of Biofilm Components in Uropathogenic Escherichia coli and Acts as a Fitness Factor During Experimental Urinary Tract Infection. Front Microbiol. 2020;11:26.
Gruber AR, Lorenz R, Bernhart SH, Neuböck R, Hofacker IL. The Vienna RNA websuite. Nucleic Acids Res. 2008;36(Web Server issue):W70-4.
Link TM, Valentin-Hansen P, Brennan RG. Structure of Escherichia coli Hfq bound to polyriboadenylate RNA. Proc Natl Acad Sci U S A. 2009;106(46):19292-7.
Kulesus RR, Diaz-Perez K, Slechta ES, Eto DS, Mulvey MA. Impact of the RNA chaperone Hfq on the fitness and virulence potential of uropathogenic Escherichia coli. Infect Immun. 2008;76(7):3019-26.
Lenz DH, Mok KC, Lilley BN, Kulkarni RV, Wingreen NS, Bassler BL. The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell. 2004;118(1):69-82.
Liu Y, Wu N, Dong J, Gao YP, Zhang X, Mu CH, et al. Hfq Is a Global Regulator That Controls the Pathogenicity of Staphylococcus aureus. Plos One. 2010;5(9).
Padalon-Brauch G, Hershberg R, Elgrably-Weiss M, Baruch K, Rosenshine I, Margalit H, et al. Small RNAs encoded within genetic islands of Salmonella typhimurium show host-induced expression and role in virulence. Nucleic Acids Res. 2008;36(6):1913-27.
Brunel R, Charpentier X. Trans-translation is essential in the human pathogen Legionella pneumophila. Sci Rep. 2016;6:37935.
Julio SM, Heithoff DM, Mahan MJ. ssrA (tmRNA) plays a role in Salmonella enterica serovar Typhimurium pathogenesis. J Bacteriol. 2000;182(6):1558-63.
Svetlanov A, Puri N, Mena P, Koller A, Karzai AW. Francisella tularensis tmRNA system mutants are vulnerable to stress, avirulent in mice, and provide effective immune protection. Mol Microbiol. 2012;85(1):122-41.
Wu S: Characterization of tmRNA function and regulation in Pseudomonas aeruginosa. In: Suihan's dissertation-4 17. Alabama: Auburn University; 2013.
Jin Y, Watt RM, Danchin A, Huang JD. Small noncoding RNA GcvB is a novel regulator of acid resistance in Escherichia coli. BMC Genomics. 2009;10:165.
McArthur SD, Pulvermacher SC, Stauffer GV. The Yersinia pestis gcvB gene encodes two small regulatory RNA molecules. BMC Microbiol. 2006;6:52.
Baddal B, Muzzi A, Censini S, Calogero RA, Torricelli G, Guidotti S, et al. Dual RNA-seq of Nontypeable Haemophilus influenzae and Host Cell Transcriptomes Reveals Novel Insights into Host-Pathogen Cross Talk. mBio. 2015;6(6):e01765-15.
Papenfort K, Förstner KU, Cong JP, Sharma CM, Bassler BL. Differential RNA-seq of Vibrio cholerae identifies the VqmR small RNA as a regulator of biofilm formation. Proc Natl Acad Sci U S A. 2015;112(7):E766-75.
Vogel J. A rough guide to the non-coding RNA world of Salmonella. Mol Microbiol. 2009;71(1):1-11.
Chiang MK, Lu MC, Liu LC, Lin CT, Lai YC. Impact of Hfq on global gene expression and virulence in Klebsiella pneumoniae. PLoS One. 2011;6(7):e22248.
Gulliver EL, Wright A, Lucas DD, Mégroz M, Kleifeld O, Schittenhelm RB, et al. Determination of the small RNA GcvB regulon in the Gram-negative bacterial pathogen Pasteurella multocida and identification of the GcvB seed binding region. RNA. 2018;24(5):704-20.
Ju X, Fang X, Xiao Y, Li B, Shi R, Wei C, et al. Small RNA GcvB Regulates Oxidative Stress Response of Escherichia coli. Antioxidants (Basel). 2021;10(11):1774.
Jørgensen MG, Nielsen JS, Boysen A, Franch T, Møller-Jensen J, Valentin-Hansen P. Small regulatory RNAs control the multi-cellular adhesive lifestyle of Escherichia coli. Mol Microbiol. 2012;84(1):36-50.
Coornaert A, Chiaruttini C, Springer M, Guillier M. Post-transcriptional control of the Escherichia coli PhoQ-PhoP two-component system by multiple sRNAs involves a novel pairing region of GcvB. PLoS Genet. 2013;9(1):e1003156.
Pulvermacher SC, Stauffer LT, Stauffer GV. Role of the sRNA GcvB in regulation of cycA in Escherichia coli. Microbiology (Reading). 2009;155(Pt 1):106-14.
Sharma CM, Papenfort K, Pernitzsch SR, Mollenkopf HJ, Hinton JC, Vogel J. Pervasive post-transcriptional control of genes involved in amino acid metabolism by the Hfq-dependent GcvB small RNA. Mol Microbiol. 2011;81(5):1144-65.
Darwin AJ, Stewart V. Expression of the narX, narL, narP, and narQ genes of Escherichia coli K-12: regulation of the regulators. J Bacteriol. 1995;177(13):3865-9.
Noriega CE, Lin HY, Chen LL, Williams SB, Stewart V. Asymmetric cross-regulation between the nitrate-responsive NarX-NarL and NarQ-NarP two-component regulatory systems from Escherichia coli K-12. Molecular Microbiology. 2010;75(2):394-412.
Moreno-Gámez S, Sorg RA, Domenech A, Kjos M, Weissing FJ, van Doorn GS, et al. Quorum sensing integrates environmental cues, cell density and cell history to control bacterial competence. Nat Commun. 2017;8.
Inzana TJ, Corbeil LB. Development of a defined medium for Haemophilus somnus isolated from cattle. Am J Vet Res. 1987;48(3):366-9.
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory; 1989.
Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983;166(4):557-80.
Inzana TJ, Iritani B, Gogolewski RP, Kania SA, Corbeil LB. Purification and characterization of lipooligosaccharides from four strains of "Haemophilus somnus". Infect Immun. 1988;56:2830-7.
Gautheret D, Lambert A. Direct RNA motif definition and identification from multiple sequence alignments using secondary structure profiles. J Mol Biol. 2001;313(5):1003-11.

Table 1. Bacterial strains, plasmids, and oligonucleotides used in this study.

Strain or plasmid or oligonucleotide	Relevant characteristics	Reference or source
Strains
H. somni strain 2336	Pneumonia isolate	[5]
E. coli One Shot^TM Top 10	F- mcrA Δ( mrr-hsdRMS-mcrBC) Φ80lacZΔM15 Δ lacX74 recA1 araD139 Δ( araleu)7697 galU galK rpsL (StrR) endA1 nupG	Invitrogen, USA
E. coli One Shot™ BL21 Star™ (DE3)	F^-ompT hsdS_B (r_B^-, m_B^-) galdcmrne131 (DE3)	Invitrogen, USA
Plasmid
pET101/DTopo	ColE1/pMB1/pBR322/pUC ori; lacI; multicloning sites; His-tag (6x) V5 epitope tags; Ampicillin resistance	Invitrogen, USA
pUC19	pMB1 ori; 5’ terminal lacZ; P_lac; Ampicillin resistance	Invitrogen, USA
Oligonucleotides
Hfq_overex_F	CACCATGGCAAAA GGACAATCACT	This study
Hfq_overex_R	TTCAGTTTGATTTTCAGCTAATACTTCCG	This study
HS79_in vitro transcript_F	TAATACGACTCACTATAGGGGTGTATAATAGAAATCAAATAATC	This study
HS79_in vitro transcript_R	AAAAAATTTTTTTTGCGTGGATT	This study
HS97_in vitro transcript_F	TAATACGACTCACTATAGGGCGCTGGCAGGCTAATGAC	This study
HS97_in vitro transcript_R	GTCAAATAAAAAATAGGTCGTT	This study
HS79_Northern	GCTATAGGGCTTATCCGTTACAAGTG	This study
HS97_Northern	TATTAGTCATTAGCCTGCCAGCGTAC	This study
5’ RACE adapter	GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA	This study
5’ RACE outer primer	GCTGATGGCGATGAATGAACACTG	This study
5’ RACE inner primer	CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG	This study
HS79_RACE_gs outer primer	CCTGTCGGTAACTATCCCTAAGC	This study
HS79_RACE_gs inner primer	CCCAAGCTTTGGCTATAGGGCTTATCCGTTAC	This study
HS97_RACE_gs outer primer	CAATACTGCGGAAACGAGCTG	This study
HS97_RACE_gs inner primer	CCCAAGCTTCGACCTTCAATCCACCCAACTT	This study

Table 2. Histophilus somni strain 2336 sRNAs, their genome location, additional features, and comparative genomics.

ID	Start#	End#	Length (nt)	Promoter	Rho-independent terminator	Flanking gene (left)	Flanking gene (right)	Rfam annotation	Conservation across other genome*	Remarks
HS1	8109	8210	101	-	Y	HSM_0009	HSM_0010	-	C	Kumar R et al. 2012
HS2	12352	12414	63	Y	-	HSM_0015	HSM_0016	DND	DND	This work
HS3	16104	16190	87	Y	Y	HSM_0018	HSM_0019	-	B	Kumar R et al. 2012
HS4	30644	30884	240	Y	Y	HSM_0039	HSM_0040	-	B	Kumar R et al. 2012
HS5	44663	45024	362	Y	-	HSM_0051	HSM_0053	DND	DND	This work
HS6	59543	59723	181	Y	-	HSM_0065	HSM_0066	DND	DND	This work
HS7	66666	66766	101	Y	-	HSM_0068	HSM_0069	DND	DND	This work
HS8	88943	89453	511	Y	Y	HSM_0077	HSM_0079	DND	DND	This work
HS9	91939	92065	127	Y	Y	HSM_0081	HSM_0082	-	C	Kumar et al., 2012
HS10	94247	94306	60	Y	-	HSM_0083	HSM_0084	DND	DND	This work
HS11	113922	114103	182	Y	Y	HSM_0102	HSM_0103	-	C	Kumar et al., 2012
HS12	183080	183180	101	Y	-	HSM_0171	HSM_0172	-	B	Kumar R et al. 2012
HS13	197510	197896	387	Y	Y	HSM_0186	HSM_0186	-	B	Kumar R et al. 2012
HS14	229488	229780	293	Y	-	HSM_0213	HSM_0214	-	C	Kumar R et al. 2012
HS15	258962	259117	156	Y	Y	HSM_0244	HSM_0245	-	A	Kumar R et al. 2012
HS16	260385	260624	240	Y	Y	HSM_0245	HSM_0246	-	A	Kumar R et al. 2012
HS17	261006	261095	90	Y	-	HSM_0245	HSM_0246	DND	DND	This work
HS18	261354	261531	178	Y	Y	HSM_0246	HSM_0247	-	A	Kumar R et al. 2012
HS19	261807	262158	352	Y	Y	HSM_0246	HSM_0247	-	A	Kumar et al., 2012
HS20	263989	264069	81	Y	-	HSM_0250	HSM_0251	DND	DND	This work
HS21	274202	274429	228	Y	-	HSM_0261	HSM_0262	DND	DND	This work
HS22	279541	279732	192	Y	-	HSM_0266	HSM_0267	-	B	Kumar et al., 2012
HS23	306543	306993	451	Y	-	HSM_0284	HSM_0285	tmrna	D	Kumar R et al. 2012
HS24	307115	307234	120	Y	-	HSM_0284	HSM_0285	DND	DND	This work
HS25	311883	311965	83	Y	Y	HSM_0287	HSM_0288	DND	DND	This work
HS26	318134	318443	310	Y	Y	HSM_0292	HSM_0293	-	D	Kumar et al., 2012
HS27	325426	325495	70	Y	-	HSM_0302	HSM_0303	DND	DND	This work
HS28	328923	328991	69	Y	-	HSM_0305	HSM_0013	DND	DND	This work
HS29	360310	360403	94	Y	-	HSM_0336	HSM_0337	DND	DND	This work
HS30	368822	369085	264	Y	Y	HSM_0336	HSM_0337	DND	DND	This work
HS31	382931	383420	490	Y	-	HSM_0346	HSM_0347	-	A	Kumar et al., 2012
HS32	385627	385785	159	Y	Y	HSM_0348	HSM_0349	-	B	Kumar et al., 2012
HS33	479539	479630	92	Y	-	HSM_0413	HSM_0414	DND	DND	This work
HS34	481596	481692	97	-	Y	HSM_0415	HSM_0416	DND	DND	This work
HS35	509847	510012	166	-	-	HSM_0439	HSM_0440	DND	DND	This work
HS36	513150	513269	120	Y	-	HSM_0443	HSM_0014	DND	DND	This work
HS37	515196	315366	171	Y	-	HSM_0016	HSM_0017	DND	DND	This work
HS38	518616	519042	427	-	Y	HSM_0018	HSM_0445	DND	DND	This work
HS39	524433	524805	373	Y	-	HSM_0448	HSM_0450	-	A	Kumar et al., 2012
HS40	538565	538669	105	-	Y	HSM_0462	HSM_0463	DND	DND	This work
HS41	555076	555135	60	Y	Y	HSM_0479	HSM_0480	DND	DND	This work
HS42	555979	556100	122	Y	-	HSM_0480	HSM_0481	DND	DND	This work
HS43	598133	598401	269	-	Y	HSM_0520	HSM_0521	DND	DND	This work
HS44	599224	599432	209	Y	Y	HSM_0521	HSM_0522	-	B	Kumar et al., 2012
HS45	608001	608193	193	Y	Y	HSM_0533	HSM_0534	DND	DND	This work
HS46	616791	617166	376	Y	-	HSM_0539	HSM_0540	-	A	Kumar et al., 2012
HS47	617726	618078	352	Y	-	HSM_0539	HSM_0540	-	A	Kumar et al., 2012
HS48	618122	618334	213	Y	Y	HSM_0539	HSM_0540	-	A	Kumar et al., 2012
HS49	619340	619614	275	Y	-	HSM_0540	HSM_0541	DND	DND	This work
HS50	629462	629599	138	Y	-	HSM_0550	HSM_0019	DND	DND	This work
HS51	631525	631711	187	Y	-	HSM_0021	HSM_0022	DND	DND	This work
HS52	634705	634828	124	-	-	HSM_0022	HSM_0023	DND	DND	This work
HS53	658121	658225	105	Y	-	HSM_0565	HSM_0566	DND	DND	This work
HS54	672117	672270	154	Y	Y	HSM_0578	HSM_0027	DND	DND	This work
HS55	674011	674147	137	Y	-	HSM_0028	HSM_0029	DND	DND	This work
HS56	677141	677264	124	Y	-	HSM_0029	HSM_0030	DND	DND	This work
HS57	677381	677603	223	Y	Y	HSM_0030	HSM_0579	DND	DND	This work
HS58	680657	680737	81	Y	Y	HSM_0582	HSM_0590	DND	DND	This work
HS59	694254	694751	498	Y	-	HSM_0594	HSM_0595	DND	DND	This work
HS60	704946	705009	64	Y	Y	HSM_0608	HSM_0609	DND	DND	This work
HS61	756806	756890	85	Y	Y	HSM_0658	HSM_0659	DND	DND	This work
HS62	764367	764500	134	Y	-	HSM_0668	HSM_0669	DND	DND	This work
HS63	782580	782672	93	-	-	HSM_0688	HSM_0689	DND	DND	This work
HS64	815707	815993	287	Y	Y	HSM_0708	HSM_0709	DND	DND	This work
HS65	821014	821099	86	Y	-	HSM_0711	HSM_0712	DND	DND	This work
HS66	827720	828315	596	Y	Y	HSM_0717	HSM_0718	DND	DND	This work
HS67	851529	851687	158	Y	Y	HSM_0740	HSM_0741	-	B	Kumar et al., 2012
HS68	860901	861198	298	Y	-	HSM_0747	HSM_0748	DND	DND	This work
HS69	868282	867910	309	Y	-	HSM_0750	HSM_0751	DND	DND	This work
HS70	869792	869984	193	Y	Y	HSM_0751	HSM_0752	DND	DND	This work
HS71	871001	871177	176	Y	-	HSM_0753	HSM_0031	DND	DND	This work
HS72	876309	876450	142	Y	Y	HSM_0658	HSM_0659	Glycine	C	Kumar et al., 2012
HS73	893534	893598	65	Y	Y	HSM_0775	HSM_0776	DND	DND	This work
HS74	894124	894221	98	Y	-	HSM_0776	HSM_0777	DND	DND	This work
HS75	913875	914133	259	Y	Y	HSM_0793	HSM_0794	DND	DND	This work
HS76	914805	914973	169	Y	-	HSM_0794	HSM_0796	DND	DND	This work
HS77	956123	956231	109	Y	-	HSM_0830	HSM_0832	DND	DND	This work
HS78	969506	969784	279	Y	Y	HSM_0843	HSM_0844	DND	DND	This work
HS79	981948	982242	295	Y	Y	HSM_0847	HSM_0848	-	C	Kumar et al., 2012
HS80	983363	983525	163	Y	-	HSM_0849	HSM_0850	DND	DND	This work
HS81	984864	984928	65	Y	-	HSM_0850	HSM_0035	DND	DND	This work
HS82	985484	985636	153	Y	-	HSM_0037	HSM_0038	DND	DND	This work
HS83	987368	987513	146	Y	-	HSM_0039	HSM_0040	DND	DND	This work
HS84	990507	990586	80	Y	-	HSM_0040	HSM_0041	DND	DND	This work
HS85	993119	993253	135	Y	-	HSM_0852	HSM_0853	DND	DND	This work
HS86	1007800	1008014	215	Y	Y	HSM_0868	HSM_0869	-	C	Kumar et al., 2012
HS87	1008113	1008332	224	Y	Y	HSM_0868	HSM_0869	-	A	Kumar et al., 2012
HS88	1009543	1009788	246	Y	Y	HSM_0869	HSM_0870	DND	DND	This work
HS89	1012617	1012863	206	Y	Y	HSM_0874	HSM_0875	-	B	Kumar et al., 2012
HS90	1013851	1014063	213	Y	-	HSM_0875	HSM_0876	DND	DND	This work
HS91	1014280	1014767	163	Y	Y	HSM_0875	HSM_0876	-	A	Kumar et al., 2012
HS92	1021920	1022358	442	Y	-	HSM_0888	HSM_0889	-	A	Kumar et al., 2012
HS93	1022359	1022473	115	Y	Y	HSM_0888	HSM_0889	-	A	Kumar et al., 2012
HS94	1024358	1025423	134	-	Y	HSM_0891	HSM_0892	DND	DND	This work
HS95	1030864	1031208	345	Y	Y	HSM_0898	HSM_0898	DND	DND	This work
HS96	1031383	1031557	175	Y	-	HSM_0899	HSM_0900	DND	DND	This work
HS97	1032012	1032164	153	Y	Y	HSM_0900	HSM_0901	-	C	Kumar et al., 2012
HS98	1032206	1032457	252	Y	Y	HSM_0900	HSM_0901	-	D	Kumar et al., 2012
HS99	1079687	1079792	106	Y	-	HSM_0945	HSM_0946	DND	DND	This work
HS100	1101608	1101842	235	Y	-	HSM_0964	HSM_0965	DND	DND	This work
HS101	1111354	1111410	57	-	Y	HSM_0970	HSM_0971	DND	DND	This work
HS102	1112842	1112994	153	Y	-	HSM_0972	HSM_0973	DND	DND	This work
HS103	1149364	1149487	124	Y	-	HSM_1006	HSM_0047	DND	DND	This work
HS104	1161353	1161420	68	Y	-	HSM_1015	HSM_1016	DND	DND	This work
HS105	1163348	1163469	122	Y	Y	HSM_1017	HSM_1018	DND	DND	This work
HS106	1180654	1181062	409	Y	Y	HSM_1022	HSM_1023	DND	DND	This work
HS107	1181630	1181719	90	Y	-	HSM_1023	HSM_1024	DND	DND	This work
HS108	1204957	1205023	67	Y	Y	HSM_1047	HSM_1048	DND	DND	This work
HS109	1227189	1227300	112	Y	Y	HSM_1066	HSM_1067	DND	DND	This work
HS110	1240897	1241177	281	Y	-	HSM_1079	HSM_1080	DND	DND	This work
HS100	1101608	1101842	235	Y	-	HSM_0964	HSM_0965	DND	DND	This work
HS101	1111354	1111410	57	-	Y	HSM_0970	HSM_0971	DND	DND	This work
HS111	1243001	1243210	210	Y	Y	HSM_1081	HSM_1082	DND	DND	This work
HS112	1265528	1265731	204	Y	-	HSM_1102	HSM_1103	DND	DND	This work
HS113	1276545	1276910	366	Y	Y	HSM_1113	HSM_1114	DND	DND	This work
HS114	1312678	1312854	177	Y	Y	HSM_1143	HSM_1144	-	A	Kumar et al., 2012
HS115	1319443	1319574	132	Y	Y	HSM_1153	HSM_1154	DND	DND	This work
HS116	1323359	1323518	160	Y	Y	HSM_1156	HSM_1157	DND	DND	This work
HS117	1337413	1337658	246	Y	Y	HSM_1072	HSM_1173	-	B	Kumar et al., 2012
HS118	1368913	1369114	202	Y	Y	HSM_ 1211	HSM_1212	DND	DND	This work
HS119	1413711	1413974	264	Y	-	HSM_1254	HSM_1255	lysine	B	Kumar et al., 2012
HS120	1416712	1417102	392	Y	Y	HSM_1256	HSM_1257	DND	DND	This work
HS121	1452902	1452109	183	Y	-	HSM_1272	HSM_1273	DND	DND	This work
HS122	1464716	1464864	149	Y	Y	HSM_1284	HSM_1285	DND	DND	This work
HS123	1466794	1466925	132	-	-	HSM_1286	HSM_1287	DND	DND	This work
HS124	1467920	1468011	90	Y	Y	HSM_0053	HSM_1288	DND	DND	This work
HS125	1530875	1530965	91	Y	-	HSM_1345	HSM_1346	DND	DND	This work
HS126	1536500	1536585	86	Y	Y	HSM_1353	HSM_1354	DND	DND	This work
HS127	1580074	1580172	99	Y	Y	HSM_1383	HSM_1384	DND	DND	This work
HS128	1597315	1597535	221	Y	-	HSM_1399	HSM_1400	DND	DND	This work
HS129	1634642	1631725	84	-	-	HSM_1426	HSM_1427	DND	DND	This work
HS130	1653708	1653761	54	-	Y	HSM_1448	HSM_1449	DND	DND	This work
HS131	1659113	1659217	105	Y	Y	HSM_1455	HSM_1456	DND	DND	This work
HS132	1678216	1678326	111	Y	-	HSM_1471	HSM_1472	DND	DND	This work
HS133	1684791	1684900	110	Y	-	HSM_1477	HSM_1478	DND	DND	This work
HS134	1688991	1689061	71	-	Y	HSM_1483	HSM_1484	DND	DND	This work
HS135	1741229	1741292	64	-	-	HSM_1514	HSM_1515	DND	DND	This work
HS136	1748564	1748835	272	Y	Y	HSM_1521	HSM_1522	DND	DND	This work
HS137	1776051	1776199	149	Y	-	HSM_1542	HSM_1543	DND	DND	This work
HS138	1791994	1792043	50	-	Y	HSM_1556	HSM_1557	DND	DND	This work
HS139	1796225	1796280	56	-	Y	HSM_1560	HSM_1561	DND	DND	This work
HS140	1798765	1798889	125	-	Y	HSM_0058	HSM_1563	DND	DND	This work
HS141	1806298	1806841	547	Y	Y	HSM_1569	HSM_1571	DND	DND	This work
HS142	1839525	1839645	121	Y	Y	HSM_1590	HSM_1591	-	B	Kumar et al., 2012
HS143	1865693	1865748	58	Y	-	HSM_1616	HSM_1617	DND	DND	This work
HS144	1874327	1874482	156	Y	Y	HSM_1626	HSM_1627	isrK	B	Kumar et al., 2012
HS145	1875319	1875422	104	Y	Y	HSM_1628	HSM_1629	DND	DND	This work
HS146	1876066	1876214	149	-	-	HSM_ 1630	HSM_1631	DND	DND	This work
HS147	1921157	1921223	67	-	Y	HSM_1668	HSM_1669	DND	DND	This work
HS148	1922040	1922215	176	-	-	HSM_1669	HSM_1670	DND	DND	This work
HS149	1923821	1923892	72	Y	-	HSM_1671	HSM_1672	DND	DND	This work
HS150	1925814	1925932	118	-	-	HSM_1675	HSM_1676	-	B	Kumar et al., 2012
HS151	1927618	1928029	412	Y	-	HSM_1676	HSM_1677	-	D	Kumar et al., 2012
HS152	1928147	1928340	194	Y	Y	HSM_1676	HSM_1677	-	A	Kumar et al., 2012
HS153	1929376	1929458	83	-	-	HSM_1677	HSM_1678	DND	DND	This work
HS154	1931140	1931219	80	Y	Y	HSM_1679	HSM_1680	DND	DND	This work
HS155	1931457	1931553	97	-	-	HSM_1679	HSM_1680	DND	DND	This work
HS156	1938168	1938400	233	Y	-	HSM_1688	HSM_1689	DND	DND	This work
HS157	1942495	1942610	116	Y	Y	HSM_1692	HSM_1693	-	A	Kumar et al., 2012
HS158	1943443	1943494	52	-	Y	HSM_1694	HSM_1695	DND	DND	This work
HS159	1962921	1963057	137	Y	-	HSM_1719	HSM_1720	DND	DND	This work
HS160	1965414	1965466	53	-	Y	HSM_1720	HSM_1721	DND	DND	This work
HS161	1967173	1967232	60	-	-	HSM_1722	HSM_1723	DND	DND	This work
HS162	1971022	1971098	77	-	-	HSM_1726	HSM_1727	DND	DND	This work
HS163	1971510	1971638	129	-	Y	HSM_1727	HSM_1728	DND	DND	This work
HS164	1982114	1982330	217	-	Y	HSM_1738	HSM_1739	DND	DND	This work
HS165	1994468	1994545	78	-	-	HSM_0059	HSM_1753	DND	DND	This work
HS166	2020540	2020731	192	Y	Y	HSM_1776	HSM_1777	gcvB	D	Kumar et al., 2012
HS167	2025431	2025500	70	Y	-	HSM_1782	HSM_1783	DND	DND	This work
HS168	2037940	2038042	103	Y	-	HSM_1792	HSM_1793	DND	DND	This work
HS169	2071563	2071686	124	-	-	HSM_1821	HSM_1822	DND	DND	This work
HS170	2108023	2108090	68	-	Y	HSM_1859	HSM_1860	DND	DND	This work
HS171	2118034	2118391	358	Y	Y	HSM_1867	HSM_0060	DND	DND	This work
HS172	2118413	2118518	106	-	-	HSM_1867	HSM_0060	DND	DND	This work
HS173	2123413	2123485	73	Y	-	HSM_0061	HSM_0062	DND	DND	This work
HS174	1971510	1971638	129	-	Y	HSM_0062	HSM_0063	DND	DND	This work
HS175	2123773	2123839	67	-	-	HSM_0063	HSM_1868	DND	DND	This work
HS176	2124729	2124829	102	Y	Y	HSM_1868	HSM_1869	-	A	Kumar et al., 2012
HS177	2146424	2146602	179	Y	-	HSM_0065	HSM_1893	-	B	Kumar et al., 2012
HS178	2150203	2150273	71	Y	Y	HSM_1895	HSM_1896	DND	DND	This work
HS179	2210181	2210317	137	Y	Y	HSM_1950	HSM_1951	-	B	Kumar et al., 2012
HS180	2223843	2223945	103	Y	-	HSM_1974	HSM_1975	alpha_RBS	D	Kumar et al., 2012

^{*sRNA sequences conserved in; A - Unique to H. somni 2336. B - H. somni strain 129PT only. C – Phylogenetically closer bacterial genomes specially members of Pasteurellaceae family (M. haemolytica, P. multocida. H. influenza etc). D - across distant bacterial species.}

^{The start# and end# represents the boundaries of identified transcriptionally active region (TAR) which is a potential sRNA region.}

^{Any cell with no predicted result is marked with ‘-’.}

^{‘DND’ – Did not determined}

Table 3. sRNAs that can interact with sigma 54.

ID	Sigma 54 binding motif*
HS9	TGCCACAAGTGCTACT
HS11	TACCAGCTCCCATTGCA
HS14	TAGCCCATTGCTTGCA
HS26	TAGCACTTGCCGATTGCC
HS72	TGGCGAGGACTGTTACT
HS86	AGCCACTTTCGACAGTGGCG
HS97	TCCCCCTCTCGTTGAA
HS98	CGGCACCCTATTGAA

*Conserved sequences matching with the already reported sigma 54 binding motifs are underlined.

No competing interests reported.

Identification and initial characterization of Hfq-associated sRNAs in Histophilus somni strain 2336

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Background

Results

Discussion

Conclusion

Methods

Declarations

References

Tables

Strain or plasmid or oligonucleotide

ID

Additional Declarations

Status:

Version 1