Capsaicin ameliorates fatty accumulation both in mouse liver and in human hepatocytes

doi:10.21203/rs.3.rs-2069413/v1

Download PDF

Research Article

Capsaicin ameliorates fatty accumulation both in mouse liver and in human hepatocytes

https://doi.org/10.21203/rs.3.rs-2069413/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background:Nonalcoholic fatty liver disease (NAFLD) is a continuous spectrum of the disease recognized as excessive fatty accumulation in the liver, and no effective drugs are approved by FDA. Present study aimed to investigate whether capsaicin, the major ingredients of pepper, can ameliorate the progression of NAFLD. The underlying mechanism was also explored.

Methods:The function of capsaicin on lipid accumulation was assessed both in high-fat high-sugar diet (HFHSD) induced mice and in human hepatocytes. In animal experiments, mice were divided into three groups: normal diet (ND), HFHSD, and HFHSD subjected to capsaicin cream. The body weight, liver weight, lipid droplets, triglyceride (TG), and total cholesterol (TC) of each group were compared. In cell experiments, WRL68 cells were cultured with the palmitic and oleic acid (PAOA) mixture. The lipid accumulation was detected using fluorescence microscopy and flow cytometer. RT-qPCRwas performed to explore the potential mechanism of capsaicin.

Results: Topical application of capsaicin significantly decreased liver index (HFHSD vs HFHSD + Cap, 6.92 ± 1.47 vs 6.16 ± 1.13, mean ± SEM, n = 8) and ameliorated hepatic fatty accumulation (HFHSD vs HFHSD + Cap, 22.54 ± 4.53 vs 9.92 ± 4.42, mean ± SEM, n = 8) in HFHSD-fed mice. Capsaicin treatment decreased intracellular lipid accumulation in human hepatocytes. RT-qPCR showed that HFHSD feeding or PAOA exposure could significantly up-regulate the levels of SREBP-1c, ACC1, and CYP2E1, while capsaicin application reversed their expression.

Conclusion: Topical application of capsaicin ameliorates fatty accumulation both in mice and human hepatocytes, which may be related to de novo lipogenesis inhibition and ω-oxidation regulation.

fatty accumulation

topical application

capsaicin

mouse model

human hepatocytes

Non-alcoholic fatty liver disease (NAFLD) represents the most frequent chronic liver disease with a global prevalence of 25% [1], which is marked by fatty accumulation in the liver without the experience of alcoholic abuse. NAFLD progresses from simple fatty liver disease to nonalcoholic steatohepatitis (NASH) or even cirrhosis, which is closely related to type 2 diabetes mellitus and obesity [2]. Although several compounds are currently under development, there are no approved drugs for NAFLD treatment [3].With the increasing knowledge of metabolism and associated pathologies, NAFLD is recently considered to be a multi-factorial systemic disease [4]. A new term, metabolic dysfunction associated fatty liver disease (MAFLD), is proposed to replace NAFLD [5]. Since no approved pharmacological therapies are currently available, it is essential to extensively explore the intervention strategies for treatment or prevention of NAFLD.

The pathogenesis of NAFLD is very complicated, the “two hits” theory is widely accepted at present [6]. Firstly, Insulin resistance stimulates the transcription of sterol regulatory element-binding protein-1c (SREBP-1c) [7, 8]. Then, SREBP-1c positively regulates the activity of acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FAS). ACC converts acetyl-CoA, an essential substrate of fatty acids, into malonyl-CoA, while FAS utilizes acetyl-CoA and malonyl-CoA to form palmitic acid. Secondly, the liver is damaged by oxidative stress, which is caused by excessive reactive oxygen species (ROS). ROS are generally produced by Cytochrome P450 2E1 (CYP2E1) in mitochondria and microcosms.

Capsaicin is the major pungent ingredient of peppers, which has been identified for numerous beneficial roles in health, including rheumatoid arthritis [9], pain inflammation, and vasomotor rhinitis [10]. Recently, a capsaicin-rich diet represents a valuable intervention for populations with obesity [11, 12]. When 0.014% capsaicin was orally administrated to animals, their visceral fat weight of rodent significantly reduced without any obvious effect on total caloric intake [13] [14]. Kang demonstrated that the application of capsaicin in obese mice reduced triglyceride levels and fasting glucose, accompanied by decreased concentrations of insulin and leptin [15]. Capsaicin is a highly selective agonist for the transient receptor potential vanilloid 1 (TRPV1). It is well accepted that most effects of capsaicin are caused by stimulating TRPV1 receptor [16]. However, Nikami’s study [17] indicated that capsaicin pretreatment reduces the hypothermia caused by lipopolysaccharide in chickens, although TRPV1 of chicken is insensitive to capsaicin. This suggests that the role of capsaicin in this study may be TRPV1-independent.

In this study, we investigated the effects of capsaicin on lipid accumulation in mouse liver and human hepatocytes, and further analyzed its potential mechanism.

Animal models and treatment regimens

Male C57BL/6 mice weighing 14-18 g were purchased from Shanghai SLAC Laboratory animal Co. LTD (Shanghai, China) and raised under pathogen-free conditions. After one week of adaption, the mice were randomly divided into two groups. One group was fed with standard diet (normal diet, ND) (n = 9), and the other group was provided with a high-fat high-sugar diet (HFHSD) (n = 16). All mice were housed in cages (4-5 mice/cage) at 18-23˚C and ~50% humidity in 12 h light-dark cycle. The ND mice were fed with normal diet (composed of 10% fat, 20% protein, and 70% carbohydrate based on caloric content) and purified drinking water. The HFHSD mice were fed with high-fat diet (composed of 60% fat, 20% protein, and 20% carbohydrate) and high-sugar drinking water (55% glucose and 45% fructose). The feed was purchased from Double Lion Experimental Animal Feed Technology Co., Ltd. At week 9, half of the HFHSD mice (n = 8) were scraped capsaicin cream containing 2.5 μM capsaicin, 10% soluble starch, and 70% glycerol (v/v) onto shaved abdominal skin twice daily (HFHSD + Cap). All mice were weighed weekly. At week 17, mice were sacrificed under deep anesthesia by isoflurane, blood samples were collected, and the livers were isolated and weighed immediately. One portion of the liver was fixed with 4% paraformaldehyde, and the remaining was snap-frozen with liquid nitrogen. Mice received humane care throughout the experiment in accordance with the “Guide for the Care and Use of Laboratory Animals”. The experiment complied with the Laboratory Animal Ethics Committee of Zhejiang Sci-Tech University.

Histological examination of mouse liver

The livers were processed in stages, including alcohol dehydration, xylene transparent, soaking in organic solution, and bedding in paraffin. Deparaffinized liver sections (4 μM thick) were rehydrated and stained with hematoxylin and eosin (H&E) according to the standard procedures. The lipid droplets of livers were visualized by Oil Red O staining. The fresh livers were snap-frozen with OCT TissueTek and cut into 6-8 μM sections. Subsequently, a series of processes were followed, including washing, staining, differentiation, and sealing. The average optical density of Oil Red O staining was analyzed by Image-Plus software 2.0.

Biochemistry examination

Peripheral blood was collected from the orbital vein of mouse, and the serum was harvested by centrifugation (3000 rpm for 10 min) and stored at -20℃ until analysis. The levels of serum triglyceride (TG) and total cholesterol (TC) were measured with an automatic biochemical analyzer (Beckman LX-20, Palo Alto, CA). To measure TG and TC contents in mouse liver, about 100mg of liver was extracted from mouse according to the ratio of 1:9 (w/v) (liver weight: ethanol). Subsequently, the supernatant was measured by TG/TC assay kit following the manufacturer’s instructions.

ELISA assay

The serum cytokines, including IL-6, IL-8, and TNF-α, were determined by ELISA assay according to the manufacturer’s instructions (Zcibio Technology Co. Ltd). Finally, the reaction was terminated by adding a 50 uL stop solution. The concentrations of samples were calculated with a microplate reader (Spectra MAX Plus384, Molecular Devices) at the absorbance of 450 nm.

Cell culture and cell viability assessment

WRL68 cells were cultured in Minimum Essential Medium (MEM) (Hyclone Technologies), supplemented with 10% (v/v) fetal bovine serum (FBS) (Hyclone Technologies) and 1% (v/v) Penicillin-Streptomycin. The cells grew at 37°C in a humidified atmosphere containing 5% CO₂. Cell viability was measured by using Cell Counting Kit-8 assay kit according to the instructions. The cell viability was estimated by measuring the absorbance of 450 nm.

Induction of human hepatic lipid accumulation

To establish the cell model of lipid accumulation, palmitic acid and oleic acid (PAOA, Sigma-Aldrich) with a molar ratio of 1:2 was prepared, and supplemented with 0.5% (w/v) fatty acid-free bovine serum albumin (BSA). WRL68 cells were exposed to the medium containing 400 μM PAOA mixture for 24 h. Subsequently, the medium containing PAOA was removed, and the cells were routinely cultured for 24h in the presence or absence of capsaicin at the concentration of 250 μM. An equal volume of PBS buffer was used as control. To detect hepatic lipid droplets, the cells were washed with PBS buffer and then fixed with 4% paraformaldehyde. Intracellular lipids were stained with 3.3 μg/mL Nile red for 15 min at room temperature. Cell nuclei were stained by Hoechst 33358 for 5 min. Images were acquired with fluorescence microscopy (Olympus). For fluorometric measurement, cells were harvested with trypsin. The pellets were incubated with MEM medium containing 0.75 μg/mL Nile red. The fluorescence was determined by flow cytometer (BD Accuri C6) with the excitation/emission wavelength of 525/585 nm.

RNA isolation and RT-qPCR analysis

Total RNA was extracted from WRL68 cells or liver of mouse with RNA isolation kit according to the instructions (Sigma-Aldrich). The first-strand cDNA was synthesized from 1 µg total RNA by using Ready-to-go first-strand beads. RT-qPCR was performed by using the Real-Time qPCR mixture (Promega). GAPDH was used as an internal reference gene to normalize the expression of target genes. Fold changes were determined by using 2^ΔΔCT, and the final value was acquired by converting logarithmic scale to exponential scale (2^-ΔΔCT). The primers used in this experiment are presented in table 1.

Table 1

Primes for RT-qPCR assay

Gene

Forward primer

Reverse primer

FAS

Human

Mouse

GGACCCAGAATACCAAGTGCAG

CTGCGATTCTCCTGGCTGTGAA

GTTGCTGGTGAGTGTGCATTCC

CAACAACCATAGGCGATTTCTGG

SREBP-1C

Human

Mouse

GCGCCTTGACAGGTGAAGTC

CGACTACATCCGCTTCTTGCAG

GCCAGGGAAGTCACTGTCTTG

CCTCCATAGACACATCTGTGCC

ACC1

Human

Mouse

TTCACTCCACCTTGTCAGCGGA

GTTCTGTTGGACAACGCCTTCAC

GTCAGAGAAGCAGCCCATCACT

GGAGTCACAGAAGCAGCCCATT

ACC2

Human

Mouse

GACGAGCTGATCTCCATCCTCA

AGAAGCGAGCACTGCAAGGTTG

ATGGACTCCACCTGGTTATGCC

GGAAGATGGACTCCACCTGGTT

TRPV1

Human

Mouse

GTGGACAGCTACAGTGAGATGC

CATCTTCACCACGGCTGCTTAC

GGAAGCCACATACTCCTTGAGG

CAGACAGGATCTCTCCAGTGAC

PPARα

Human

Mouse

TCGGCGAGGATAGTTCTGGAAG

ACCACTACGGAGTTCACGCATG

GACCACAGGATAAGTCACCGAG

GAATCTTGCAGCTCCGATCACAC

CYP2E1

Human

Mouse

GAGCACCATCAATCTCTGGACC

AGGCTGTCAAGGAGGTGCTACT

CACGGTGATACCGTCCATTGTG

AAAACCTCCGCACGTCCTTCCA

Cyp4a11

CATGGCAGACTCTGTACGAGTG

CTGATGGCTGAAGGCACACTTC

Cyp4a10

GCTACTCAAGGCTTTCCAGCAG

CCAGAACCATCTAGGAAAGGCAC

GADPH

Human

Mouse

GTCTCCTCTGACTTCAACAGCG

CATCACTGCCACCCAGAAGACTG

ACCACCCTGTTGCTGTAGCCAA

ATGCCAGTGAGCTTCCCGTTCAG

Statistical analysis

Comparisons between two groups were performed with Mann-Whitney test. For the comparison among three groups, one-way ANOVA followed by Tukey's multiple comparisons test was used. Differences were considered statistically significant at the p-value < 0.05. Data were shown as mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001. Statistical analyses were performed with GraphPad Prism software 9.0.0.

The topical application of capsaicin decreases the body weight gain and liver weight in mice

To investigate the effects of capsaicin on fatty liver, mouse model induced by HFHSD was established. Mice were divided into ND, HFHSD, and HFHSD + Cap groups. The bodyweight of mouse was compared among the groups. We found that the high-fat high-sugar diet significantly increased the body weight of mouse (Fig.1A), while topical application of capsaicin inhibited the weight gain in HFHSD mouse (Fig.1B). In addition, the liver index was prevented by capsaicin treatment in HFHSD feeding mice (HFHSD vs HFHSD + Cap, 6.92 ± 1.47 vs 6.16 ± 1.13, mean ± SEM, n = 8) (Fig.1C, Fig.1D, Fig.1E). However, no apparent difference in food intake was found between HFHSD mouse and HFHSD + Cap mouse (Additional file 1). These identify that the topical application of capsaicin prevented the increase of livers in HFHSD feeding mouse.

Capsaicin ameliorates hepatic fatty accumulation in high-fat high-sugar diet fed mice reduces lipid accumulation in human hepatocytes

To assess the role of capsaicin in hepatic fatty accumulation, we analyzed the lipid droplets in mouse liver by histological characterization and oil-red O staining (Fig.2A and Fig.2B). The results showed that capsaicin treatment significantly ameliorates fatty accumulation in mouse liver (Fig.2C) (HFHSD vs HFHSD + Cap, 22.54 ± 4.53 vs 9.92 ± 4.42, mean ± SEM, n = 8). The concentrations of triglyceride (TG) and total cholesterol (TC) both in serum and in mouse liver were detected (Fig.3A, Fig.3B, Fig.3C, Fig.3D). Surprisingly, we found that capsaicin treatment did not significantly reduce the contents of TG and TC either in serum or in liver. The level of serum TG was even increased by capsaicin. In addition, biochemistry determination of high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) (Fig.3E and Fig.3F) showed that capsaicin treatment increased HDL-C levels, but reduced LDL-C levels. These indicate that capsaicin cannot improve hyperlipidemia induced by high-fat high-sugar feeding.

Furthermore, the cytokines, including IL6, IL8, and TNF-alpha, were also measured. The results showed that the production of IL-6 and IL-8 was apparently increased in HFHSD mice, while slightly decreased in HFHSD + Cap mice. However, no significant changes of TNF-alpha were observed among the groups (Fig.3G, Fig.3H, Fig.3I). These suggest that the application of capsaicin cannot distinctly prevent the release of inflammatory cytokines.

To model human hepatic steatosis, WRL68 cells were exposed to PAOA mixture to induce lipid accumulation. Firstly, the cytotoxicity of capsaicin and PAOA mixture was measured with CCK8 assay, indicating that either 400 μM PAOA or 250 μM capsaicin does not induce apparent cytotoxicity in WRL68 cells (Fig.4A and Fig.4B). Nile red staining showed that PAOA induction at the concentration of 400 μM effectively promoted fatty accumulation in WRL68 cells, which could be inhibited by capsaicin at the concentration of 250 μM (Fig.4C, Fig.4D, Fig.4E), suggesting that capsaicin can significantly inhibit fatty accumulation.

The function of capsaicin may depend on the regulation of de novo lipogenesis and CYP2E1 participation

It was previously demonstrated that capsaicin triggers TRPV1 mediated calcium influx, thereby accelerating lipolysis and visceral remodeling [18]. However, our results showed that there was no obvious difference in the expression of TRPV1 among ND, HFHSD, and HFHSD + Cap mice. A similar result was observed in the cell experiment (Fig.5A and Fig.6A). This suggests that the effect of capsaicin on fatty accumulation may be related to mechanism independent on TRPV1 activation.

The imbalance of triglyceride synthesis and utilization is the main reason for fatty accumulation. In fatty acid synthesis, Acetyl-CoA carboxylase (ACC) converts acetyl-CoA to malonyl-CoA. Fatty acid synthase (FAS) then uses acetyl-CoA and malonyl-CoA to form palmitic acid. Both ACC and FAS are positively regulated by SREBP-1c. To explore the underlying mechanism of capsaicin inhibiting fatty accumulation, we detected the expression of genes related to de novo lipogenesis (DNL) at the mRNA level in mouse liver and human hepatocytes. The results exhibited that the expression of SREBP-1c and ACC1 was enhanced by HFHSD feeding or PAOA exposure, while it was decreased by capsaicin treatment. Meanwhile, FAS and ACC2 was not apparently affected by capsaicin (Fig.5B, Fig.5C, Fig.5D, Fig.5E, Fig.6B, Fig.6C, Fig.6D, Fig.6E). Our experiment suggests that the function of capsaicin mainly depends on SREBP-1c / ACC regulation.

Excessive accumulation of free fatty acids (FFAs) in hepatocytes can activate alternative pathways of fatty acids oxidation, such as β-oxidation and ω-oxidation. Peroxisome proliferator-activated receptor (PPAR-α) plays a vital role in the up-regulation of a series of genes, including mitochondrial β-oxidation related enzymes, such as Cytochrome P450 4A (CYP4A) [19]. Surprisingly, our results showed that HFHSD feeding or PAOA exposure failed to significantly regulate the expression of PPAR-α and CYP4A10 (mouse) / CYP4A11 (human) (Fig.5F, Fig.5G, Fig.6F, Fig.6G), though capsaicin application significantly increased their expression. As an inducible hepatic microsomal cytochrome, Cytochrome P450 2E1 (CYP2E1) initiates the auto-propagative process of lipid oxidation in the process of ω-oxidation. Our results identified that CYP2E1 was up-regulated by HFHDS induction or PAOA exposure, while capsaicin reversed the enhancement (Fig.5H and Fig.6H). These suggest that capsaicin promoting NAFLD might be involved in CYP2E1 participation.

NAFLD is a global disease with complex pathogenesis, and there is no specific drugs approved by FDA [20]. With the increasing incidence rate of NAFLD, the impact on public health has aroused great interest in finding effective medication. Capsaicin plays a certain role in maintaining human metabolism, especially for weight loss in obese population. Hu demonstrated that a capsaicin-rich diet has a beneficial intervention in populations at high risk for NAFLD [21]. However, the side effects of capsaicin administration, including gastric ulcers, stomatitis, vomiting, diarrhea, hyperalgesia pain, and nausea, have been reported in several human projects [22, 23]. Our study demonstrated that the topical application of capsaicin can not only improve liver steatosis in mice fed with high-fat high-sugar diet, but also prevent lipid accumulation in human hepatocytes. Meanwhile, the side effects caused by direct administration of capsaicin have been avoided. Basing the fact that the hyperlipidemia induced by high-fat high-sugar diet had not been improved by capsaicin in our experiment, we emphasize that the protecting of liver from lipid accumulation may require drug combination of capsaicin and other hyperlipidemic drugs. Herein, we call for an in-depth understanding of the role and mechanism of capsaicin in the prevention of NAFLD and other related metabolic diseases.

In NAFLD, although fatty acids accumulated in hepatocytes, with the increased expression of SREBP-1c, FAS, and ACC1, de novo synthesis and uptake of fatty acids are still enhanced. The genes related to fatty acid oxidation, including CYP2E1 and CYP4A11, are overexpressed, while the expression of PPAR-α is decreased [19]. Our data indicated that the effect of capsaicin preventing lipid accumulation is mainly dependent on the regulation of SREBP-1c and ACC1, as well as ω-oxidation mediated by CYP2E1. Nowadays, SREBP, ACC, and PPARs have attracted more attention in the pharmaceutical research of NAFLD [24]. It’s reported that CYP2E1 is critically responsible for the development of alcoholic steatohepatitis (ALH), so there are a series of researches on drugs targeting CYP2E1 for ALH treatment [25]. We propose the role CYP2E1 in the pathogenesis of NAFLD should be under further investigation.

Contrary to previous studies, we did not find apparent changes of lipogenesis enzymes FAS. One reason is that the mice in our study were fed a diet containing high fat and high fructose simultaneously, which is more similar to the western diet. Different food ingredients may lead to significant changes of biochemical markers in mice. Its reported that the mRNA expression of FAS and ACC was not enhanced in methionine choline-deficient (MCD) fed mice [26].

In summary, we validated the role of capsaicin in preventing fatty accumulation in high-fat high-sugar fed mice and PAOA exposure human hepatocytes, which may be associated with the inhibition of de novo lipogenesis and CYP2E1 participation

ACC	Acetyl-CoA carboxylase
AMPK	Adenosine 5‘-monophosphate (AMP)-activated protein kinase
BSA	Bovine serum albumin
Cap	Capsaicin
CCK8	Cell Counting Kit-8
CYP2E1	Cytochrome P450 2E1
CYP4A11	Cytochrome P450 4A11
DNL	de novo lipogenesis
ELISA	Enzyme-linked immunosorbent assay
FAS	Fatty acid synthase
FBS	Fetal bovine serum
FDA	Food and Drug Administration
FFAs	Free fatty acids
GAPDH	Glyceraldehyde phosphate dehydrogenase
HDL-C	High-density lipoprotein cholesterol
H&E	Hematoxylin and eosin
HFHSD	High-fat high-sugar diet
IL-6	Interleukin- 6
IL-8	Interleukin- 8
LDL-C	Low-density lipoprotein cholesterol
LPS	Lipopolysaccharide
MEM	Minimum Essential Medium
NAFLD	Nonalcoholic fatty liver disease
NASH	Nonalcoholic steatohepatitis
ND	Normal diet
OCT	Optimal cutting temperature compound
PAOA	Palmitic and oleic acid
PPARα	Peroxisome proliferator-activated receptor α
ROS	Reactive oxygen species
SREBP-1c	Sterol regulatory element-binding protein-1c
TC	Total cholesterol
TG	Triglyceride
TNF-α	Tumor necrosis factor-α
TRPV1	Transient receptor potential vanilloid 1

Ethics approval and consent to participate:

Male C57BL/6 mice were purchased from SLAC Laboratory Animal Company Limited (Shanghai, China). The care and use of mice conformed to the “Guide for the Care and Use of Laboratory Animal”. All studies were performed with the approval of the Laboratory Animal Ethics Committee of Zhejiang Sci-Tech University. All methods about animals were carried out in compliance with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments). Other methods were carried out in accordance with guidelines of Zhejiang Sci-Tech University Experimental Specifications.

Cell line was purchased from FuHeng Cell Center，Shanghai，China.

Consent for publication: Not applicable.

Availability of data and materials: All data generated or analyzed during this study are included in this published article [and its supplementary information files].

Competing interests: The authors declare that they have no competing interests.

Funding: Supported by National Natural Science Foundation of China (No. 81972281), Natural Science Foundation of Zhejiang Province (No. LGF22C010005), and Scientific Research Foundation of Nanshan District (No. 2020016).

Author Contributions: J.G, S.W, and X.L performed experiments; L.X and X.J were responsible for data analysis；X.J drafted the manuscript, W.A, Y.Z, and T.Y participated in the project discussion; K.C was responsible for designing and revising of the manuscript.

Acknowledgements: Not applicable.

Powell EE, Wong VW, Rinella M: Non-alcoholic fatty liver disease. Lancet (London, England) 2021, 397(10290):2212-2224.
Younossi ZM: Non-alcoholic fatty liver disease - A global public health perspective. Journal of hepatology 2019, 70(3):531-544.
Friedman SL, Neuschwander-Tetri BA, Mary R, Sanyal AJ: Mechanisms of NAFLD development and therapeutic strategies. Nature Medicine 2018.
Targher G, Tilg H, Byrne CD: Non-alcoholic fatty liver disease: a multisystem disease requiring a multidisciplinary and holistic approach. The lancet Gastroenterology & hepatology 2021, 6(7):578-588.
Eslam M, Newsome PN, Sarin SK, Anstee QM, Targher G, Romero-Gomez M, Zelber-Sagi S, Wai-Sun Wong V, Dufour JF, Schattenberg JM et al: A new definition for metabolic dysfunction-associated fatty liver disease: An international expert consensus statement. Journal of hepatology 2020, 73(1):202-209.
Tsujimoto T, Kuriyama S, Yamazaki M, Nakatani Y, Okuda H, Yoshiji H, Fukui H: Augmented hepatocellular carcinoma progression and depressed Kupffer cell activity in rat cirrhotic livers. Int J Oncol 2001, 18(1):41-47.
Liu J, Xu Y, Hu Y, Wang G: The role of fibroblast growth factor 21 in the pathogenesis of non-alcoholic fatty liver disease and implications for therapy. Metabolism-clinical & Experimental 2015, 64(3):380-390.
Nemes K, Berg F: Interpreting lipoproteins in nonalcoholic fatty liver disease. Current Opinion in Lipidology 2017, 28(4):355-360.
Richards BL, Whittle SL, Buchbinder R: Neuromodulators for pain management in rheumatoid arthritis. The Cochrane database of systematic reviews 2012, 1(1):Cd008921.
Singh U, Bernstein JA: Intranasal capsaicin in management of nonallergic (vasomotor) rhinitis. Progress in drug research Fortschritte der Arzneimittelforschung Progres des recherches pharmaceutiques 2014, 68:147-170.
Mahalak KK, Bobokalonov J, Firrman J, Williams R, Evans B, Fanelli B, Soares JW, Kobori M, Liu L: Analysis of the Ability of Capsaicin to Modulate the Human Gut Microbiota In Vitro. Nutrients 2022, 14(6).
Azlan A, Sultana S, Huei CS, Razman MR: Antioxidant, Anti-Obesity, Nutritional and Other Beneficial Effects of Different Chili Pepper: A Review. Molecules (Basel, Switzerland) 2022, 27(3).
Teruo K, Koh-Ichiro H, Kazuo I: Effects of capsaicin on lipid metabolism in rats fed a high fat diet. Journal of Nutrition 1986(7):1272.
Ohnuki K, Haramizu S, Oki K, Watanabe T, Yazawa S, Fushiki T: Administration of Capsiate, a Non-Pungent Capsaicin Analog, Promotes Energy Metabolism and Suppresses Body Fat Accumulation in Mice. Bioscience, Biotechnology, and Biochemistry 2001.
Kang JH, Goto T, Han IS, Kawada T, Kim YM, Yu R: Dietary capsaicin reduces obesity-induced insulin resistance and hepatic steatosis in obese mice fed a high-fat diet. Obesity (Silver Spring, Md) 2010, 18(4):780-787.
Panchal SK, Bliss E, Brown L: Capsaicin in Metabolic Syndrome. Nutrients 2018, 10(5).
Nikami H, Mahmoud ME, Shimizu Y, Shiina T, Hirayama H, Iwami M, Dosoky RM, Ahmed MM, Takewaki T: Capsaicin pretreatment attenuates LPS-induced hypothermia through TRPV1-independent mechanisms in chicken. Life Sci 2008, 82(23-24):1191-1195.
Chen J, Li L, Li Y, Liang X, Sun Q, Yu H, Zhong J, Ni Y, Chen J, Zhao Z et al: Activation of TRPV1 channel by dietary capsaicin improves visceral fat remodeling through connexin43-mediated Ca2+ influx. Cardiovasc Diabetol 2015, 14:22.
Kohjima M, Enjoji M, Higuchi N, Kato M, Kotoh K, Yoshimoto T, Fujino T, Yada M, Yada R, Harada N: Re-evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease. International Journal of Molecular Medicine 2007, 20(3):351-358.
Obelianis VB, Vasiliauskas DA: [Functional indices of the cardiovascular system in pronounced neuro-emotional tension]. Gigiena truda i professional'nye zabolevaniia 1988(2):13-16.
Hu J, Luo H, Jiang Y, Chen P: Dietary capsaicin and antibiotics act synergistically to reduce non-alcoholic fatty liver disease induced by high fat diet in mice. Oncotarget 2017, 8(24):38161.
Hayman M, Kam PC: Capsaicin: A review of its pharmacology and clinical applications. CURRENT ANAESTHESIA AND CRITICAL CARE 2008.
Lu M, Chen C, Lan Y, Xiao J, Li R, Huang J, Huang Q, Cao Y, Ho CT: Capsaicin-the major bioactive ingredient of chili peppers: bio-efficacy and delivery systems. Food Funct 2020, 11(4):2848-2860.
Saran AR, Dave S, Zarrinpar A: Circadian Rhythms in the Pathogenesis and Treatment of Fatty Liver Disease. Gastroenterology 2020, 158(7).
Diesinger T, Buko V, Lautwein A, Dvorsky R, Belonovskaya E, Lukivskaya O, Naruta E, Kirko S, Andreev V, Buckert D et al: Drug targeting CYP2E1 for the treatment of early-stage alcoholic steatohepatitis. PloS one 2020, 15(7):e0235990.
Shin MK, Yang SM, Han IS: Capsaicin suppresses liver fat accumulation in high-fat diet-induced NAFLD mice. Animal cells and systems the official publication of the Zoological Society of Korea 2020(23):1-6.

No competing interests reported.

Additionalfile1.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Capsaicin ameliorates fatty accumulation both in mouse liver and in human hepatocytes

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1