Colletotrichum acericola sp. nov. from seeds of invasive alien Acer negundo in Poland: delayed pathogen introduction after its host appearance?

doi:10.21203/rs.3.rs-2070381/v1

Download PDF

Article

Colletotrichum acericola sp. nov. from seeds of invasive alien Acer negundo in Poland: delayed pathogen introduction after its host appearance?

https://doi.org/10.21203/rs.3.rs-2070381/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The boxelder maple (Acer negundo, Sapindaceae) is one of the most common tree species of the genus Acer natively growing in North America. In the 17th century A. negundo was introduced to Europe as an ornamental plant, and from this point forward it started uncontrolled expansion on new territories, as an alien invasive species (IAS), threatening local ecosystems and human’s safeness. Etiological symptoms of fungal development on boxelders’ seeds and petioles, were observed in 2017 and 2021 in the municipality of Wrocław (SW Poland, Europe), outside of host native occurrence. Morphological analyses combined with multilocus phylogenetic analyses (using rDNA ITS, gapdh, act, tub2, chs-1, and his3 sequences), indicated that isolated strains belong to a new species of Colletotrichum, from the rare Colletotrichum agaves species complex. Name Colletotrichum acericola is proposed for this fungus, after its host on which it was found. It is the second species of the Colletotrichum agaves species complex described from the dicotyledonous host and outside host plants of the family Asparagaceae. Based on phylogenetic analyses and deposited in NCBI-GenBank environmental sequences (ex endophytes of Dalea purpurea and Panicum virgatum in prairies of USA) assigned here to this species, it is likely that Colletotrichum acericola is native to North America and introduced to Europe after its host plant appearance, maybe on nursery material. The possible future invasion of C. acericola on Acer negundo and its spillover to other (native) Acer species in Europe are discussed.

Acer negundo

boxelder

Colletotrichum

invasive alien species

novel weapons hypothesis

taxonomy

spillover

Biological invasions are one of the greatest challenges of the 21th century [1]. According to Hulme [2], up to 80% of alien taxa came to Europe as ornamental plants, due to their decorative features, which bring them to the centres of cities and gardens. It is estimated that up to 5–20% of them became invasive over time [3]. The uncontrolled movement of organisms beyond the natural ranges of their occurrence not only threatens biodiversity, but can also pose economic problems and threaten human health and life [4–9]. The negative impact of invasive alien species on local ecosystems may be direct, such as niche occupation and allelopathic impact, or indirect, e.g. through the transfer of pathogens and parasites to native organisms occurring in new areas [10, 11].

The phenomenon of increased competitiveness of alien invasive plants compared to native taxa is explained by many hypotheses, however, the most important of which, dealing with pathogen transfer, are the Enemy Release Hypothesis (ERH) and the Novel Weapons Hypothesis (NWH). According to the assumptions of ERH hypothesis, invasive alien species are under lower enemy pressure than native one, which gives them advantage in energy expending for sporulation, growth and expansion [12–15]. Alien species might also be a carrier of some alien, cryptic pathogens, that may be transferred unnoticed and be brought into new territories with the host plant, often as endophytes [10, 15–17]. In principle dragged alien pathogens are less harmful to the primary host with whom they share years of co-occurrence, but by spillovering to local plants, they can threaten organisms in native ecosystems [11, 18, 19]. This phenomenon indirectly is taken up by the NWH, which mainly explain IAS superiority as a result of allelopathic influence. Newly introduced host plants may pose a phytosanitary threat, by being a reservoir of native (for the host plant) pathogens attacking local species with double-barrelled strength (spillback mechanism), which may negatively influence native flora [16, 20, 21]. On the other hand, the introduction of alien pathogens often may happen long after introduction of alien host plants, what we often observed on example of powdery mildews [e.g., 22–26]; that shows that the threat posed by alien species is a long term issue that may affect local ecosystems for a long time.

The boxelder maple (Acer negundo, Sapindaceae) is the most common species of the genus Acer in North America. It was brought to Europe in 1688 to the Fulham Garden in England as an ornamental plant [27]. In Poland, the species joined the collection of the Kraków Botanical Garden (1808), the park’s trees collection in Krzemieniec (1810) and the collection in Niedźwiedź in 1813. Based on information from neighboring countries [27], the first escape of A. negundo from cultivation in Central Europe was observed at the turn of the 19th and 20th centuries. At that time, it was also planted as a roadside plant [27]. However, its particularly high occurrence in the first stages of invasion was recorded along rivers where this species developed particularly well [27–29]. Currently, the boxelder is considered as an invasive alien species which occurs in natural and semi-natural habitats. The species invaded all European countries (except Iceland and Ireland) [30]. Due to its rapid growth, high resistance to drought and wide tolerance to soil and light conditions, A. negundo spreads the easiest in areas exposed to strong human pressure (e.g. heaps, post-industrial dumps or the surroundings of settlers). This ornamental plant is still used for greening poor, degraded soils, parks and alleys, where due to the above-mentioned features it is one of the few plants, capable to stand such harsh, urban conditions [28]. Importantly, the boxelder pose the greatest threat to phytocoenoses such as riparian forests and open ecosystems, e.g. xerothermic grasslands [30, 31], by displacing native species of woody and herbaceous plants. Moreover, overgrowing stems and twigs of A. negundo on the railway and hydrological infrastructure (e.g., fire embankments), makes it difficult to maintain them in a proper technical condition, indirectly threatening people’s safety. Moreover, A. negundo may influence human health, as its pollen has allergenic properties.

Apart from the native area of the boxelder occurrence, only a few fungi causing plant diseases have been described from this alien tree in a secondary range of its occurrence. For example, in Europe the boxelder is a host of polyphagous fungus - Phymatotrichum omnivorum causing dangerous disease syndrome known as root rot [31]. Other diseases that were observed in Europe include: tar spot (caused by Rhytisma acerinum) [32], leaf spot (caused by Diplodina acerina), powdery mildew (caused by Sawadea bicornis) [33] and shoot dieback (caused by Fusarium lateritium) [34]. In 2015 the Slovenian forest service noted rarely recorded species Cristulariella depraedans, Schizophyllum commune, and oomycete pathogen Phytophthora sp. [35]. In turn, in Turkey and China, shoot dieback caused by Fusarium solani, Fusarium nirenbergiae and Fusarium lateritium were also observed from A. negundo [36–38].

Interestingly, among the genus Colletotrichum, only Colletotrichum gloeosporioides has been reported on Acer negundo, in the native range of boxelder occurrence: in New Jersey and Texas in the USA [39]. However, it is currently known that Colletotrichum gloeosporioides is a species complex [40, 41], and therefore, the identity of the Colletotrichum species on the boxelder in the USA is unclear. At the same time it is obvious that the genus Colletotrichum is one of the most important fungal genera, including saprobes, endophytes and plant pathogens causing anthracnoses on a wide range of angiosperm plants [42, 43]. In the past, the identification of Colletotrichum species was challenging due to simple and often overlapping morphological characteristics in many species complexes [44, 45]. The application of molecular phylogenetic methods, based on multi-locus DNA sequence analyses, provided a reliable tool to species identification [42, 46] leading to extensive studies on the genus Colletotrichum, especially in tropics and subtropics [43]. Recently, etiological symptoms of fungal development on seeds and petioles of Acer negundo with conidiomata similar to Colletotrichum species were observed in south-western Poland. The aim of this study was to isolate the causative agent into cultures and to identify the isolated fungus to species based on morphological and multi-locus DNA sequences analyses. The possible geographical origin of the causative agent, its introduction to Europe after host appearance and its possible impact on the native plants are discussed.

Isolates

Seeds and petioles of Acer negundo (Sapindaceae) with etiological symptoms of fungal development were collected in the municipality of Wrocław (SW Poland) in November 2017 and November 2021, from two localities in SE part of the city (det. & leg. K.Patejuk). On both study spots, plants were growing in small groups as a part of an urban green area, located in a close neighbourhood to the traffic route. Each locality, three individuals of A. negundo were surveyed. Fully matured seeds and rarely petioles were covered by brown smears that turned to the black, raised dots, breaking on the apical part with time. The use of plants in the present study complied with international, national and institutional guidelines. After one month of drying under room conditions seeds with symptoms of fungal development were disinfected with 1% sodium hypochlorite solution for 30 sec and placed on PDA medium (Biocorp). After 14 days from developed colonies, one representative strain of Colletotrichum species from three multispecies fungal cultures (representing three collections from two spots) was transferred to Petri dishes with PDA in order to obtain single-species cultures that were used for morphological and molecular analyses. Dried specimens (holotype, isotype and other specimens) are stored in the fungal collection of the W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków (KRAM F). Ex-type culture and other culture are deposited in the culture collection of the Westerdijk Fungal Biodiversity Institute (CBS).

Morphological analyses

Symptoms of infection were observed and photographed using dried seeds and petioles. Macroscopic characteristics and colony diameter of cultures were analyzed and measured on MEA (malt extract agar), OA (oatmeal agar), PDA (potato dextrose agar) and SNA (synthetic nutrient-poor agar) using one- and two-week-cultures incubated at 25°C. Microscopic characteristics were studied mostly on PDA, supplemented by some observations on OA, using cultures or slide cultures older than two weeks incubated at 25°C. Fungal structures taken from the cultures were placed in 80% lactic acid, heated to boiling point, cooled and examined under a Nikon Eclipse 80i light microscope at a magnification of ×1000. The microscopic structures were measured and photographed using NIS-Elements BR 3.0 imaging software.

DNA isolation, amplification, and sequencing

Prior to molecular analyses, isolates were grown on PDB medium (Potato Dextrose Broth, BD Difco, USA) for 10 days at 23°C in the dark at Petri dishes protected with Parafilm.

DNA was extracted using Bead-Beat Micro AX Gravity Kit (A&A Biotechnology, Poland) from freeze dried (CoolSafe, Scanvac, Denmark) mycelium homogenized with quartz beads in a Magna Lyser homogenizer (Roche, Basel, Switzerland). Then, DNA was quantified fluorometrically on a Quantus device (Promega, WI, USA) and diluted in ddH₂O to a concentration of 20 ng·L^− 1 for further analyses.

Amplification of ITS1-5.8S-ITS2 regions of ribosomal DNA (ITS) and fragments encoding β-tubulin (tub2), actin (act), glyceraldehyde-3-phosphate dehydrogenase (gadph) and chitin synthase (chs-1) genes was carried out in 37.5 µL of PCR Mix Plus (A&A Biotechnology, Poland). The final concentration of reagents was as follows: 1×PCR Mix Plus, 0.6 pM of each primer synthesized by IBB PAN, Poland (Table 1) and 4 ng of DNA template. Thermal cycling was performed on an Eppendorf EP Mastercycler using the following parameters: initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation in 94°C for 1 min, annealing in temperature typical for each of the 5 primer set (Table 1) for 1 min and extension in 72°C for 2 min, followed by 10 min at 72°C for the final extension. The presence of PCR products was verified by electrophoretic separation of 2 µL of the post-reaction mixture in tris-borate-EDTA (TBE) buffered by a 1.2% agarose gel (Pronadisa, Spain) stained with SimplySafe (EURx, Poland).

Table 1

Annealing conditions of PCR assays, primers and their references
Target	Primer name and sequence 5′→ 3′	Annealing conditions	References
ITS	ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC	55°C/1 min	[68]
act	ACT-512F: ATGTGCAAGGCCGGTTTCGC ACT-783R: TACGAGTCCTTCTGGCCCAT	60°C TD-PCR*	[69]
chs-1	CHS-79F: TGGGGCAAGGATGCTTGGAAGAAG CHS-354R: TGGAAGAACCATCTGTGAGAGTTG	58°C/1 min	[69]
gapdh	GDF1: GCCGTCAACGACCCCTTCATTGA GDR1: GGGTGGAGTCGTACTTGAGCATGT	58°C/1 min	[70]
tub2	Bt2a : GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC	58°C/1 min	[71]
*65°C (cycle 1–5); 62°C (cycle 6–10); 60°C (cycle 11–35).

The amplification products were purified and sequenced by Genomed, Poland. Fluorograms were edited and consensus sequences were generated with FinchTV 1.4 (Geospiza Inc., Seattle, WA, USA). The Basic Local Alignment Search Tool (BLAST) [47] of the GenBank NCBI nucleotide sequence database (www.ncbi.nlm.nih.gov/genbank) was used to compare ITS, act, chs-1, gapdh and tub2 sequences of our isolates with sequences deposited in mentioned database.

Phylogenetic analyses

Obtained sequence reads were trimmed and assembled in Geneious Prime® 2022.1.1. In order to resolve phylogenetic and systematic placement of obtained strains, a multilocus dataset, comprising rDNA ITS, gapdh, act, tub2, chs-1, his3 sequences, was assembled. Dataset comprised newly generated sequences, sequences from all sequenced representatives of the Colletotrichum agaves and Colletotrichum boninense species complexes and sequences of selected representatives of other related Colletotrichum species used by Talhinhas and Baroncelli [43] and Liu et al. [48] (with small modifications) (Table 2). Additionally, all rDNA ITS sequences present in GenBank [49, 50] that were identical to rDNA ITS sequences of our strains were included in phylogenetic reconstruction. Monilochaetes infuscans was used as an outgroup.

Table 2

List of species, with details of strain/voucher information, country of origin, host plant, and GenBank accession numbers (ITS, act, chs-1, gapdh, his3, tub2) used for phylogenetic analyses
Species	Strain/ specimen voucher**	Country	Host plant	GenBank acc. no.
Species	Strain/ specimen voucher**	Country	Host plant	ITS	act	chs-1	gapdh	his3	tub2
Colletotrichum agaves	CBS 118190	Mexico	Agave striata	DQ286221	–	–	–	–	–
Colletotrichum acericola	CBS (= Col5B)*	Poland	Acer negundo	OP514720	OP536817	OP524187	OP524190	–	OP524184
Colletotrichum acericola	CBS (= Col4B)	Poland	Acer negundo	OP514722	OP536819	OP524186	OP524189	–	OP524183
Colletotrichum acericola	KRAM F-59696 (= KJN2)	Poland	Acer negundo	OP514721	OP536818	OP524188	OP524191	–	OP524185
Colletotrichum agaves	LC0947	Thailand	Agave sp.	MZ595831	MZ664129	MZ799266	MZ664053	MZ673842	MZ673955
Colletotrichum annellatum	CBS 129826*	Colombia	Hevea brasiliensis	JQ005222	JQ005570	JQ005396	JQ005309	JQ005483	JQ005656
Colletotrichum arecacearum	LC13850*	China	Arecaceae	MZ595867	MZ664165	MZ799262	MZ664049	MZ673887	MZ673986
Colletotrichum beeveri	CBS 128527*	New Zealand	Brachyglottis repanda	JQ005171	JQ005519	JQ005345	JQ005258	JQ005432	JQ005605
Colletotrichum boninense	CBS 123755*	Japan	Crinum asiaticum var. sinicum	JQ005153	JQ005501	JQ005327	JQ005240	JQ005414	JQ005588
Colletotrichum brasiliense	CBS 128501*	Brazil	Passiflora edulis	JQ005235	JQ005583	JQ005409	JQ005322	JQ005496	JQ005669
Colletotrichum brassicicola	CBS 101059*	New Zealand	Brassica oleracea var. gemmifera	JQ005172	JQ005520	JQ005346	JQ005259	JQ005433	JQ005606
Colletotrichum bromeliacearum	LC0951*	China	bromeliad	MZ595832	MZ664130	MZ799267	MZ664077	MZ673843	MZ673956
Colletotrichum camelliae	CGMCC 3.14925*	China	Camellia sinensis	KJ955081	KJ954363	MZ799255	KJ954782	MZ673847	KJ955230
Colletotrichum camelliae-japonicae	CGMCC 3.18118*	China	Camellia japonica	KX853165	KX893576	–	KX893584	–	KX893580
Colletotrichum catinaense	CBS 142417*	Italy	Citrus reticulata	KY856400	KY855971	KY856136	KY856224	KY856307	KY856482
Colletotrichum chamaedoreae	LC13868*	China	Chamaedorea erumpens	MZ595890	MZ664188	MZ799274	MZ664084	MZ673910	MZ674008
Colletotrichum citricola	CBS 134228*	China	Citrus unshiu	KC293576	KC293616	KC293792	KC293736	–	KC293656
Colletotrichum citri-medicae	GUCC 1554*	China	Citrus medica	MN959910	MT006325	MT006328	MT006331	MT006334	–
Colletotrichum colombiense	CBS 129818*	Colombia	Passiflora edulis	JQ005174	JQ005522	JQ005348	JQ005261	JQ005435	JQ005608
Colletotrichum condaoense	CBS 13429*	Vietnam	Ipomoea pes-caprae	MH229914	–	MH229926	MH229920	MH229927	MH229923
Colletotrichum constrictum	CBS 128504*	New Zealand	Citrus limon	JQ005238	JQ005586	JQ005412	JQ005325	JQ005499	JQ005672
Colletotrichum cymbidiicola	IMI 347923*	Australia	Cymbidium sp.	JQ005166	JQ005514	JQ005340	JQ005253	JQ005427	JQ005600
Colletotrichum dacrycarpi	CBS 130241*	New Zealand	Dacrycarpus dacrydioides	JQ005236	JQ005584	JQ005410	JQ005323	JQ005497	JQ005670
Colletotrichum diversum	LC11292 *	China	Thaumatophyllum bipinnatifidum	MZ595844	MZ664142	MZ799272	MZ664081	MZ673864	MZ673965
Colletotrichum doitungense	MFLUCC 14–0128*	Thailand	Dendrobium sp.	MF448524	MH376385	–	MH049480	–	MH351277
Colletotrichum euphorbiae	CBS 134725*	South Africa	Euphorbia sp.	KF777146	KF777125	KF777128	KF777131	KF777134	KF777247
Colletotrichum feijoicola	CBS 144633*	Portugal	Acca sellowiana	MK876413	MK876466	–	MK876475	–	MK876507
Colletotrichum gloeosporioides	IMI 356878*	Italy	Citrus sinensis	JX010152	JX009531	JX009818	JX010056	JQ005413	JX010445
Colletotrichum grevilleae	CBS 132879*	Italy	Grevillea sp.	KC297078	KC296941	KC296987	KC297010	KC297056	KC297102
Colletotrichum hippeastri	CBS 125376*	China	Hippeastrum vittatum	JQ005231	JQ005579	JQ005405	JQ005318	JQ005492	JQ005665
Colletotrichum karstii	CBS 132134*	China	Vanda sp.	HM585409	HM581995	HM582023	HM585391	–	HM585428
Colletotrichum ledebouriae	CBS 141284*	South Africa	Ledebouria floridunda	KX228254	KX228357	–	–	KX228365	–
Colletotrichum limonicola	CBS 142410*	Malta	Citrus limon	KY856472	KY856045	KY856213	KY856296	KY856388	KY856554
Colletotrichum nageiae	LC13866*	China	Nageia nagi	MZ595882	MZ664180	MZ799278	MZ664087	MZ673902	MZ674000
Colletotrichum neosansevieriae	CBS 139918*	South Africa	Sansevieria trifasciata	KR476747	KR476790	KF777128	KR476791	KR476792	KR476797
Colletotrichum novae-zelandiae	CBS 128505*	New Zealand	Capsicum annuum	JQ005228	JQ005576	JQ005402	JQ005315	JQ005489	JQ005662
Colletotrichum oncidii	CBS 129828*	Germany	Oncidium sp.	JQ005169	JQ005517	JQ005343	JQ005256	JQ005430	JQ005603
Colletotrichum parsonsiae	CBS 128525*	New Zealand	Parsonsia capsularis	JQ005233	JQ005581	JQ005407	JQ005320	JQ005494	JQ005667
Colletotrichum petchii	CBS 378.94*	Italy	Dracaena marginata	JQ005223	JQ005571	JQ005397	JQ005310	JQ005484	JQ005657
Colletotrichum phyllanthi	CBS 175.67*	India	Phyllanthus acidus	JQ005221	JQ005569	JQ005395	JQ005308	JQ005482	JQ005655
Colletotrichum pyrifoliae	CGMCC 3.18902*	China	Pyrus pyrifolia	MG748078	MG747768	MG747914	MG747996	–	MG748158
Colletotrichum sansevieriae	MAFF 239721*	Japan	Sansevieria trifasciata	AB212991	(Sequences available at http://www.gene.affrc.go.jp/databases-micro_search_en.php)
Colletotrichum “sansevieriae”	IUB: B.Whitaker: OTU58	USA	Panicum virgatum	MH178727	–	–	–	–	–
Colletotrichum sp. isolate MBD_190	MBD_190	USA	Dalea purpurea	MK595512	–	–	–	–	–
Colletotrichum torulosum	CBS 128544*	New Zealand	Solanum melongena	JQ005164	–	JQ005338	JQ005251	JQ005425	JQ005598
Colletotrichum watphraense	MFLUCC 14–0123*	Thailand	Dendrobium sp.	MF448523	MH376384	–	MH049479	–	MH351276
Monilochaetes infuscans	CBS 869.96*	South Africa	Ipomoea batatas	GU180626	JQ005843	JQ005801	JX546612	JQ005822	JQ005864
** Abbreviations: CGMCC: China General Microbiological Culture Collection Center, Beijing, China; CBS: Culture collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; IMI: Culture collection of CABI Europe UK Centre, Egham, UK; KRAM F: Fungal collection of the W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków, Poland; LC: Working collection of Lei Cai, housed at Chinese Academy of Sciences, Beijing, China; MAFF: Ministry of Agriculture, Forestry and Fisheries, Tsukuba, Japan; MBD: personal collection of Mara DeMers; MFLUCC: Mae Fah Luang University Culture Collection, ChiangRai, Thailand.
* = ex-holotype or ex-epitype culture.

Table 2

List of species, with details of strain information, country of origin, host plant, and GenBank accession numbers (ITS, *act*, *chs-1*, *gapdh*, *his3*, *tub2*) used for phylogenetic analyses
Species	Strain**	Country	Host plant	GenBank acc. no.
Species	Strain**	Country	Host plant	ITS	act	chs-1	gapdh	his3	tub2
Colletotrichum agaves	CBS 118190	Mexico	Agave striata	DQ286221	–	–	–	–	–
Colletotrichum acericola	CBS XXX (= Col5B)*	Poland	Acer negundo	XXX	XXX	XXX	XXX	–	XXX
Colletotrichum acericola	CBS XXX (= Col4B)	Poland	Acer negundo	XXX	XXX	XXX	XXX	–	XXX
Colletotrichum acericola	KRAM F-59696	Poland	Acer negundo	XXX	XXX	XXX	XXX	–	XXX
Colletotrichum agaves	LC0947	Thailand	Agave sp.	MZ595831	MZ664129	MZ799266	MZ664053	MZ673842	MZ673955
Colletotrichum annellatum	CBS 129826*	Colombia	Hevea brasiliensis	JQ005222	JQ005570	JQ005396	JQ005309	JQ005483	JQ005656
Colletotrichum arecacearum	LC13850*	China	Arecaceae	MZ595867	MZ664165	MZ799262	MZ664049	MZ673887	MZ673986
Colletotrichum beeveri	CBS 128527*	New Zealand	Brachyglottis repanda	JQ005171	JQ005519	JQ005345	JQ005258	JQ005432	JQ005605
Colletotrichum boninense	CBS 123755*	Japan	Crinum asiaticum var. sinicum	JQ005153	JQ005501	JQ005327	JQ005240	JQ005414	JQ005588
Colletotrichum brasiliense	CBS 128501*	Brazil	Passiflora edulis	JQ005235	JQ005583	JQ005409	JQ005322	JQ005496	JQ005669
Colletotrichum brassicicola	CBS 101059*	New Zealand	Brassica oleracea var. gemmifera	JQ005172	JQ005520	JQ005346	JQ005259	JQ005433	JQ005606
Colletotrichum bromeliacearum	LC0951*	China	bromeliad	MZ595832	MZ664130	MZ799267	MZ664077	MZ673843	MZ673956
Colletotrichum camelliae	CGMCC 3.14925*	China	Camellia sinensis	KJ955081	KJ954363	MZ799255	KJ954782	MZ673847	KJ955230
Colletotrichum camelliae-japonicae	CGMCC 3.18118*	China	Camellia japonica	KX853165	KX893576	–	KX893584	–	KX893580
Colletotrichum catinaense	CBS 142417*	Italy	Citrus reticulata	KY856400	KY855971	KY856136	KY856224	KY856307	KY856482
Colletotrichum chamaedoreae	LC13868*	China	Chamaedorea erumpens	MZ595890	MZ664188	MZ799274	MZ664084	MZ673910	MZ674008
Colletotrichum citricola	CBS 134228*	China	Citrus unshiu	KC293576	KC293616	KC293792	KC293736	–	KC293656
Colletotrichum citri-medicae	GUCC 1554*	China	Citrus medica	MN959910	MT006325	MT006328	MT006331	MT006334	–
Colletotrichum colombiense	CBS 129818*	Colombia	Passiflora edulis	JQ005174	JQ005522	JQ005348	JQ005261	JQ005435	JQ005608
Colletotrichum condaoense	CBS 13429*	Vietnam	Ipomoea pes-caprae	MH229914	–	MH229926	MH229920	MH229927	MH229923
Colletotrichum constrictum	CBS 128504*	New Zealand	Citrus limon	JQ005238	JQ005586	JQ005412	JQ005325	JQ005499	JQ005672
Colletotrichum cymbidiicola	IMI 347923*	Australia	Cymbidium sp.	JQ005166	JQ005514	JQ005340	JQ005253	JQ005427	JQ005600
Colletotrichum dacrycarpi	CBS 130241*	New Zealand	Dacrycarpus dacrydioides	JQ005236	JQ005584	JQ005410	JQ005323	JQ005497	JQ005670
Colletotrichum diversum	LC11292 *	China	Thaumatophyllum bipinnatifidum	MZ595844	MZ664142	MZ799272	MZ664081	MZ673864	MZ673965
Colletotrichum doitungense	MFLUCC 14–0128*	Thailand	Dendrobium sp.	MF448524	MH376385	–	MH049480	–	MH351277
Colletotrichum euphorbiae	CBS 134725*	South Africa	Euphorbia sp.	KF777146	KF777125	KF777128	KF777131	KF777134	KF777247
Colletotrichum feijoicola	CBS 144633*	Portugal	Acca sellowiana	MK876413	MK876466	–	MK876475	–	MK876507
Colletotrichum gloeosporioides	IMI 356878*	Italy	Citrus sinensis	JX010152	JX009531	JX009818	JX010056	JQ005413	JX010445
Colletotrichum grevilleae	CBS 132879*	Italy	Grevillea sp.	KC297078	KC296941	KC296987	KC297010	KC297056	KC297102
Colletotrichum hippeastri	CBS 125376*	China	Hippeastrum vittatum	JQ005231	JQ005579	JQ005405	JQ005318	JQ005492	JQ005665
Colletotrichum karstii	CBS 132134*	China	Vanda sp.	HM585409	HM581995	HM582023	HM585391	–	HM585428
Colletotrichum ledebouriae	CBS 141284*	South Africa	Ledebouria floridunda	KX228254	KX228357	–	–	KX228365	–
Colletotrichum limonicola	CBS 142410*	Malta	Citrus limon	KY856472	KY856045	KY856213	KY856296	KY856388	KY856554
Colletotrichum nageiae	LC13866*	China	Nageia nagi	MZ595882	MZ664180	MZ799278	MZ664087	MZ673902	MZ674000
Colletotrichum neosansevieriae	CBS 139918*	South Africa	Sansevieria trifasciata	KR476747	KR476790	KF777128	KR476791	KR476792	KR476797
Colletotrichum novae-zelandiae	CBS 128505*	New Zealand	Capsicum annuum	JQ005228	JQ005576	JQ005402	JQ005315	JQ005489	JQ005662
Colletotrichum oncidii	CBS 129828*	Germany	Oncidium sp.	JQ005169	JQ005517	JQ005343	JQ005256	JQ005430	JQ005603
Colletotrichum parsonsiae	CBS 128525*	New Zealand	Parsonsia capsularis	JQ005233	JQ005581	JQ005407	JQ005320	JQ005494	JQ005667
Colletotrichum petchii	CBS 378.94*	Italy	Dracaena marginata	JQ005223	JQ005571	JQ005397	JQ005310	JQ005484	JQ005657
Colletotrichum phyllanthi	CBS 175.67*	India	Phyllanthus acidus	JQ005221	JQ005569	JQ005395	JQ005308	JQ005482	JQ005655
Colletotrichum pyrifoliae	CGMCC 3.18902*	China	Pyrus pyrifolia	MG748078	MG747768	MG747914	MG747996	–	MG748158
Colletotrichum sansevieriae	MAFF 239721*	Japan	Sansevieria trifasciata	AB212991	(Sequences available at http://www.gene.affrc.go.jp/databases-micro_search_en.php)
Colletotrichum “sansevieriae” Whitaker OTU58	IUB: B.Whitaker: OTU58	USA	Panicum virgatum	MH178727	–	–	–	–	–
Colletotrichum sp. isolate MBD_190	MBD_190	USA	Dalea purpurea	MK595512	–	–	–	–	–
Colletotrichum torulosum	CBS 128544*	New Zealand	Solanum melongena	JQ005164	JQ005598	JQ005338	JQ005251	JQ005425	JQ005598
Colletotrichum watphraense	MFLUCC 14–0123*	Thailand	Dendrobium sp.	MF448523	MH376384	–	MH049479	–	MH351276
Monilochaetes infuscans	CBS 869.96*	South Africa	Ipomoea batatas	GU180626	JQ005843	JQ005801	JX546612	JQ005822	JQ005864
** Abbreviations: CGMCC: China General Microbiological Culture Collection Center, Beijing, China; CBS: Culture collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; IMI: Culture collection of CABI Europe UK Centre, Egham, UK; KRAM F: Fungal collection of the W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków, Poland; LC: Working collection of Lei Cai, housed at Chinese Academy of Sciences, Beijing, China; MAFF: Ministry of Agriculture, Forestry and Fisheries, Tsukuba, Japan; MBD: personal collection of Mara DeMers; MFLUCC: Mae Fah Luang University Culture Collection, ChiangRai, Thailand.
* = ex-holotype or ex-epitype culture.

Multiple sequence alignments (MSA) were performed for each loci independently using the MAFFT algorithm [51] as implemented in Geneious Prime® 2022.1.1. and concatenated. The concatenated data block was used as an input file for the ModelTest-NG v. 0.2.0 in order to select the best-fit models of nucleotide substitution for partitioned MSA. For maximum likelihood (ML) based phylogenetic inference we have used the RAxML-NG v. 1.0.3. and for the Bayesian inference (BI) - MrBayes 3.2.6 [52]. Final phylogenetic tree was prepared with FigTree 1.4.4.

Phylogenetic analyses

For all sequenced samples high quality reads enabling assembly of reads were obtained. In case of gapdh sequences bidirectional reads have shared a limited number of nucleotides, but after comparison of sequences obtained in this study and in references from GenBank these were used with confidence.

For phylogenetic reconstruction a datablocks containing 47 ITS sequences (590 bp), 43 gapdh sequences (302), 43 act sequences (289 bp), 42 tub2 sequences (527 bp), 38 chs-1 sequences (280 bp) and 33 his3 sequences (396 bp) were used. The concatenated dataset consisted of 47 sequences of 2384 bp length. The best-fit substitution models were calculated separately for ML and BI templates and used in respective analyses based on Bayesian information criterion. ML analysis was performed with following models - TrN + I + G4 for ITS, TIM3ef + G4, K80 + G4 and HKY + G4 for gapdh codons, K80 + G4, K80 + G4 and TrNef + G4 for act codons, TPM2 + G4, TrNef + G4 and K80 + I + G4 for tub2 codons, TIM3ef + I + G4, HKY + G4 and JC for chs-1 codons, HKY + G4, TIM1 + I + G4 and TPM3 + I + G4 for his3 codons. The analysis was performed with 1000 bootstrap repetitions. The BI analysis used HKY + I + G4 substitution model for ITS, HKY + G4, K80 + G4 and HKY + G4 for gapdh codons, K80 + G4, K80 + G4 and HKY + G4 for act codons, K80 + G4, HKY + G4 and K80 + I + G4 for tub2 codons, JC + I + G4, HKY + G4 and JC for chs-1 codons, HKY + G4, GTR + I + G4 and K80 + G4 for his3 codons. The BI analyses were conducted using two concurrent analyses of four chains run for 165300 generations. First 25000 trees were eliminated as a burning.

Resulting trees from both analyses were congruent showing well-supported position of our strains within the Colletotrichum agaves species complex (Fig. 1). Sequences from studied strains, together with the two most similar rDNA ITS sequences recovered from GenBank [ex endophytes of Dalea purpurea (Fabaceae) and Panicum virgatum (Poaceae) in prairies of USA], are positioned in a sister position to sequences representing Colletotrichum agaves. The sequences of the studied Colletotrichum and C. agaves formed a sister group to subclade containing sequences of C. euphorbiae, C. ledebouriae, C. neosansevieriae and C. sansevieriae.

Taxonomy

Colletotrichum acericola Patejuk, Piątek, Czachura, Baturo-Cieśniewska, sp. nov. (Figs. 2–4)

MycoBank no. MB …………….

Etymology: Named after the host plant genus.

Description: Infection (in vivo) on seeds and seed petioles, at first forming orange patches, later encircled by darker borders and subsequently producing black rounded conidiomata that rupture and expose conidia. Mycelium (in vitro) consisting of hyaline or subhyaline, simple, septate, branched hyphae, sometimes constricted at septa, 1.5–6.0 µm. Conidiomata acervular, rounded, up to 500 µm in diam., black with setae and opening by rupture but sterile (on OA) or slimy orange consisting of conidial mass (on PDA and MEA), conidiophores formed on hyphae or on cushion-like, globose or subglobose cells, 4.0–13.5 × 4.0–6.5 µm. Setae numerous on OA but only one observed on PDA, brown, smooth, single or very rarely branched, 1–3-septate, 50–110 µm long, 3.0–5.5 µm wide at the base, tip acutely rounded. Conidiophores hyaline, smooth, straight, septate, single or rarely branched, 30.0–50.0 × 4.0–4.5 µm; conidiogenous cells hyaline, smooth, cylindrical, 18.0–31.0 × 3.5–6.0 µm. Conidia hyaline, smooth, with orange guttules, nonseptate, subcylindrical, straight or rarely slightly curved, apex obtuse, base sometimes indistinctly truncate, 17.5–22.5 × 5.0–7.5 µm. Appressoria brown, smooth, single, nonseptate, exceptionally 1-septate, rounded to clavate, margin sometimes undulate, 7.0–14.0 × 5.0– 9.5 µm.

Culture characteristics: Colony on MEA globose, flat, orange in the middle, covered with white aerial mycelium, which forms concentric zonation, and orange conidiomata, margin fimbriate, colony reaching 43 × 36 mm in diameter after 7 days and 68 × 47 mm after 14 days of growth at 25°C. Reverse orange with whitish margin. Colony on OA globose, flat, entirely orange, covered with white mycelium and grayish dots of emerging conidiomata (?) in the middle, with the entire edge, colony reaching 56 × 55 mm in diameter after 7 days and 85 × 85 mm after 14 days of growth at 25°C. Reverse orange. Colony on PDA undulate, flat, orange in the middle, partly covered with white aerial mycelium and orange conidiomata, margin white, colony reaching 31 × 24 mm in diameter after 7 days and 42 × 36 mm after 14 days of growth at 25°C. Reverse orange with whitish margin. Colony on SNA subglobose, flat, hyaline, with fimbriate margin, reaching 15 × 12 mm in diameter after 7 days and 39 × 29 mm after 14 days of growth at 25°C. Reverse white, margin fimbriate.

Type: Poland, Lower Silesia Province, Wrocław County: Wrocław city, Krakowska street, GPS: 51.08631, 17.06837, seeds and petioles of Acer negundo, 16 Oct. 2021, leg. K. Patejuk (KRAM F-59692 (dried culture) – holotype, KRAM F-59693 (material in planta) – isotype; culture ex type: col5b = CBS; GenBank sequences: ITS = OP514720, act = OP536817, chs-1 = OP524187, gapdh = OP524190, tub2 = OP524184).

Other specimens examined: Poland, Lower Silesia Province, Wrocław County: Wrocław city, Krakowska street, GPS: 51.08631, 17.06837, seeds of Acer negundo, 05 Dec. 2017, leg. K. Patejuk (KRAM F-59696 (dried culture); GenBank sequences: ITS = OP514721, act = OP536818, chs-1 = OP524188, gapdh = OP524191, tub2 = OP524185).

Poland, Lower Silesia Province, Wrocław County: Wrocław city, Bytomska street, GPS: 51.07698,17.08304, seeds and petioles of Acer negundo, 16 Oct. 2021, leg. K. Patejuk (KRAM F-59694 (dried culture), KRAM F-59695 (material in planta); culture ex type: col4b = CBS; GenBank sequences: ITS = OP514722, act = OP536819, chs-1 = OP524186, gapdh = OP524189, tub2 = OP524183).

In this study morphological and molecular phylogenetic analyses, based on sequences from multiple loci (rDNA ITS, gapdh, act, tub2, chs-1, his3), were used to resolve the identity of the Colletotrichum species inhabiting seeds and petioles of invasive alien Acer negundo surveyed in Poland. The analyses showed that causative agent represents a new species, which is described here as Colletotrichum acericola. Phylogenetically, this species is nested within the Colletotrichum agaves species complex.

The Colletotrichum agaves species complex is a relatively small complex established by Bhunjun et al. [53], comprising five species: C. agaves, C. euphorbiae, C. ledebouriae, C. neosansevieriae and C. sansevieriae [43, 48, 53, 54]. Colletotrichium acericola differs from C. agaves, which is the most closely related phylogenetic relative, by producing infection symptoms on seeds and petioles and by having shorter setae and smaller conidia. Colletotrichum agaves causes circular leaf spots with acervuli in concentric rings, its setae are 60–211 µm long and conidia are 17.5–33.0 µm long; additionally appressoria were not observed in cultures of this species [55]. The four remaining species of the C. agaves species complex are also morphologically different from C. acericola. First of all, they cause infections on leaves, either as leaf spots (C. ledebouriae, C. neosansevieriae) or water-soaked lesions and blight of the leaves (C. sansevieriae). In C. euphorbiae, the etiological symptoms on plants were not reported [56–59]. Morphologically, C. euphorbiae and C. sansevieriae differ in having longer conidia (17.0–28.5 µm long and 12.5–32.5 µm long, respectively) while C. ledebouriae and C. neosansevieriae differ in having more septa on setae that are also longer (setae 2–4-septate, 80–120 µm long and 3–7-septate, 120–200 µm long, respectively) [56–59].

In the genus Colletotrichum, there are different levels of host specificity. Generally, many species are generalists and could infect a wide range of host plants [41, 43, 48, 60, 61]. However, specialist species are also common in this genus - Jayawardena et al. [54] listed 153 host-specific species of Colletotrichum. Members of the Colletotrichum agaves species complex are considered as highly host specific and most of their host plants belong to monocot family Asparagaceae (C. agaves on Agave spp., C. ledebouriae on Ledebouria floridunda, C. sansevieriae on Sansevieria trifasciata, C. neosansevieriae on Sansevieria trifasciata) [43, 54, 62]. The only species that was previously described on plants from other host family is C. euphorbiae, found on Euphorbia sp. from the eudicot family Euphorbiaceae [57]. Colletotrichum agaves, that is genetically closely related to C. acericola, is reported from the biggest number of hosts as it was observed on numerous species of Agave and on Furcraea [55]; the reports on Furcraea are however not confirmed by molecular analyses. Based on our current knowledge, C. acericola is the second member of the Colletotrichum agaves species complex described from a dicotyledonous host (in the family Sapindaceae), outside of the family Asparagaceae. However, whether C. acericola is host-specific as the other members of its group is currently unclear and needs further studies. Two environmental sequences [ex endophytes of Dalea purpurea (Fabaceae) and Panicum virgatum (Poaceae) in prairies of USA] [49, 50] that were grouped with sequences of C. acericola suggest that this species may inhabit wider number of hosts, at least endophytically.

It is likely that the native occurrence of C. acericola might be in North America, possibly prairie in North-East USA. Sampling localisation of two identical to C. acericola rDNA ITS sequences (ex endophytes of Dalea purpurea and Panicum virgatum in prairies of Minnesota and Indiana/Illinois in the USA [49, 50]) provides us traces to support this hypothesis. The native occurrence of host plants of members of the Colletotrichum agaves complex species, which mainly contains warm, subtropical localisations in Southern Africa, Northern and Middle America, and the native range of host plants of C. acericola (Acer negundo, Dalea purpurea, Panicum virgatum) indirectly also spot American continent as a potential geographical origin of this species. Until now, besides C. agaves on introduced Agave species [55], none of the representatives of Colletotrichum agaves complex species was found in Europe. It is worth to mention that also other species in the Colletotrichum agaves species complex were introduced outside their possible native ranges, e.g. C. agaves or C. sansevieriae, which are currently known on alien ranges of respective host plants [55, 62–66].

The phenomenon of pathogens carried by IAS to the new areas is well known and documented [16]. It is likely that Colletotrichum acericola broke the geographic barrier, and was transferred to Europe, due to the transport of nursery material and seeds of A. negundo from the USA, to fulfill the need on the garden's market. The question remains whether Colletotrichum acericola was co-introduced to Europe together with its host plant Acer negundo already in the 17th or 19th century but remained unnoticed until now or whether it is a relatively recent introduction, long after host plant appearance. Still rare occurrence of C. acericola may suggest recent introduction. However, detailed searching for pathogen distribution is to be done. It is not excluded that if environmental conditions will be favorable, the abundance growth of C. acericola on the new localisations, leading to uncontrolled spillover of C. acericola to other (native) representatives of Acer spp. in Europe may be observed in the future. As many examples have shown, the consequences of alien pathogen adaptation to the new range of hosts in new areas might be disastrous for local environments [16]. The future development of invasion made by Colletotrichum acericola in Europe and its possible jump/spillover to native hosts should be monitored. However, because of the current cryptic life-style of the C. acericola it is hard to assess potential spread of this species in Europe and type of its interaction with european representatives of Acer spp. Nevertheless, as Blackburn and Even [15] point out, newly arrived pathogens are less harmful to invasive alien plants with which they have shared years of co-evolution. In turn, local taxa do not have any evolutionary adaptations against this pathogen. This approach is indicated by the Novel Weapons Hypothesis, proposed by Schmid-Hempel [67]. The potential threat that C. acericola might pose for a native european Acer species needs more studies, starting with pathogenicity tests in controlled conditions. This type of research will give us the opportunity for a rapid response, which may lead to reinforce one of the natural or anthropogenic barriers, which will cut-off or slow down the spillover mechanism [21]. From the practical point of view, information about new pathogens should be implemented during the planning of long-term forestry and municipal greenery projects. Monitoring of IAS’s sanitary conditions seems like an indispensable action to avoid uncontrolled and rapid spread of new pathogens in a human-changed environment.

Acknowledgements

This work was supported by the Wrocław University of Environmental and Life Sciences (Poland) as part of the Ph.D. research program “Innovative Scientist”, No N060/0005/22 (recipient K.P.). P.C., M.O.K. and M.P. were supported by statutory funds of the W. Szafer Institute of Botany, Polish Academy of Sciences.

Data availability

Dried specimens (holotype, isotype and other specimens) are have been stored in the publicly available fungal collection of the W. Szafer Institute of Botany, Polish Academy of Sciences, Kraków (cal5b = KRAM F-59692 (dried culture), KRAM F-59693 (material in planta); cal4b = KRAM F-59694 (dried culture), KRAM F-59695 (material in planta); KJN2 = KRAM F-59696 (dried culture)). Sequences obtained in the present study have been deposited in the GenBank NCBI nucleotide sequence database (www.ncbi.nlm.nih.gov/genbank) in following accession numbers: col5b = CBS; GenBank sequences: ITS = OP514720, act = OP536817, chs-1 = OP524187, gapdh = OP524190, tub2 = OP524184; KJN2 = ITS = OP514721, act = OP536818, chs-1 = OP524188 , gapdh = OP524191, tub2 = OP524185; col4b = CBS; GenBank sequences: ITS = OP514722, act = OP536819, chs-1 = OP524186, gapdh = OP524189, tub2 = OP524183.

Author contributions

KP: conceptualization, project administration, investigation - field work, fungal analysis, morphological analyses, writing; PC: investigation - morphological analyses, phylogenetic analyses, visualization, writing - review & editing; ABC: investigation - genetical analysis, writing; MOK: phylogenetic analyses, writing; WP: conceptualization, investigation - field work; KN: writing - review & editing; MP: conceptualization, investigation - morphological analyses, phylogenetic analyses, visualization, writing.

Najberek, K. & Solarz, W. Gatunki obce. Przyczyny inwazyjnych zachowań i sposoby zwalczania. Kosmos 65(1), 81–91 (2016).
Hulme, P. E. Phenotypic plasticity and plant invasions: is it all Jack?. Funct. Ecol. 22(1), 3–7 (2008).
Jeschke, J. M. General hypotheses in invasion ecology. Divers. Distrib. 20, 1229–1234 (2014).
Pimentel, D. et al. Economic and environmental threats of alien plant, animal, and microbe invasions. Agric. Ecosyst. Environ. 84, 1–20 (2001).
Vilà, M. et al. How well do we understand the impacts of alien species on ecosystem services? A pan-European, cross-taxa assessment. Front. Ecol. Environ. 8, 135–144 (2010).
Keller, R., Geist, J., Jeschke, J. M. & Kühn, I. Invasive species in Europe: ecology, status, and policy. Environ. Sci. Eur. 23, 23 (2011).
Bellard, C., Cassey, P. & Blackburn, T. M. Alien species as a driver of recent extinctions. Biol. Lett. 12, 20150623 (2016).
Diagne, C. et al. High and rising economic costs of biological invasions worldwide. Nature 592, 571–576 (2021).
Yang, Q. et al. The global loss of floristic uniqueness. Nat. Commun. 12, 7290 (2021).
Lymbery, A. J., Morine, M., Kanani, H. G., Beatty, S. J. & Morgan, D. L. Co-invaders: the effects of alien parasites on native hosts. Int. J. Parasitol.: Parasites Wildl. 3, 171–177 (2014).
Najberek, K. et al. Invasive alien species as reservoirs for pathogens. Ecol. Indic. 139, 108879 (2022).
Elton, C. S. The Ecology of Invasions by Animals and Plants. (Methuen, 1958).
Maron, J. L. & Vilà, M. When do herbivores affect plant invasion? Evidence for the natural enemies and biotic resistance hypotheses. Oikos 95(3), 361–373. (2001).
Keane, R. M. & Crawley, M. J. Exotic plant invasions and the enemy release hypothesis. Trends Ecol. Evol. 17(4), 164–170 (2002).
Blackburn, T. M. & Ewen, J. G. Parasites as drivers and passengers of human-mediated biological invasions. EcoHealth 14, 61–73 (2017).
Strauss, A., White, A. & Boots, M. Invading with biological weapons: the importance of disease-mediated invasions. Funct. Ecol. 26, 1249–1261 (2012).
Migliorini, D. et al. Metabarcoding reveals southern hemisphere fungal endophytes within wood of cultivated Proteaceae in Portugal. Eur. J. Plant Pathol. 160, 173–184 (2021).
Alexander, K. et al. The Ecology of Pathogen Spillover and Disease Emergence at the Human-Wildlife-Environment Interface in The Connections Between Ecology and Infectious Disease, Advances in Environmental Microbiology (ed. Hurst, C. J.) (Springer 2018).
Becker, D. J. et al. Dynamic and integrative approaches to understanding pathogen spillover. Philos. Trans. R. Soc. B Biol. Sci. 374, 20190014 (2019).
Solarz, W. & Najberek, K. Alien parasites may survive even if their original hosts do not. EcoHealth 14, 3–4 (2017).
Sokolow, S. H. et al. Ecological interventions to prevent and manage zoonotic pathogen spillover Phil. Trans. R. Soc. B 374, 20180342 (2019).
Kiss, L. et al. Spread of the North American snowberry powdery mildew fungus, Erysiphe symphoricarpi (syn. Microsphaera symphoricarpi), to Europe. Mycol. Res. 106(9), 1086–1092 (2002).
Zimmermannová-Pastirčaková, K., Adamska, I., Błaszkowski, J., Bolay, A. & Braun U. Epidemic spread of Erysiphe flexuosa (North American powdery mildew of horse-chestnut) in Europe. Schlechtendalia 8, 39–45 (2002).
Ale-Agha, N. et al. Erysiphe catalpae and Erysiphe elevata in Europe. Mycol. Prog. 3, 291–296 (2004).
Bolay, A. et al. Erysiphe deutziae - a new epidemic spread in Europe. Cryptogam., Mycol. 26(4), 293–298 (2005).
Pastirčaková, K. et al. Global distribution of Erysiphe platani: new records, teleomorph formation and re-examination of herbarium collections. Cryptogam., Mycol. 35, 163–176 (2014).
Tokarska-Guzik, B. The establishment and spread of alien plant species (kenophytes) in the flora of Poland. (Wydawnictwo Uniwersytetu Śląskiego, 2005).
Dajdok, Z. & Pawlaczyk, P. Inwazyjne gatunki roślin ekosystemów mokradłowych Polski (Wydawnictwo Klubu Przyrodników, 2009).
Tokarska-Guzik, B. et al. Rośliny obcego pochodzenia w Polsce (GDOŚ, 2012).
Chmura, D., Chmiel, J. & Danielewicz, W. Acer negundo L. – species information sheet. GDOŚ www.projekty.gdos.gov.pl/igo (2018)
Chmura, D., Chmiel, J. & Danielewicz, W. Survey assessing the degree of invasiveness of Acer negundo L. in Poland, based on the protocol Harmonia+PL – procedure for negative impact risk assessment for invasive alien species and potentially invasive alien species in Poland. GDOŚ www.projekty.gdos.gov.pl/igo (2018)
Ruszkiewicz-Michalska, M. et al. Preliminary studies of fungi in the Biebrza National Park (NE Poland ). I. Micromycetes. Acta Mycol. 47, 213–234 (2012).
Sałata, B. Flora Polska. Grzyby (Mycota) 15: Ascomycetes, Erysiphales. (Państwowe Wydawnictwo Naukowe, 1985).
Patejuk, K., Baturo-Ciésniewska, A., Najberek, K. & Pusz W. First report of Fusarium lateritium causing shoot dieback of Acer negundo in Europe. Plant Dis. 106, 1519 (2022).
Trajber, D. Porocilo o pojavu skodlijivih dejavnikov zive in nezive narave v gazdu. Nivo: GGO Murska Sobota, za obdobje 01.01.2015 do 21.12.2015 - porocevalska, prognosticno-diagnosticno sluzba za gozdove (2016).
Li, M., Dai, Y., Li, H., Zheng, Z. & Chen, F. First report of Fusarium solani causing stem canker of Acer negundo in China. Plant Dis. 104, 3263–3263 (2020).
Demirci, F. & Maden, S. A severe dieback of box elder (Acer negundo) caused by Fusarium solani (Mart.) Sacc. in Turkey. Australas. Plant Dis. Notes 1, 13 (2006).
Zhao, X., Li, H., Zhou, L., Chen, F. & Chen, F. Wilt of Acer negundo L. caused by Fusarium nirenbergiae in China. J. For. Res. 31, 2013–2022 (2020).
Anonymous. Index of plant diseases in the United States. U.S.D.A. Agric. Handb. 165, 1–531 (1960).
Phoulivong, S. et al. Colletotrichum gloeosporioides is not a common pathogen on tropical fruits. Fungal Divers. 44, 33–43 (2010).
Weir, B.S., Johnston, P.R., Damm, U. The Colletotrichum gloeosporioides species complex. Stud. Mycol. 73, 115–180 (2012).
Marin-Felix, Y. et al. Genera of phytopathogenic fungi: GOPHY 1. Stud. Mycol. 86, 99–216 (2017).
Talhinhas, P. & Baroncelli, R. Colletotrichum species and complexes: geographic distribution, host range and conservation status. Fungal Divers. 110, 109–198 (2021).
Hyde, K. D. et al. Colletotrichum: a catalogue of confusion. Fungal Divers. 39, 1–17 (2009).
Cannon, P. F., Damm, U., Johnston, P. R. & Weir, B. S. Colletotrichum - current status and future directions. Stud. Mycol. 73(1), 181–213 (2012).
Cai, L. et al. A polyphasic approach for studying Colletotrichum. Fungal Divers. 39, 183–204 (2009).
Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402 (1997).
Liu, F. et al. Updating species diversity of Colletotrichum, with a phylogenomic overview. Stud. Mycol. 101, 1–56 (2022).
Whitaker, B. K., Reynolds, H. L. & Clay, K. Foliar fungal endophyte communities are structured by environment but not host ecotype in Panicum virgatum (switchgrass). Ecology 99 (12), 2703–2711 (2018).
DeMers, M. & May, G. Habitat-scale heterogeneity maintains fungal endophyte diversity in two native prairie legumes. Mycologia 113(1), 20–32 (2021).
Katoh, K., Kuma, K., Toh, H. & Miyata, T. MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 33, 511–518 (2005).
Ronquist, F. et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61, 539–542 (2012).
Bhunjun, C. S. et al. Investigating species boundaries in Colletotrichum. Fungal Divers. 107, 107–127 (2021).
Jayawardena, R. S., Bhunjun, C. S., Hyde, K. D., Gentekaki, E. & Itthayakorn, P. Colletotrichum: lifestyles, biology, morpho-species, species complexes and accepted species. Mycosphere 12(1), 519–669 (2021).
Farr, D. F., Aime, M. C., Rossman, A. Y. & Palm, M. E. Species of Colletotrichum on Agavaceae. Mycol. Res. 110, 1359–1408 (2006).
Nakamura, M., Ohzono, M., Iwai, H. & Arai, K. Anthracnose of Sansevieria trifasciata caused by Colletotrichum sansevieriae sp. nov. J. Gen. Plant Pathol. 72, 253–256 (2006).
Crous, P. W. et al. Fungal Planet description sheets: 154-213. Persoonia. 31, 188–296 (2013).
Crous, P. W. et al. Fungal Planet description sheets: 320–370. Persoonia 34, 167–266 (2015).
Crous, P. W. et al. Fungal Planet description sheets: 400–468. Persoonia 36, 316–458 (2016).
Damm, U., Cannon, P. F., Woudenberg, J. H. C. & Crous, P. W. The Colletotrichum acutatum species complex. Stud. Mycol. 73, 37–113 (2012).
Damm, U. et al. The Colletotrichum boninense species complex. Stud. Mycol. 73, 1–36 (2012).
Kee, Y. J., Zakaria, L. & Mohd, M. H. Identification, pathogenicity and histopathology of Colletotrichum sansevieriae causing anthracnose of Sansevieria trifasciata in Malaysia. J. Appl. Microbiol. 129(3), 626–636 (2020).
Aldaoud, R., DeAlwis, S., Salib, S., Cunnington, J.H. & Doughty, S. First record of Colletotrichum sansevieriae on Sansevieria sp. (mother-in-law’s tongue) in Australia. Australas. Plant Dis. Notes 6, 60–61 (2011).
Palmateer, A. J., Tarnowski, T. L. B. & Lopez, P. First report of Colletotrichum sansevieriae causing anthracnose of Sansevieria trifasciata in Florida. Plant Dis. 96(2), 293 (2012)
Park, J. H., Han, K. S., Kim, J. Y. & Shin, H. D. First report of anthracnose caused by Colletotrichum sansevieriae on Sansevieria in Korea. Plant Dis. 97(11), 1510 (2013).
Karimi, O., Ghanbari, M. A. T., Bagherabadi, S., Amirabad, Y. M. First report of Colletotrichum sansevieriae causing anthracnose on Sansevieria trifasciata in Iran. J. Plant Pathol. 99(1), 302–302 (2017).
Schmid-Hempel, P. Evolutionary parasitology. The integrated study of infections, immunology, ecology, and genetics (Oxford University Press, 2011).
White, T.J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics in PCR Protocols: A Guide to Methods and Applications; (ed. Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J.) 315–322 (Academic Press, 1990)
Carbone, I. & Kohn, L.M. A method for designing sets for speciation studies in filamentous ascomycetes. Mycologia 91, 553–556 (1999).
Templeton, M., Rikkerink, E., Solon, S., Crowhurst, R.. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene 122(1), 225–230 (1992).
Glass N.L. & Donaldson G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 61, 1323–1330 (1995).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Colletotrichum acericola sp. nov. from seeds of invasive alien Acer negundo in Poland: delayed pathogen introduction after its host appearance?

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Isolates

Morphological analyses

DNA isolation, amplification, and sequencing

Phylogenetic analyses

Results

Phylogenetic analyses

Taxonomy

Discussion

Declarations

References

Additional Declarations

Status:

Version 1