KIAA1429 regulates the expression of RAB27B in a m6A  YTHDF1 axis-dependent manner and promotes the progression of chronic myeloid leukemia, serving as a potential therapeutic target

doi:10.21203/rs.3.rs-2072636/v1

Download PDF

Research Article

KIAA1429 regulates the expression of RAB27B in a m6A YTHDF1 axis-dependent manner and promotes the progression of chronic myeloid leukemia, serving as a potential therapeutic target

https://doi.org/10.21203/rs.3.rs-2072636/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Chronic myeloid leukemia (CML) is one of the most common adult leukemias. The considerable negative changes in its acute phase and the adverse drug effects could lead to poor prognosis. N6-methyladenine (m6A) modification plays an important regulatory role in physiological and pathological processes. KIAA1429 is an important m6A regulator, but the biological role of KIAA1429 in CML is still unclear.

Methods: RT-qPCR and Western blot were used to analyze the differential expression of KIAA1429 in CML clinical samples and cell lines. CCK-8, EdU staining, flow cytometry, Transwellassay, cellular morphology evaluation, and liquid chromatography-mass spectrometry (LC-MS) were further implemented to assess the changes in the biological functions of CML cell lines with KIAA1429 knockdown or overexpression. In addition, subcutaneous tumorigenesis experiment in nude mice was performed for in vivo function assessment. The combination of MeRIP-seq and mRNA-seq predicted that RAB27B is a downstream target gene of KIAA1429. RIP-qPCR, RNA stability analysis, SELECT, and “rescue” experiments were then conducted to explore the mechanisms underlying the regulation of KIAA1429/m6A/YTHDF1 axis on RAB27B. Finally, the inhibitory effects of rucaparib on KIAA1429 and CML were explored in vitro and in vivo.

Results: The m6A and KIAA1429 expression was significantly upregulated in patients with blast phase CML. KIAA1429 was found to regulate the total level of RNA m6A modification in the CML cells and to promote the malignant biological behaviors of CML cells, including proliferation, migration, and imatinib resistance. Inhibiting KIAA1429 in CML cells regulated the stability of RAB27B mRNA through the m6A/YTHDF1 axis, consequently inhibiting CML proliferation and drug efflux, and ultimately increasing cell sensitivity to imatinib. Rucaparib suppressed the expression of KIAA1429 and CML cell proliferation, and promoted cell apoptosis. The combined use of rucaparib and imatinib enhanced the sensitivity of CML cells to imatinib. Rucaparib inhibited the tumorigenesis capability of CML cells in vivo.

Conclusions: Elevated KIAA1429 expression in the blast phase of CML enhanced the stability of RAB27B mRNA through the m6A/YTHDF1 axis to upregulate RAB27B expression, and thus promoting CML progression. Therefore, rucaparib exerts inhibitory effects on KIAA1429 expression and CML progression.

Chronic myeloid leukemia

N6-methyladenine

KIAA1429

RAB27B

YTHDF1

rucaparib

Chronic myeloid leukemia (CML) is a malignant clonal myeloproliferative disorder originating from myeloid pluripotential hematopoietic stem cells^[1]. This disease is manifested mainly by the abnormal proliferation of mature myeloid cells and accounts for approximately 20% of all adult leukemias. The characteristics of CML is the formation of Philadelphia (Ph) chromosome caused by t(9;22) translocation, which encodes Bcr/Ab11 fusion protein, an oncoprotein with high tyrosine kinase activities that been considered as the molecular basis of CML development^{[2, 3]}. The natural course of CML consists of three phases: chronic phase (CP), accelerated phase (AP), and blast crisis (BC). Patients with CML that had progressed into BP have extremely poor prognoses^[4]. Tyrosine kinase inhibitors (TKIs), represented by imatinib, are targeted therapy drugs for CML with high clinical effectiveness^[5]. Unfortunately, however, approximately 25% of patients could develop drug resistance or have poor drug responsivity^{[6, 7]}. The acute phase changes of CML and TKIs resistance are still the major challenges for achieving treatment-free remission (TFR) in CML patients.

In recent years, the advances of epigenetics in molecular targeting therapy of tumors have provided novel routes for the treatment of CML. N⁶-methyladenine (m⁶A) modification is the methylation modification of the sixth nitrogen atom of RNA base adenine (A), which is one of the most common modifications of mRNA in eukaryotes^{[8, 9]}. m⁶A is jointly, reversely, and dynamically regulated by methyltransferases^[10], demethylases^[11], and reader proteins^[12]. Methyltransferases add the m⁶A modification to transcripts, whereas demethylases remove the m⁶A modification from transcripts, which are then recognized by reader proteins that exert different effects^[13]. M⁶A modification is important for maintaining the metabolism, stability, splicing, and translation of mRNA. M⁶A participates in various physiological and pathological processes in tumor development, reproduction, and biological rhythm^{[14, 15]}. Accumulating evidence has shown that m⁶A modification regulates the proliferation, differentiation, and metabolism of hematopoietic stem cells and leukemia cells^[16–18], and influences the sensitivity of leukemia cells to chemotherapy drugs^{[19, 20]}. KIAA1429 is one of the major components of the m⁶A methyltransferase complex that mediates the m⁶A modification of coding and non-coding RNA^[21]. KIAA1429 promotes the development of various cancers^[22–25], such as breast, liver, and gastric cancers, and is closely associated with poor prognoses. However, the role of KIAA1429 in CML is still unclear and needs to be further investigated.

In this study, we examined the role and underlying mechanisms of KIAA1429 in the progression of CML and drug resistance, and established that the KIAA1429/m⁶A/YTHDF1 axis upregulated the expression of RAB27B through increasing the stability of RAB27B mRNA. Additionally, it played an important role in the progression of CML, which was found by using transcriptome sequencing and RIP-qPCR. This study aimed to explore the epigenetic mechanisms in the progression of CML, and assess the potential value of KIAA1429 as a highly promising treatment target.

Patients and samples

Peripheral blood mononuclear cells (PBMCs) were collected from the specimens of a total number of 40 CML-CP and 18 CML-BC patients, who were admitted to the First/Second Affiliated Hospital of Nanchang University from 2018-01-01 to 2021-6-30. All patients were in line with the diagnosis of CML chronic phase or CML blast phase, as specified in the "The guidelines for diagnosis and treatment of chronic myelogenous leukemia in China (2020 edition)". The patients with the CML chronic phase were all first-diagnosed cases and had not received any anti-tumor therapy. All included subjects were informed about the study, and the study protocol was reviewed and approved by the hospital ethics committee.

Cell culture and transfection

Human chronic myeloid leukemia cell lines K562 and KCL22 were purchased from the American Type Culture Collection (ATCC), and the K562 imatinib-resistant strain K562/G01 was donated by the School of Laboratory Medicine, Chongqing Medical University (Chongqing, China). The culture conditions maintained in an incubator were as follows: 37 °C, 5% CO_2,and saturated humidity. The culture medium consisted of 10% fetal bovine serum (Gibco, USA), 100 U/mL penicillin (Solarbio, China), 100 U/mL streptomycin (Solarbio, China) RPMI-1640 (Gibco, USA). IM (Apexbio, USA) was used at a final concentration of 1 μM. Rucaparib (MCE, USA) was diluted to 100 nM in DMSO. Overexpression cell lines were constructed using the KIAA1429 (NM_015496.4) overexpression plasmid (Hanbio, China), and silencing cell lines were constructed using a lentivirus containing KIAA1429/RAB27B/YTHDF1 shRNA (Genechem, China) (Table 1).

Quantitative real‑time PCR

Total RNA was extracted by using Trizol reagent (Invitrogen, USA). First-strand cDNA was synthesized with the PrimeScript™ Reverse Transcriptase kit (Takara, Japan) and random primers. Real-time quantitative PCR was performed with a TB Green® Premix EX TaqTMⅡqPCR Master Mix (Takara, Japan). All reactions were run in triplicate on the Applied Biosystems 7500 Real-Time PCR System. GAPDH were applied as endogenous control. The relative expression was calculated using the comparative Ct (2^-ΔΔCT) method. The sequences of the primers are listed in Table 2.

Western blot

Cells were lysed in RIPA lysis buffers (Applygen, China). The protein concentration was detected with a bicinchoninic acid (BCA) kit (Tiangen, China). During electrophoresis, 40 ng of protein was added to each well on 8% SDS-PAGE. The proteins in the gel were then transferred onto PVDF membranes (Millipore, Germany). The membranes were blocked with 5% nonfat milk and incubated for 2 h at room temperature. Anti-GAPDH primary antibody was added (#2218S, Cell Signaling Technology, 1:1000), anti-KIAA1429 (#51104, CST, 1:1000), anti-RAB27B (AO0173, Boster, 1:1000), anti-YTHDF1 (#51104, CST, 1:1000), followed by overnight incubation at 4 °C. Secondary antibody (Anti-Rabbit, 7074S, CST, 1:5000) was added, followed by incubation for 2 h at room temperature. Finally, blots were detected using an enhanced chemiluminescence kit (Thermo, USA) and analyzed by a Bio-Rad Western Blot Imaging System (Bio-Rad, Berkeley, CA, USA).

Cell proliferation assay

The proliferation ability of each cell line was examined using the Cell Counting Kit-8 (Hambio, China), following the manufacturer’s instructions. Briefly, 100 μL of 1×10⁵/mL cells were seeded into 96-well plates. The cells were then cultured in a cell incubator. A volume of 10 μLof CCK-8 solution was added into each well 0, 12, 24, and 48 h later. Following incubation at 37 °C for another 2 h, the OD values at 450 nm were measured using a microplate reader (PERLONG, China).

EDU assay

Cell proliferation was detected by EdU staining. According to the instructions of the reagent (RIBOBIO, China), 1×10⁶ cells in logarithmic growth phase were taken and incubated with EdU solution diluted 1:1000 in complete medium for 2.5 h. After fixation in polyformaldehyde at room temperature, each of the samples was decolorized with 2 mg/mL glycine. Apollo staining and Hoechst33342 chamber staining were performed in sequence, and after washing, fluorescence microscopy was used for the determination of cell proliferation.

Flow cytometry

Initially, 1×10⁵cells were collected Then, after washing with pre-cooled PBS, 5 μL of the Annexin V-APC (BD, USA) and 5 μL of 7-AAD staining solution were added into each of the tubes, followed by incubation in the dark for 10 min at room temperature. After adding binding buffer, flow cytometry analyses were performed within an hour using a BD FACS Calibur Flow Cytometer (BD, San Diego, CA, USA).

Migration assays

Transfected cell lines were starved in serum-free medium for 24 h. Cells were added to Transwell chambers at a density of 1 x 10⁶/mL. After 48 h of culture, the chamber was taken out, immersed in 4% paraformaldehyde for 30 min, and stained with 0.1% crystal violet for approximately 30 min. The cells were washed with PBS, and cell migration was determined by counting under an inverted microscope.

RNA stability detection

The cells in the logarithmic growth phase were resuspended to 1×10⁵/mLin serum-free medium, and 5 μg/mL actinomycin D was added. Each group of cells was transferred into four parallel wells, corresponding to four time points. The cells were collected after 0, 2, 4, and 6 h of incubation at a constant temperature in a cell incubator. Total mRNA was extracted from each group of cells by the Trizol method, and the target gene expression was detected by RT-qPCR. Further, results curves were drawn to observe the mRNA expression changes in different target genes, and the degradation rates were compared to establish mRNA stability.

Total RNA m⁶A modification level

According to the manufacturer’s instructions and treated with gDNA wiper mix (Vazyme, China). PolyA⁺ mRNA was purified using Dynabeads^TM mRNA Purification Kit (Invitrogen, USA). EpiQuik m⁶A RNA Methylation Quantification Kit (Colorimetric) (Epigentek, USA) was utilized to measure the global m⁶A levels in mRNA following the manufacturer’s protocol. 200 ng polyA⁺ mRNA was used per each sample analysis.

mRNA sequencing

Total RNA was extracted from K562 cells silenced by KIAA1429, and the samples of the control group were subjected to extraction with TRIzol reagent. The library preparations were sequenced by Seqhealth technology Co., Ltd. (Wuhan, China). Gene ontology terms were considered significantly differentially expressed if adjusted P < 0.05 and the fold-change >1.

RNA immunoprecipitation qPCR

RIP measurements were conducted using the Magna RIP kit (Millipore, MA, USA). K562 cells were lysed with the RIP Lysis Buffer. Next, the RIP lysate supernatant and the specific antibody were incubated overnight on protein A/G magnetic beads at 4 ℃. After washing, total RNA was extracted with TRIzol, and quantitative RT-qPCR analysis was performed.

Liquid chromatography-mass spectrometry (LC-MS)

Imatinib concentrations were detected by LC-MS. After the cells were treated with imatinib for 48 h, the medium was replaced and cultured for 24 h, and the extracellular and intracellular fluids were collected. The internal standard solution was diluted 100 times with methanol to prepare a precipitant. Next, the sample was aspirated into a centrifuge tube, and the precipitant containing the internal standard was added. Further, the tube was vortex-centrifuged, and the supernatant was collected and diluted with purified water, followed by chromatographic analysis. Meanwhile, quantitative processing of sample data, using internal standard method and multi-point calibration curve quantification, was also conducted.

SELECT detection

Total RNA, polyA-RNA, or synthesized RNA oligos were mixed with primers and dTTP in CutSmart buffer. The RNA and primers were annealed by an incubating mixture at a temperature gradient: 90 °C for 1 min, 80 °C for 1 min, 70 °C for 1 min, 60 °C for 1 min, 50 °C for 1 min, and then 40 °C for 6 min. Subsequently, a mixture containing DNA polymerase, SplintR ligase, and ATP was added into the former mixture. The final reaction mixture was incubated at 40 °C for 20 min, denatured at 80 °C for 20 min, and kept at 4 °C. Afterwards, quantitative real-time PCR (qPCR) reaction was performed. qPCR was run under the following conditions: 95 °C for 5min; (95 °C, 10s; 60 °C, 35s) × 40 cycles; 95 °C for 15 s; 60 °C for 1 min; and 95 °C, for 15 s; 4 °C. Data were analyzed with QuantStudioTM Real-Time PCR Software v1.3.

In vivo study

Female BALB/C-nu mice were selected as subcutaneous tumor-forming experimental animals. K562 cells (1×10⁶) were suspended in 100 μL of normal saline and mixed with an equal volume of Matrigel. This mixture was subcutaneously injected into the right armpit skin of 4-week-old mice. Tumor size measurements were initiated on the day of inoculation. The tumor size was calculated using the formula 0.5 × (long diameter) × (short diameter)². In the toxicity experiment, nude mice were given 50 mg/kg/d rucaparib via intragastric administration; the control group was fed with an equal volume of normal saline. One week later, the mice were anesthetized, sampled, and killed. In our drug trials, we first used BALB/ C nude mice to create subcutaneous tumorigenesis models. When the tumor volume increased to 100 mm³(±20%), rucaparib was given via intragastric administration at 50 mg/kg/d; meanwhile, the control group was given the same volume of normal saline. After 2-4 weeks, the mice were anesthetized, sampled, and killed. All animal experiments were approved by the Animal Protection and Use Committee of the Second Affiliated Hospital of Nanchang University (Nanchang, China).

Statistical analysis

Statistical analysis was performed using GraphPad Prism7.0 statistical software (San Diego, CA, USA). The values of the results are expressed as mean ± SEM of at least three independent experiments. Data were analyzed using Student’s t-test and ANOVA. P-values < 0.05 were considered to indicate statistically significant differences.

KIAA1429 expression in CML-BC patients is upregulated.

The expression of m⁶A related methyltransferase KIAA1429 is dysregulated in a variety of tumors (Fig. S1a) and is closely related to tumor progression and poor prognosis (Fig. S1b). Importantly, it is a key regulator of m⁶A modification (Fig. S1c). To explore the function of KIAA1429 in CML, the expression data of 16 cancers, documented in the Human Protein Atlas (HPA) database, were analyzed. The findings showed that in comparison with other cancers, the expression of KIAA1429 in CML cell line K562 was the highest (Fig. 1a). In addition, of all human tissues, bone marrow had the highest expression of KIAA1429 (Fig. S1d). Our team also analyzed the sequencing data in CML patients (GSE100026). Our findings showed that compared with CML-CP, the expression of m⁶A writer KIAA1429 in CML-BC was upregulated (Fig. 1b). The m⁶A modification level and KIAA1429 expression were measured in 40 patients with CML-CP and 18 patients with CML-BC included in this study. We found that the total m⁶A modification level (Fig. 1c) of KIAA1429 expression (Fig. 1d and e) (Fig. S1e) was significantly more upregulated in the CML-BC group than that in the CML-CP group, indicating that KIAA1429 could be associated with CML progression.

Imatinib is a first-line drug for the treatment of CML, and the progression of CML is generally associated with imatinib resistance. Therefore, the levels of m⁶A modification level and KIAA1429 expression were measured in the CML cell lines K562 and KCL22, as well as in the imatinib-resistant K562 cell line (K562/G01). The results obtained revealed that compared with the K562 and KCL22 cells, the total m⁶A modification level (Fig. 1f), as well as the mRNA and protein levels of KIAA1429 (Fig. 1g and h) were significantly upregulated in K562/G01 cells. In summary, KIAA1429 could upregulate the m⁶A modification to increase the imatinib resistance and promote tumor progression in CML.

KIAA1429 expression upregulation promoted the transformation of the malignant biological characteristics of CML cells.

To investigate the biological effects of KIAA1429 in CML, a KIAA1429 overexpression plasmid Lv-KIAA1429 was constructed and used to transfect CML cell lines (K562, K562/G01, and KCL22) (Fig. 2a and b). Our results showed that the total m⁶A modification level in the CML cells the of Lv-KIAA1429 group was significantly higher than that in the cells of the control group (Lv-NC) (Fig. 2c). KIAA1429 overexpression enhanced the proliferation and migration capabilities of CML cells (Fig. 2d, e, and g), while the cell apoptosis rate decreased (Fig. 2f). The Wright-Giemsa staining of cells before and after the overexpression revealed a lower number of primitive cells in the overexpressed cell lines than in the cells without KIAA1429 overexpression. In addition, the percentages of promyelocytes and myelocytes were increased, and the morphological characteristics were similar to the bone marrow characteristics of transformation from chronic phase to acute phase (Fig. 2h). The half-inhibitory concentration (IC50) assay showed that the resistance to Imatinib of K562/G01 cells was significantly upregulated (Fig. 2i), indicating that the increased expression of KIAA1429 could be associated with the imatinib resistance of CML cells. In summary, these findings showed that elevated expression of KIAA1429 reduced the sensitivity of CML cells to imatinib and inhibited the differentiation of CML cells, which could be a potential mechanism underlying the acute transformation of CML.

Knocking down KIAA1429 expression inhibited the transformation of malignant biological characteristics of CML cells.

The effect of KIAA1429 knockdown on CML progression was further investigated. First, a stable cell line of CML with KIAA1429 knockdown (Sh-KIAA1429) was constructed (Fig. 3a and b). In contrast to the overexpression, the KIAA1429 knockdown reduced the total level of RNA m⁶A modification in CML cells (Fig. 3c). CML cell proliferation was inhibited (Fig. 3d and e), cell apoptosis was increased (Fig. 3f), and cell migration was suppressed (Fig. 3g). Cell morphological observation showed that the KIAA1429 knockdown increased the percentage of lobulated or stab-nuclear cells, and the cells were stabilized in the chronic phase (Fig. 3h). Moreover, KIAA1429 knockdown significantly inhibited the Imatinib resistance of K562/G01 cells (Fig. 3i). These findings demonstrated that KIAA1429 knockdown could inhibit the malignant transformation of biological characteristics of CML.

RAB27B is the downstream target gene of KIAA1429

KIAA1429 is the critical enzyme of m⁶A methylation modification, the dysregulation of which induces the activation of relevant cancer pathways. In this study, the KIAA1429 expression was knocked down by shRNA in K562 cells, and K562-Sh1 and K562 cells were subjected to mRNA-seq analysis. Screening was then performed using |logFC| > 1 and P-value < 0.05 as the criteria, which retrieved 1587 differential expression genes (DEG) (Fig. 4a) (Fig. S2a and S2b). To clarify the association between DEGs and m⁶A modification, the KIAA1429 related MeRIP-seq data in the m6a2target database (http://m6a2target.canceromics.org/#/perturbation) was differentially analyzed (|logFC| > 1 and P-value < 0.05), and retrieved 1499 m⁶A related DEGs. OVERLAP analysis was performed for the two groups of DEGs, and 120 co-expressed DEGs (cDEGs) were identified (Table S1, Fig. 4b). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were performed for cDEGs, which showed the biological functions of the genes were mainly enriched in various aspects, including enzyme activity inhibitor, focal adhesion, and exocytosis (Fig. 4c). Network analysis of protein-protein interaction (PPI) (https://cn.string-db.org/) showed that RAB27B is the Hub gene of the network (Fig. S2c), indicating that RAB27B could be a potential key target gene regulated by KIAA1429. RT-qPCR analysis showed that the expression of RAB27B mRNA in K562/G01 cells was significantly higher than in K562 and KCL22 cells (Fig. 4d); while in K562 cells with KIAA1429 knockdown, RAB27B level also decreased with the reduction of KIAA1429 level (Fig. 4e and 4f). In clinical samples of CML, the expression of RAB27B mRNA was significantly higher in the CML-BC group than in the CML-CP group (Fig. 4g), which was significantly positively associated with KIAA1429 (r = 0.338, P = 0.010) (Fig. 4h). These findings evidenced that RAB27B could be an important downstream target gene for KIAA1429.

KIAA1429 regulates RAB27B mRNA stability in m⁶A-dependent manner and could be recognized by YTHDF1

To verify our speculation, RIP-qPCR was utilized to assess the relationship between KIAA1429 and RAB27B. After enrichment by KIAA1429-antibody, the expression of RAB27B mRNA increased significantly, indicating that RAB27B is a downstream mRNA binding to KIAA1429 (Fig. 4j). After the knockdown of KIAA1429, CML cells were treated by actinomycin D. We found that the RAB27B mRNA expression level decreased gradually over time (Fig. 4i), indicating that KIAA1429 regulated the stability of RAB27B mRNA and consequently influenced the expression and function of RAB27B.

The m⁶A methylation sites of RAB27B mRNA were predicted using the SRAMP website (http://www.cuilab.cn/sramp) (Fig. 4k), which showed that five m⁶A modification sites in the sequences of RAB27B mRNA, i.e. A116, A1466, A1508, A1518, A2300, A2981, A3478, A4641, had relatively high possibility of modification (Fig. 4k)(Fig. S2e). The SELECT assay was performed to measure the m⁶A modification levels at the sites before and after knockdown, which showed that after KIAA1429 knockdown, the m⁶A modifications at A1116, A2981, and A3478 sites decreased significantly (Fig. 4l and m) (Fig. S2f), while the modification at other sites did not change significantly, indicating that KIAA1429 knockdown downregulates the m⁶A modification level at these sites.

Previous studies have revealed that m⁶A reader proteins could recognize the information of m⁶A modification in mRNA of transcripts and consequently regulate the expression of target mRNA, influencing the biological processes in cancer. To further explore the molecular mechanisms of RAB27B m⁶A modification, the relevant reader proteins were searched by bioinformatics measurements. Of the various m⁶A reader proteins, YTHDF1 was positively correlated with the levels of RAB27B mRNA (GEO: GSE100026) (Fig. 4n), indicating that YTHDF1 could be a key reader protein of RAB27B.

This finding was further confirmed by in vitro experiments. The K562 sh-YTHDF1 cells were successfully constructed by using a lentivirus (Fig. 4p). Our results showed that after knockdown of YTHDF1 in cells, the mRNA and protein levels of RAB27B also decreased correspondingly (Fig. 4q and 4r), and the stability of RAB27B mRNA also decreased (Fig. 4o). RIP-qPCR findings showed that RAB27B mRNA could be abundantly enriched by YTHDF1 protein, and thus influence the stability of RAB27B mRNA (Fig. 4s). These findings indicated that YTHDF1 could bind to RAB27B mRNA in CML cells.

Inhibiting RAB27B expression rescued the promotion effects of KIAA1429 on CML cell proliferation and drug resistance

Previous studies have shown that RAB27B could regulate cell signaling transduction and exosome release, and thus influence tumor proliferation and drug resistance. However, the role of RAB27B in CML is still unclear. To clarify the biological functions of RAB27B, the lentivirus of RAB27B knockdown was used to transfect K562 and K562/G01 cells, as well as KIAA1429 overexpression cells (Fig 5a and 5b). The results we obtained revealed that after the knockdown of RAB27B, the proliferation capability of K562, K562/G01, and KIAA1429 overexpression cells decreased (Fig. 5c and 5d), while KIAA1429 overexpression partially rescued the inhibitory effects of RAB27B knockdown on cell proliferation capability. Cells were arrested in the S phase after RAB27B knockdown (Fig. 5e). Pathway array results showed that the expression levels of genes associated with S cell phase, such as ABL1 and MCM2, were lower, whereas those of negative regulation genes, such as CDKN2B and TP53, were higher (Fig. 5f). RAB27B knockdown induced the upregulation of cell apoptosis and suppressed the inhibitory effects of KIAA1429 overexpression on CML cell apoptosis (Fig. 5g). In addition, RAB27B knockdown increased the sensitivity of K562/G01 cells to imatinib (Fig. 5h), while KIAA1429 overexpression enhanced the resistance of the cells with RAB27B knockdown to the drug. To verify whether the drug resistance of CML cells was associated with RAB27B mediated drug transportation, K562/G01 cells in Sh-NC group and sh-RAB27B group were treated by 2 µmol/L imatinib for 48 h, and then culture medium with no imatinib was utilized to further treat cells for 24 h. Afterwards, LC-MS was used to measure the imatinib concentration in the cells and culture medium. As can be seen in Fig. 5i, the level of imatinib in the culture medium was lower, whereas its level in the cells in the Sh-RNA27B group was higher. The obtained findings also showed that the RAB27B knockdown reduced the number of exosomes in the culture medium (Fig. S3). These findings indicated that RAB27B knockdown inhibited the efflux of imatinib in cells, leading to drug enrichment in the cells, which could be associated with the inhibition of the exosome secretion.

Inhibiting KIAA1429 axis inhibited the tumorigenesis capability of CML cell lines in vivo

In vivo experiments were further performed. The K562 cells in the negative-control group, as well as K562 cells with KIAA1429, RAB27B, or YTHDF1 knockdown, were inoculated into BALB/C-nu nude mice. The results showed that the sizes of the tumors in the nude mice inoculated with KIAA1429, RAB27B, or YTHDF1 knockdown cells were smaller than those in the nude mice in the control group (Fig. 5j). Additionally, the tumor growth rate in the former group was lower (Fig. 5k), indicating that the KIAA1429, RAB27B, or YTHDF1 knockdown significantly reduced the tumorigenesis capability of K562 cells. The body weight curve of the nude mice was also used to assess their overall nutrition status. We found that the body weight of the nude mice in the control group was reduced, whereas that of the nude mice in the KIAA1429, RAB27B, and YTHDF1 groups remained stable (Fig. 5l), which was significantly improved compared with that in the control group.

Rucaparib inhibited the KIAA1429 expression and the proliferation and drug resistance of CML cells

Our previous studies have revealed the role of KIAA1429 in promoting the progression of CML. We also aimed to treat CML by targeting this gene. To screen the treatment drugs, the Genomics of Drug Sensitivity in Cancer (GDSC) database and mRNA-seq data were analyzed comprehensively, and IC50 was used to assess the sensitivity of the cells in each group to chemotherapy drugs. The results obtained (Fig. 6a) showed that the KIAA1429 knockdown group had higher IC50 values than those in the ponatinib (P = 0.002), rucaparib (P = 0.026), axitinib group (P = 0.026), and ATRA groups (P = 0.026). These findings indicated that cells with KIAA1429 overexpression are more sensitive to these anti-tumor drugs. Ponatinib, axitinib, and ATRA have already been applied for CML treatment in clinical practice. Thus, in this study, we focused on the treatment with rucaparib.

Interestingly, the 48-h treatment with concentration gradients of rucaparib decreased the cell expression of KIAA1429 mRNA and protein (Fig. 6b and c). The degrees of this reduction were positively associated with drug concentrations, indicating that rucaparib could inhibit the expression of KIAA1429. In addition, rucaparib also suppressed the proliferation of CML cells (Fig. 6d), while the IC50 values of K562 and K562/G01 were 101.3 μM and 87.81 μM (Fig. 6e), respectively. The 48-h rucaparib treatment dose-dependently promoted the apoptosis of CML cells (Fig. 6f). These findings demonstrated that rucaparib suppressed the proliferation and promoted the apoptosis of CML cells. These effects were more pronounced in imatinib-resistant CML cells than in sensitive cells. We further investigated whether rucaparib could enhance the drug resistant CML cells to imatinib. Low concentrations of rucaparib and imatinib of approximately 50% of IC50 were used to treat cells independently or in combination, and then the proliferation and apoptosis of cells were observed. We established that the proliferation of cells in the rucaparib + imatinib group was significantly lower than that in the control, rucaparib, and imatinib groups (Fig. 6g). The apoptosis rate in the rucaparib + imatinib group was significantly higher than those in the other three groups (Fig. 6h). Rucaparib treatment decreased significantly the IC50 of imatinib (Fig. 6i). These findings indicated that the treatment with rucaparib significantly increased the sensitivity of CML cell lines to imatinib.

We further investigated whether rucaparib could be used to treat CML in vivo. Firstly, toxicological experiments in BALB/C-nu mice were performed for verification. The body weight (Fig. 6j), blood routine parameters (Fig. 6k), and biochemical indicators such as ALT and UREA (Fig. 6l) in the treatment group were not significantly different from those in the control group, indicating that this dose of rucaparib exerts no liver or renal toxicity in vivo. No tissue injury or inflammatory lesions were found in the treatment group (Fig. 6m), indicating the high biocompatibility and safety of rucaparib at this dose.

The nude mice models of subcutaneous tumorigenesis models of CML were treated by rucaparib to assess its therapeutic effects. The tumor size (Fig. 6n), weight (Fig. 6o), and growth weight (Fig. 6p) in the treatment group were significantly lower than those in the control group, indicating that rucaparib inhibited the tumorigenesis in the CML cells in vivo, suggesting its potential therapeutic value.

The regulation of BP CML and the resistance to TKIs are current concerns of researchers. Unfortunately, they are still substantial challenges in clinical practice^{[3, 6]}. Previous studies have shown that m⁶A modification plays an important role in the development and progression of human diseases^{[26, 27]}. KIAA1429 is highly expressed in various tumors and is closely associated with tumor progression and poor prognoses of patients^[28]. In this study, we first established that the expression of KIAA1429 was significantly more upregulated in the BP phase of CML than in the CP phase. In addition, the KIAA1429 expression was also more upregulated in the imatinib-resistant K562/G01 cells than in the imatinib-sensitive K562 cells. These results indicate that KIAA1429 is involved in the malignant progression and imatinib resistance of CML cells. Therefore, we are the first to verify that KIAA1429 regulates the total m⁶A modification levels in cells.

In agreement with our findings, Schwartz et al^[29]. previously reported that KIAA1429 knockdown resulted in a four-fold decrease in the peak m⁶A score, which was even more prominent in human cells after METTL3 and METTL14 knockdown. The cell function experiments and in vivo experiments in this study investigated whether KIAA1429 could promote the malignant biological behaviors of CML, enhancing disease development and progression. Previous research has revealed that RAB27B influence the cell signaling transduction and is closely associated with exosomes release^[30–32]. Hence, it plays an important role in the maturation and secretion of zymogen granules^{[33, 34]} and, therefore, could be used as a tumor marker for disease analysis and prognosis prediction^{[35, 36]}. In this study, we were the first to establish that RAB27B expression also played a similar role in CML. The investigation of its underlying mechanisms showed that the processes mediated by KIAA1429 was partially through m⁶A mediation by RAB27B. We further found three m⁶A modification sites, two of which are located in the 3'UTR region, which are related to mRNA stability, and one site is located in the CDS sequence. Considering the mechanism of its regulation, it may also involve translation efficiency. The m⁶A modification ultimately produces an effect through the m⁶A reader protein, and then plays a specific function^[37–39], and we further found and verified that YTHDF1 is the reader protein of RAB27B. More specifically, inhibiting KIAA1429 expression could reduce the m⁶A modification of RAB27B mRNA, which is then recognized by YTHDF1 and reduced the stability of mRNA, decrease the expression of RAB27B, and consequently inhibit the proliferation and drug resistance of CML cells.

The progression, treatment response, and overall clinical outcomes of CML patients are also influenced by the accumulation of the impact of other abnormal genetic and epigenetic factors, not only that of Bcr/Abl1 oncoprotein^{[5, 40, 41]}. Thus, both genetic and epigenetic factors could influence the therapeutic efficacy of CML treatment. Notably, novel targets such as m⁶A modification may play an active role in inhibiting tumor progression and drug resistance ^{[27, 42, 43]}. Previously, several inhibitors of m⁶A regulatory factors have been developed as anti-cancer drugs with positive effects. For instance, STM2457 targets METTL3 and METTLl4, the key components of m⁶A methyltransferase, significantly inhibiting the proliferation, but inducing the differentiation and increasing the apoptosis of leukemia cells^{[19, 44]}. However, STM2457 exerts no significant effects on normal hematopoietic stem or other normal cells. Therefore, we intended to establish approaches for the regulation of the KIAA1429 expression to finally achieve effective CML treatment strategies. The bioinformatics analysis in this study screened four drugs, i.e., ponatinib, rucaparib, axitinib, and ATRA out of 138 anti-tumor drugs. Our further examinations revealed that ponatinib and axitinib are second-generation TKIs that could effectively inhibit the Bcr/Abl1 signaling in CML cells with T315I + complex mutation^[45–47]. ATRA reduces the DNA damage repairing and inhibits the acquiring of Bcr/Abl1 mutation during the treatment of CML, consequently reducing the adaptive drug resistance in CML^{[48, 49]}. These results further verified the reliability of our previous findings on KIAA1429, and suggested that inhibiting KIAA1429 could be a potential effective target for treating CML-BC or such with drug resistance.

We finally focused on another drug, the PARP inhibitor rucaparib, which has not been used for CML treatment yet. The most recent studies have established that a PARP inhibitor could be used singly and/or in combination with cytotoxic, hypomethylation agents, or targeting drugs for the treatment of acute leukemia^{[50, 51]}. Nevertheless, its use in CML treatment has not been reported. In this study, in vitro cell examinations showed that rucaparib could inhibit the proliferation and promote the apoptosis of CML cells. Furthermore, it can increase the sensitivity of CML cells to imatinib. Even in K562/G01 cells, the IC50 of rucaparib was lower than that in K562 cells, indicating that rucaparib has high treatment potential for CML-BC or such with drug resistance. We further performed in vivo experiments in animals for verification of our findings. The results of these studies showed that rucaparib has high biocompatibility in animals, effectively inhibits tumor growth, and thus has high potential for clinical application.

However, we also noticed that the effects of m⁶A modification on drug responses are not consistent or easy to understand. Therefore, more in vivo experiments that in combination with clinical studies are needed to assess the application value and mode of rucaparib in CML treatment. However, it is reasonable to anticipate the development and discovery of more m⁶A-related protein inhibitors with broad perspectives for CML treatment.

KIAA1429 is highly expressed in CML-BC, which could enhance the RAB27B mRNA stability to upregulate RAB27B expression through the KIAA1429 /m⁶A/YTHDF1 axis, consequently promoting CML progression. Rucaparib has the potential to inhibit the expression of KIAA1429, resulting in to suppressed CML progression. This study provides theoretical evidence shedding light on the mechanisms underlying CML progression and drug resistance, as well as on the clinical treatment of CML. Additionally, it provides novel insights on an alternative option for the treatment of imatinib-resistant CML (Fig. 7).

CML: Chronic myeloid leukemia; m⁶A: N⁶-methyladenine; KIAA1429: vir like m⁶A methyltransferase associated; YTHDF1: YTH N⁶-methyladenosine RNA binding protein 1; RAB27B: RAB27B, member RAS oncogene family; TKIs: Tyrosine kinase inhibitors; CML-CP: Chronic myeloid leukemi chronic phase; CML-BC: Chronic myeloid leukemia blast crisis; HC: Heathy control;TFR: treatment-free remission; PBMCs: Peripheral blood mononuclear cells; LC-MS: liquid chromatography-mass spectrometry; RIP: RNA Immunoprecipitation; TCGA: The Cancer Genome Atlas; GEO: Gene Expression Omnibus; HPA: Human Protein Atlas; GDSC: Genomics of Drug Sensitivity in Cancer; PPI: Protein-Protein Interaction.

Acknowledgements

Not applicable.

Author contributions

YFY, WXZ conceived and designed the experiment. YFY, ZFM completed the experiment and wrote the manuscript. YFY, ZFM, JJY, CY, XS, LMY and ZJ conducted the trial, analyzed the results, and revised the manuscript. LJ, XYM and LSQ analyzed the data. HB, WXZ supervised the whole experiment and critically revised the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by grants from the National Natural Science Foundation of China (Grants 81860034, 82160405, 82160038, 82260035) and Natural Science Foundations of Jiangxi Province (Grants 20212ACB206016).

Availability of data and materials

Not applicable.

Ethics approval and consent to participate

All animal experiments were in accordance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978) and were conducted with the approval of the Ethics Committee of Nanchang University. This study had approval from by the Ethics Committee of the Second Affiliated Hospital of Nanchang University; all participants provided signed informed consent. The protocols complied with the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Author details

¹Jiangxi Province Key Laboratory of Laboratory Medicine, Jiangxi Provincial Clinical Research Center for Laboratory Medicine, Department of Clinical Laboratory, The Second Affiliated Hospital of Nanchang University, No. 1 Minde Road, Nanchang 330006, Jiangxi Province, China.

Zhou, H.,R. Xu, Leukemia stem cells: the root of chronic myeloid leukemia. Protein & cell, 2015. 6(6): p. 403-12.
Shan, Y., N. DeSouza, Q. Qiu, S. Li, Leukemia Stem Cells in Chronic Myeloid Leukemia. Adv Exp Med Biol, 2019. 1143: p. 191-215.
Soverini, S., M. Mancini, L. Bavaro, M. Cavo, G.J.M.c. Martinelli, Chronic myeloid leukemia: the paradigm of targeting oncogenic tyrosine kinase signaling and counteracting resistance for successful cancer therapy. 2018. 17(1): p. 49.
Patnaik, M.M.,A. Tefferi, Chronic Myelomonocytic leukemia: 2020 update on diagnosis, risk stratification and management. Am J Hematol, 2020. 95(1): p. 97-115.
Braun, T., C. Eide, B. Druker, Response and Resistance to BCR-ABL1-Targeted Therapies. Cancer cell, 2020. 37(4): p. 530-542.
Atallah, E.,C.J.H. Schiffer, Discontinuation of tyrosine kinase inhibitors in chronic myeloid leukemia: when and for whom? 2020. 105(12): p. 2738-2745.
Amir, M.,S. Javed, A Review on the Therapeutic Role of TKIs in Case of CML in Combination With Epigenetic Drugs. Frontiers in genetics, 2021. 12: p. 742802.
Wu, J., K. Frazier, J. Zhang, Z. Gan, T. Wang, X. Zhong, Emerging role of m(6) A RNA methylation in nutritional physiology and metabolism. Obes Rev, 2020. 21(1): p. e12942.
H, H., W. H, C. J, The Biogenesis and Precise Control of RNA mA Methylation. Trends in genetics : TIG, 2020. 36(1): p. 44-52.
Oerum, S., V. Meynier, M. Catala, C.J.N.a.r. Tisné, A comprehensive review of m6A/m6Am RNA methyltransferase structures. 2021. 49(13): p. 7239-7255.
Shen, D., B. Wang, Y. Gao, L. Zhao, Y. Bi, J. Zhang, et al.H.J.A.p.S.B. Liu, Detailed resume of RNA mA demethylases. 2022. 12(5): p. 2193-2205.
Y, Z., S. Y, S. H, X. W, mA-binding proteins: the emerging crucial performers in epigenetics. Journal of hematology & oncology, 2020. 13(1): p. 35.
Shi, H., J. Wei, C. He, Where, When, and How: Context-Dependent Functions of RNA Methylation Writers, Readers, and Erasers. Molecular Cell, 2019. 74(4): p. 640-650.
Tong, J., R.A. Flavell, H.-B. Li, RNA m6A modification and its function in diseases. Frontiers of Medicine, 2018. 12(4): p. 481-489.
Fazi, F.,A. Fatica, Interplay Between N (6)-Methyladenosine (m(6)A) and Non-coding RNAs in Cell Development and Cancer. Front Cell Dev Biol, 2019. 7: p. 116.
Ianniello, Z., A. Paiardini, A. Fatica, N(6)-Methyladenosine (m(6)A): A Promising New Molecular Target in Acute Myeloid Leukemia. Front Oncol, 2019. 9: p. 251.
Kwok, C., A. Marshall, J. Rasko, J. Wong, Genetic alterations of mA regulators predict poorer survival in acute myeloid leukemia. Journal of hematology & oncology, 2017. 10(1): p. 39.
Weng, H., H. Huang, H. Wu, X. Qin, B. Zhao, L. Dong, et al.J. Chen, METTL14 Inhibits Hematopoietic Stem/Progenitor Differentiation and Promotes Leukemogenesis via mRNA mA Modification. Cell stem cell, 2018. 22(2): p. 191-205.e9.
Yankova, E., W. Blackaby, M. Albertella, J. Rak, E. De Braekeleer, G. Tsagkogeorga, et al.T. Kouzarides, Small-molecule inhibition of METTL3 as a strategy against myeloid leukaemia. Nature, 2021. 593(7860): p. 597-601.
Huang, Y., R. Su, Y. Sheng, L. Dong, Z. Dong, H. Xu, et al.C. Yang, Small-Molecule Targeting of Oncogenic FTO Demethylase in Acute Myeloid Leukemia. Cancer cell, 2019. 35(4): p. 677-691.e10.
Yue, Y., J. Liu, X. Cui, J. Cao, G. Luo, Z. Zhang, et al.J. Liu, VIRMA mediates preferential mA mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell discovery, 2018. 4: p. 10.
Qian, J., J. Gao, X. Sun, M. Cao, L. Shi, T. Xia, et al.J. Wei, KIAA1429 acts as an oncogenic factor in breast cancer by regulating CDK1 in an N6-methyladenosine-independent manner. Oncogene, 2019. 38(33): p. 6123-6141.
Miao, R., C. Dai, L. Mei, J. Xu, S. Sun, Y. Xing, et al.J. Wei, KIAA1429 regulates cell proliferation by targeting c-Jun messenger RNA directly in gastric cancer. Journal of cellular physiology, 2020. 235(10): p. 7420-7432.
Cheng, X., M. Li, X. Rao, W. Zhang, X. Li, L. Wang, G. Huang, KIAA1429 regulates the migration and invasion of hepatocellular carcinoma by altering m6A modification of ID2 mRNA. OncoTargets and therapy, 2019. 12: p. 3421-3428.
Xu, Y., Y. Chen, Y. Yao, H. Xie, G. Lu, C. Du, et al.J. Zhou, VIRMA contributes to non-small cell lung cancer progression via N-methyladenosine-dependent DAPK3 post-transcriptional modification. Cancer letters, 2021. 522: p. 142-154.
Zhao, W., X. Qi, L. Liu, S. Ma, J. Liu, J. Wu, Epigenetic Regulation of m(6)A Modifications in Human Cancer. Mol Ther Nucleic Acids, 2020. 19: p. 405-412.
H, H., W. H, C. J, mA Modification in Coding and Non-coding RNAs: Roles and Therapeutic Implications in Cancer. Cancer cell, 2020. 37(3): p. 270-288.
Zhu, W., J. Wang, J. Wei, C.J.C.c.i. Lu, Role of m6A methyltransferase component VIRMA in multiple human cancers (Review). 2021. 21(1): p. 172.
Schwartz, S., M. Mumbach, M. Jovanovic, T. Wang, K. Maciag, G. Bushkin, et al.A.J.C.r. Regev, Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. 2014. 8(1): p. 284-96.
Li, R., C. Dong, K. Jiang, R. Sun, Y. Zhou, Z. Yin, et al.L. Wang, Rab27B enhances drug resistance in hepatocellular carcinoma by promoting exosome-mediated drug efflux. Carcinogenesis, 2020. 41(11): p. 1583-1591.
Kariya, Y., M. Honma, A. Hanamura, S. Aoki, T. Ninomiya, Y. Nakamichi, et al.H. Suzuki, Rab27a and Rab27b are involved in stimulation-dependent RANKL release from secretory lysosomes in osteoblastic cells. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2011. 26(4): p. 689-703.
Fukuda, M., Rab27 effectors, pleiotropic regulators in secretory pathways. Traffic (Copenhagen, Denmark), 2013. 14(9): p. 949-63.
Imai, A., S. Yoshie, T. Nashida, H. Shimomura, M. Fukuda, The small GTPase Rab27B regulates amylase release from rat parotid acinar cells. Journal of cell science, 2004. 117: p. 1945-53.
Peng, D., H. Wang, L. Li, X. Ma, Y. Chen, H. Zhou, et al.L. Liu, miR-34c-5p promotes eradication of acute myeloid leukemia stem cells by inducing senescence through selective RAB27B targeting to inhibit exosome shedding. Leukemia, 2018. 32(5): p. 1180-1188.
Ren, P., X. Yang, X. Zhai, Y. Zhang, J. Huang, Overexpression of Rab27B is correlated with distant metastasis and poor prognosis in ovarian cancer. Oncology letters, 2016. 12(2): p. 1539-1545.
Chiang, L., S. Karvar, S. Hamm-Alvarez, Direct imaging of RAB27B-enriched secretory vesicle biogenesis in lacrimal acinar cells reveals origins on a nascent vesicle budding site. PloS one, 2012. 7(2): p. e31789.
Wang, S., J. Zhang, X. Wu, X. Lin, X. Liu, J. Zhou, Differential roles of YTHDF1 and YTHDF3 in embryonic stem cell-derived cardiomyocyte differentiation. RNA biology, 2021. 18(9): p. 1354-1363.
Chai, R., Y. Chang, X. Chang, B. Pang, S. An, K. Zhang, et al.Y. Wang, YTHDF2 facilitates UBXN1 mRNA decay by recognizing METTL3-mediated mA modification to activate NF-κB and promote the malignant progression of glioma. Journal of hematology & oncology, 2021. 14(1): p. 109.
Zaccara, S.,S. Jaffrey, A Unified Model for the Function of YTHDF Proteins in Regulating mA-Modified mRNA. Cell, 2020. 181(7): p. 1582-1595.e18.
Schoenbeck, K.,K. Flynn, Health-Related Quality of Life of Patients with Chronic Myeloid Leukemia as Measured by Patient-Reported Outcomes: Current State and Future Directions. Current hematologic malignancy reports, 2021. 16(6): p. 491-499.
Garcia-Gutierrez, V., M. Breccia, E. Jabbour, M. Mauro, J.E. Cortes, A clinician perspective on the treatment of chronic myeloid leukemia in the chronic phase. J Hematol Oncol, 2022. 15(1): p. 90.
Deng, L., W. Deng, S. Fan, M. Chen, M. Qi, W. Lyu, et al.Z. Chen, m6A modification: recent advances, anticancer targeted drug discovery and beyond. Molecular cancer, 2022. 21(1): p. 52.
Jiang, G., Z. Huang, Y. Yuan, K. Tao, W. Feng, Intracellular delivery of anti-BCR/ABL antibody by PLGA nanoparticles suppresses the oncogenesis of chronic myeloid leukemia cells. J Hematol Oncol, 2021. 14(1): p. 139.
He, Y., W. Wang, X. Xu, B. Yang, X. Yu, Y. Wu, J. Wang, Mettl3 inhibits the apoptosis and autophagy of chondrocytes in inflammation through mediating Bcl2 stability via Ythdf1-mediated mA modification. Bone, 2022. 154: p. 116182.
Halbach, S., Z. Hu, C. Gretzmeier, J. Ellermann, F. Wöhrle, J. Dengjel, T. Brummer, Axitinib and sorafenib are potent in tyrosine kinase inhibitor resistant chronic myeloid leukemia cells. Cell communication and signaling : CCS, 2016. 14: p. 6.
Sacha, T., E. Szczepanek, P. Dumnicka, J. Góra-Tybor, J. Niesiobędzka-Krężel, W. Prejzner, et al.O. Grzybowska-Izydorczyk, The Outcomes of Ponatinib Therapy in Patients With Chronic Myeloid Leukemia Resistant or Intolerant to Previous Tyrosine Kinase Inhibitors, Treated in Poland Within the Donation Program. Clinical lymphoma, myeloma & leukemia, 2021.
Gleixner, K., Y. Filik, D. Berger, C. Schewzik, G. Stefanzl, I. Sadovnik, et al.P. Valent, BCR-ABL1Asciminib and ponatinib exert synergistic anti-neoplastic effects on CML cells expressing -compound mutations. American journal of cancer research, 2021. 11(9): p. 4470-4484.
Wang, Z., Z. Liu, X. Wu, S. Chu, J. Wang, H. Yuan, et al.W. Chen, ATRA-induced cellular differentiation and CD38 expression inhibits acquisition of BCR-ABL mutations for CML acquired resistance. PLoS genetics, 2014. 10(6): p. e1004414.
Pinto, C., A. DE Sousa Portilho, M. Barbosa, M. DE Moraes, J. DE Lemos, R. Burbano, C. Moreira-Nunes, Combined Therapy of ATRA and Imatinib Mesylate Decreases BCR-ABL and ABCB1/MDR1 Expression Through Cellular Differentiation in a Chronic Myeloid Leukemia Model. In vivo (Athens, Greece), 2021. 35(5): p. 2661-2667.
Padella, A., A. Ghelli Luserna Di Rorà, G. Marconi, M. Ghetti, G. Martinelli, G. Simonetti, Targeting PARP proteins in acute leukemia: DNA damage response inhibition and therapeutic strategies. Journal of hematology & oncology, 2022. 15(1): p. 10.
O'Sullivan Coyne, G., C. Karlovich, D. Wilsker, A. Voth, R. Parchment, A. Chen, J. Doroshow, PARP Inhibitor Applicability: Detailed Assays for Homologous Recombination Repair Pathway Components. OncoTargets and therapy, 2022. 15: p. 165-180.

Table 1

Target sequence

Gene symbol	Target sequence
Sh1-KIAA1429 sense strands	5’-CCGGCGGAATATGAAGCAACAAATTCTCGAGAATTTGTTGCTTCATATTCCGTTTTTG- 3’
Sh1-KIAA1429 antisense strands	5’-AATTCAAAAACGGAATATGAAGCAACAAATTCTCGAGAATTTGTTGCTTCATATTCCG- 3’
Sh2-KIAA1429 sense strands	5’-CCGGCGCTGAGCAAAGTTCTCATATCTCGAGATATGAGAACTTTGCTCAGCGTTTTTG- 3’
Sh2-KIAA1429 antisense strands	5’-AATTCAAAAACGCTGAGCAAAGTTCTCATATCTCGAGATATGAGAACTTTGCTCAGCG- 3’
Sh-RAB27B sense strands	5’-GATCCGCCAGTCAACAGAGCTTCTTAATTCAAGAGATTAAGAAGCTCTGTTGACTGGTTTTTTG- 3
Sh-RAB27B antisense strands	5’-AATTCAAAAAACCAGTCAACAGAGCTTCTTAATCTCTTGAATTAAGAAGCTCTGTTGACTGGCG- 3’
Sh-YTHDF1 sense strands	5’-CCGGCCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGGTTTTTG- 3’
Sh-YTHDF1 antisense strands	5’-AATTCAAAAACCCGAAAGAGTTTGAGTGGAACTCGAGTTCCACTCAAACTCTTTCGGG- 3

Table 2

Primers RT-qPCR.

Gene	Forward primer(5'-3')	Reverse primer(5'-3')
KIAA1429	CTTGGCAAGTGGCTTGAACC	ACGTAAGGCAGTGGTAAGGC
RAB27B	AAGGCAGACCTACCAGATCAGAG	TTCTCCACACACTGTTCCATTCG
YTHDF1	TAAGGAAATCCAATGGACGG	TTTGAGCCCTACCTTACTGGA
GAPDH	TGCCAAATATGATGACATCAAGAA	GGAGTGGGTGTCGCTGTTG

No competing interests reported.

Fig1.tif
Fig. S1 Pan-cancer analysis of KIAA1429. a. KIAA1429 mRNA expression in variety of cancers, on the basis of data from TCGA database. b. Assessment of the interrelation between KIAA1429 expression level and overall survival rate of cancers patients by Kaplan-Meier curve. c. PPI network was constructed using 23 major genes associated with m6A modification. d. HPA database showed that KIAA1429 mRNA expression in bone marrow was the highest in tissues of the body. e. IHC was used to evaluated KIAA1429 protein expression level in CML-BC patients and CML-CP patients bone marrow. *P<0.05, **P<0.01, ***P<0.001.
FigS2.tif
Fig. S2 Bioinformatics analysis. a. Heatmap represented the distribution changes of mapped transcripts after knockdown of KIAA1429 in each sample of K562 cells. b. GO and KEGG enrichment analysis shows as bubble diagram. c. PPI network was constructed using 120 intersection genes. d. m6A modification structure diagram. e. The highest frequency m6A modification motif sequences. f. Schematic diagram of RAB27B m6A modification site distribution.
FigS3.tif
Fig. S3 Exosome identification and detection. a. Electron microscopic view of exosomes. b. Exosome particle size distribution map. c. Flow cytometry was used to detect the concentration of exosomes. d. Nano-Flow Cytometry was used to detect the expression of exosome surface proteins.
TableS1.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

KIAA1429 regulates the expression of RAB27B in a m6A YTHDF1 axis-dependent manner and promotes the progression of chronic myeloid leukemia, serving as a potential therapeutic target

Status:

Version 1

Abstract

Figures

Introduction

Methods And Materials

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1