Inhibitory effect of lncRNA SNHG16 Knockdown on G2/M Transition and Proliferation of Gallbladder Carcinoma Cells via miR-3138/CDC25B/CDK1 Axis Running title: SNHG16’s mechanisms in Gallbladder cancer

doi:10.21203/rs.3.rs-2076843/v1

Download PDF

Research Article

Inhibitory effect of lncRNA SNHG16 Knockdown on G2/M Transition and Proliferation of Gallbladder Carcinoma Cells via miR-3138/CDC25B/CDK1 Axis Running title: SNHG16’s mechanisms in Gallbladder cancer

https://doi.org/10.21203/rs.3.rs-2076843/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Gallbladder cancer (GBC) is the most common and aggressive malignant tumor in the biliary system, and its tumorigenesis and development are associated with abnormal expression of the long non-coding RNA (lncRNA). Although several studies have demonstrated that SNHG16 plays an important role in various tumors, its mechanism in GBC has not been systematically investigated.

Methods

This study is described from three aspects, including tissue, cell lines, and animal model. The qRT-PCR assay was applied to calculate the mRNA levels of SNHG16, miR-3138, and CDC25B. The link between SNHG16, miR-3138, and CDC25B expression was verified with the dual-luciferase reporter assay, RNA-binding protein immunoprecipitation assay (RIP), rescue assay, gene expression correlation analysis, etc.

Results

SNHG16 was highly expressed, and miR-3138 was lowly expressed in GBC tissues and cells compared to normal tissues and cells. Low expression of SNHG16 prevents the G2/M transition of the cell cycle by inhibiting the dephosphorylation of CDK1, inducing cell apoptosis, and suppressing cell proliferation in vitro and in vivo. LncRNA SNHG16 directly binds to miR-3138 and regulates miR-3138 expression in GBC-SD and NOZ cells. Cell proliferation and G2/M transition were inhibited by mimics of miR-3138. miR-3138 mediated CDC25B/CDK1 expression by binding directly to CDC25B mRNA. Importantly, the miR-3138 inhibitor could partially reverse the effect of SNHG16 knockdown on cell proliferation, G2/M transition, and cell apoptosis. SNHG16 knockdown reduced CDC25B expression in GBC-SD and NOZ cells.

Conclusion

As a competitive endogenous RNA, SNHG16 participates in the molecular regulatory network of the GBC cell cycle and proliferation through the mir-3138/CDC25B/CDK1 axis, enhancing the understanding of the pathogenesis of gallbladder cancer.

SNHG16

GBC

cell proliferation

miR-3138

pathogenesis

Gallbladder carcinoma (GBC) is a highly malignant tumor of the digestive system. The morbidity and mortality rates of GBC were 1.2% and 1.7%, respectively (Fan, et al., 2022). Since GBC is usually asymptomatic in its early stages, most patients are diagnosed at the intermediate or advanced stage, which deprives patients of the best time for surgical treatment and leaves them suffering from low rates of radical resection. Meanwhile, the recurrence rate of GBC is very high. In addition, the knowledge about the molecular pathogenesis of GBC and the effective therapeutic drugs is insufficient, and the five-year survival rate of GBC patients is less than 5% (Zhu, et al., 2010). Therefore, there is an urgent need to further reveal the underlying molecular mechanism of GBC to provide potential targets and a theoretical basis for future molecular targeted therapy.

LncRNA is a class of non-coding RNA that contains at least 200 nucleotides and does not have protein-coding capability (Mercer, et al., 2009). More and more studies have proved that the abnormal expression of LncRNA is involved in carcinogenesis through interactions with other cellular macromolecules including DNA, protein, and RNA, leading to regulation of the tumor-related genes or signal pathways and driving a variety of important cancer phenotypes (Prensner and Chinnaiyan, 2011). For example, LncRNA HULU can accelerate the progression of liver cancer by inhibiting PTEN and activating the AKT-PI3K-mTOR pathway (Xin, et al., 2018). LINC00511 is implicated in the tumorigenesis of breast cancer through the miR-185-3p/E2F1/Nanog axis (Lu, et al., 2018).

LncRNA SNHG16, located on human chromosome 17q25.1, was first reported to be carcinogenesis in neuroblastoma (Yu, et al., 2009). Since then, a large number of studies have further found that SNHG16 is extensively involved in the complex molecular regulatory network of human tumors, such as breast cancer (Xia, et al., 2021), cervical cancer (Wu, et al., 2020), and liver cancer (Hu, et al., 2020). Normally, SNHG16, as an endogenous RNA to compete with the gene transcripts at the same microRNA binding sites, can reverse the inhibiting effect of microRNA on downstream genes and accelerate tumor progression by promoting the proliferation, migration, and invasion of tumor cells. However, the role and mechanism of SNHG16 in GBC are still unknown.

Disruption of the cell cycle dramatically alters the ability of tumor cells to proliferate, which is regarded as the common feature of many human malignant cells (Bajalia, et al., 2022). The abnormal expressions and activities of Cyclin and CDKs can lead to deletion of the absence of cell cycle checkpoints, cell cycle disturbance, and uncontrolled cell proliferation (Kastan and Bartek, 2004, Malumbres and Barbacid, 2009). In this study, we explored the functions of SNHG16 in GBC and speculated that SNHG16 may be used as competitive endogenous RNA to regulate the cell cycle and proliferation of GBC by competitively binding to miRNA and regulating the target gene CDC25B expression.

Patients and Specimens

A total of seven pairs of tissue samples, including carcinoma tissue and adjacent para-carcinoma tissues, were collected from the GBC patients who did not receive any preoperative treatment and were diagnosed as GBC by pathological classification. These samples obtained from surgical resection were rapidly frozen in liquid nitrogen and stored at -80℃ before RNA separation. The research contents were approved by the Human Ethics Committee of Weifang Medical University and Weifang Maternal and Child Health Care Hospital. All samples were obtained with written informed consent from patients.

Cell Lines and Culture

The Human GBC cell line, NOZ, was purchased from iCell Bioscience Inc, Shanghai, and the human GBC cell line, GBC-SD, and human HEK293 cell line were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). These cells were cultured in DEME (Gibco BRL, Grand Island, NY, USA) containing 10% fetal calf serum (FCS; Hyclone, Logan, UT, USA) and 1% penicillin/streptomycin (Gibco BRL) at 37℃ in a humidified incubator with 5% CO₂.

RNA Extraction and qRT-PCR

TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate the total RNA from cells and A Reverse Transcription System Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used for reverse transcription. The qRT-PCR reaction was performed using Applied Biosystems 7900HT Fast Real-Time PCR System and the PCR product was analyzed using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Foster City, CA, USA). Moreover, the relative expression of genes was calculated by the 2^−ΔΔCt method. GAPDH was used as the internal control for the expression of SNHG16/CDC25B. All experiments were performed in triplicate. The Bulge-Loop RT primers and qRT-PCR primers of miR-3138, and the U6 primers were provided by Ribobio (Guangzhou, China). The detailed information is as follows:

SNHG16-forward, 5′-GGTGCAGTCAGCCTCAGTT-3′,

SNHG16-reverse, 5′-TGATCCCATCTGGCATCGCT-3′;

CDC25B-forward, 5′-GAAGCCTTTGCCCAGAGACC-3′,

CDC25B-reverse, 5′-TCCTCAGTATCCCCCTCTGC-3′;

U6-forward, 5′- CTCGCTTCGGCAGCACATATACT-3′,

U6-reverse, 5′-CTGTGCGTTTAAGCACTTCGCA-3′;

GAPDH-forward, 5′-CAGTGCCAGCCTCGTCTAT-3′,

GAPDH- reverse, 5′-CTTCTGACACCTACCGGGGA-3′.

Lentivirus-mediated SNHG16 Knockdown

In order to stabilize the knockdown of SNHG16, a short hairpin RNA (sh-SNHG16, AAAGCCACATCTCACATGGCA), which can interfere with SNHG16, and a negative control shRNA (sh-Ctrl) were chemically synthesized and inserted into GV112 lentivirus vector (GeneChem, Shanghai, China). The constructed virus was used to infect GBC-SD and NOZ cells with the MOI (multiplicity of infection) of 10. Moreover, in order to improve the transfection efficiency, 5µg/mL polybrene (Sigma, St Louis, MO, USA) was added to the transfection system. The steady cell lines were screened with 3µg/mL puromycin. The interference efficiency was detected by qRT-PCR.

Cell Transfection

MiR-3138 mimics, inhibitors, and corresponding negative controls were provided by Ribobio. Cell transfection was conducted using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After transfection, the cells were cultured for 24 hours and then used in the downstream experiments or analysis.

Cell Cycle Analysis

After the treatment with trypsin, the cells were washed with PBS, and then incubated and fixed overnight at 4℃ with 70% pre-cooled ethanol. Subsequently, the cells were incubated with PI/RNase Staining Buffer Solution (Becton Dickinson, Franklin Lakes, NJ, USA) for 30 minutes in dark. In the analysis of the cell cycle, at least 1.5×10⁵ cells were tested using BD FACSCalibur (Becton Dickinson) and CellQuest software (Becton Dickinson).

Cell Apoptosis Analysis

Cell apoptosis was detected using FITC Annexin V Apoptosis Detection Kit I (Becton Dickinson). The cells were washed with PBS and then stained with FITC and PI at room temperature in dark. Next, the apoptotic analysis was conducted with BD FACSCalibur (Becton Dickinson).

Western Blot Analysis

Protein was extracted with RIPA lysis buffer containing protease inhibitor and the concentration of protein was detected with BCA Assay Kit (Thermo Fisher Scientific, USA). Western blot analysis was performed using the previously reported standard method (Ding, et al., 2013). In this study, the primary antibodies used included anti-p-CDK1 (Tyr15), anti-CDK1, anti-Bax, anti-CDC25B (Cell Signaling Technology; Danvers, MA, USA), anti-Bcl-2 (wanleibio, Liaoning, China), anti-Cleaved Caspase 3 (BBI Life Sciences, Shanghai, China), and anti-GAPDH (ABclonal Technology, Wuhan, China).

Cell Viability Assay

The cells were inoculated into 96-well plates at 5000 cells per well. 20µl (5mg/mL) MTT solution (Shanghai Sangon Biotech, Shanghai, China) was added to each well, and then the cells were incubated for 4 hours. Subsequently, 100µl dimethyl sulfoxide (DMSO, Shanghai Sangon Biotech) was added to dissolve the crystal. The absorbance value (OD490) of each well at the wavelength of 490 nm was measured by spectrophotometer (UV-2102C; Unico Instrument Co., Ltd, Shanghai, China) at different time points (day 1, day 3, and day 5).

Colony Formation Assay

An appropriate number of cells were placed on a 6-well plate. Under normal conditions, the cells were cultured with DEME containing 10% FBS for 15 days. During the culture process, DEME was refreshed regularly. The colonies were fixed with methanol, stained with 0.5% crystal violet stain solution (Shanghai Sangon Biotech), and then photographed. More than 50 cells were counted as one clone.

Tumor Xenograft Experiments

Four-week-old male immunodeficient BALB/c nude mice were purchased from Hunan SJA Laboratory Animal Co., Ltd (Changsha, China) and fed in a specific pathogen-free environment. About 1×10⁷ cells mixed with 0.2 ml PBS were subcutaneously injected into the left and right sides of the back of nude mice. The GBC cells with SNHG16 knockdown were injected into one side and the control cells were injected into the other side. The size and volume of tumors were measured regularly. After 22 days, the mice were sacrificed and the tumors were excised. The mass and the volume of the tumor tissues were measured, and then they were photographed. Next, tumor tissues were sectioned and HE staining was performed as described previously (Yang, et al., 2018). The animal experiments followed the Ethical Guidelines for the Use of Laboratory Animals and were approved by the Ethics Committee of Weifang Medical University.

Dual-luciferase Reporter Assay

The CDC25B and SNHG16 sequences containing miR-3138 binding sites were chemically synthesized and inserted into the GV272 luciferase reporter vector (GeneChem) to obtain SNHG16 and CDC25B wild-type fluorescent reporter plasmids. Using the same method, the mutant reporter plasmid was also obtained. The cells were inoculated into a 96-well plate and co-transfected with fluorescent plasmid and miRNA mimics using Lipofectamine 2000. After 24 hours, luciferase activity was detected by the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). Renilla luciferase activity was used as an internal reference.

RNA-binding Protein Immunoprecipitation assay (RIP)

RIP assay was conducted in the GBC cells transfected with miR-3138 mimics using Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) according to the manufacturer's instructions. After 24 hours, the cells were harvested and then lysed using RIP buffer solution. Then, the lysed cells were incubated with magnetic beads that were coupled with either human anti-ago2 antibody (Abcam, Cambridge, MA, USA) or normal mouse IgG (Abcam) at 4℃ for 4 hours. Finally, the RNA bound to the magnetic beads was isolated for qRT-PCR analysis.

Statistical Analysis

SPSS 22.0 software (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Each experiment was repeated by at least three times and the results were described as mean ± standard deviation. Two-tailed student's t-test was used to evaluate the differences among the groups, which were considered statistically significant when the P-value was < 0.05(*).

SNHG16 is Highly Expressed in GBC Tissues and Cells

To explore the function of SNHG16 in GBC, the expression of SNHG16 was studied in seven pairs of cancer tissues and adjacent para-carcinoma tissues or GBC cell line. The qRT-PCR results showed that SNHG16 had significantly higher expression in GBC tumor tissues than in para-cancer tissues (Fig. 1A). Furthermore, compared to the normal HEK293 cells, the SNHG16 expression was obviously increased in GBC-SD and NOZ cells (Fig. 1B).

Inhibition of GBC Cells Proliferation in vitro and in vivo by Interfering with SNHG16 Expression

To further investigate the relationship between SNHG16 and GBC, lentivirus transfection was transfected into the GBC-SD and NOZ cells to obtain the strains of expression of SNHG16 knockdown (Fig. 1C). Subsequently, we conducted cell proliferation experiments and animal experiments to explore the effects of SNHG16 knockdown on the proliferation ability of GBC-SD and NOZ cells in vitro and in vivo, respectively. The absorbance values of GBC-SD and NOZ cells with low SNHG16 expression were significantly lower compared with control cells by MTT assay (Fig. 1D), indicating that GBC cell activity was inhibited by SNHG16 knockdown. The colony formation assay indicated that the colony formation rate of GBC-SD and NOZ cells was significantly reduced in SNHG16 knockdown expression (Fig. 1E, 1F).

Then, the effects of SNHG16 knockdown expression in the cell proliferation of GBC-SD and NOZ cells were investigated with tumor xenograft experiments in vivo. The results of nude mouse experiments indicated that the subcutaneous tumorigenic ability of GBC-SD and NOZ cells was suppressed by the reduction of SNHG16 expression (Fig. 1G). In addition, in the nude mice, the mass and the volume of the tumors originating from the GBC cells with SNHG16 knockdown were lighter and smaller (Fig. 1H, 1I). According to the results of HE staining, the tumor generated by the injection of GBC cells with down-regulated SNHG16 expression exhibited a looser arrangement of cells and fewer tumor blood vessels (Fig. 1J). Generally, these experimental results demonstrated that SNHG16 can promote GBC cell proliferation.

The Arrest of G2/M Transition of GBC Cells and Induction of Cell Apoptosis by SNHG16 Knockdown

Compared to normal cells, tumor cells possess a distinct feature, that is, an uncontrolled cell cycle leads to a greatly increased potential for cell proliferation (Evan and Vousden, 2001). Flow cytometry-based cell cycle analysis showed that after SNHG16 knockdown, the proportion of GBC-SD and NOZ cells in the G2/M phase was significantly increased (Fig. 2A). Previous studies have demonstrated that cyclin-dependent kinase 1 (CDK1), a key regulator for the G2/M transition of the cell cycle, can be inhibited in the phosphorylation state during the interphase of cell division and activated by dephosphorylation during the G2/M transition to promote cell cycle transition (Morgan, 1995, Zou, et al., 2020). Therefore, a Western blot was used to detect the expression of CDK1. The result showed that after SNHG16 knockdown, the expression of phosphorylated CDK1 (Tyr15) in GBC-SD and NOZ cells was increased, while the expression of CDK1 was not significantly changed (Fig. 2B). This phenomenon suggested that SNHG16 knockdown can inhibit the G2/M transition of GBC cells by reducing the dephosphorylation of CDK1.

Due to the cell cycle arrest, the cells in the G2 phase cannot pass the G2/M checkpoint and enter the division phase, thus inducing cell apoptosis (Kastan and Bartek, 2004). The results of the flow cytometry-based apoptosis assay indicated that inhibition of SNHG16 expression increased the proportion of apoptotic GBC-SD and NOZ cells (Fig. 2C). Furthermore, the western blot results of apoptotic marker protein showed that the inhibition of SNHG16 expression reduced the expression of Bcl-2 in GBC-SD and NOZ cells and increased the expression of Bax and Cleaved Caspase 3 (Fig. 2D), suggesting that SNHG16 knockdown could induce cell apoptosis.

Competitive Binding of SNHG16 and CDC25B to miR-3138 in GBC Cells

Previous studies showed that CDC25B can activate CDK1 and induce the cells in the G2 phase to enter the M phase by promoting the dephosphorylation of CDK1 during the G2/M transition of eukaryotic cells (Morgan, 1995, Zhong, et al., 2017). In order to clarify the molecular mechanism of the regulation of the GBC cell cycle by SNHG16, bioinformatics analysis was performed, and the results indicated that CDC25B and SNHG16 had the same binding site (CTACCTC) as miR-3138 (Fig. 3A). Thus, SNHG16 in GBC cells may directly bind to miR-3138, act as a competitive endogenous RNA, and affect cell cycle by regulating CDC25B expression.

According to the above analysis, the expressions of miR-3138 and CDC25B mRNA in GBC cells were detected. Compared with HEK293 cells, GBC-SD and NOZ cells had a lower miR-3138 expression and a higher CDC25B expression (Fig. 3B). Meanwhile, the dual-luciferase reporter assay showed that the luciferase activity of the co-transfected HEK293 cells with both miR-3138 mimics and wild-type SNHG16 fluorescent reporter plasmid was significantly reduced, while the luciferase activity of other groups had no obvious changes (Fig. 3C). Furthermore, an RIP assay was conducted after the transfection of miR-3138 mimics in GBC-SD and NOZ cells. The results showed that compared to the control group, the over-expression of miR-3138 in GBC-SD and NOZ cells significantly increased the relative expression level of the SNHG16 incubated with magnetic beads coupled with the Ago2 antibody (Fig. 3D). Therefore, it can be concluded that SNHG16, as a competitive endogenous RNA, can directly bind to miR-3138 in GBC-SD and NOZ cells.

To confirm that CDC25B is the downstream gene of miR-3138, a CDC25B fluorescent reporter plasmid containing a miR-3138 binding site was constructed. The results of the dual-luciferase reporter assay indicated that only the fluorescence intensity of HEK293 cells, which were co-transfected with wild-type CDC25B fluorescent reporter plasmid and miR-3138 mimics, was significantly decreased (Fig. 3E). Furthermore, the qRT-PCR analysis showed that in the GBC-SD and NOZ cells with SNHG16 knockdown, the expression of miR-3138 was obviously increased, while the expression of CDC25B mRNA was reduced (Fig. 3F). These results suggested that the SNHG16/miR-3138/CDC25B axis is present in GBC cells.

The Biological Function of miR-3138 in GBC Cells

Although miR-3138 has been reported to be a possible tumor suppressor gene (Braoudaki, et al., 2016), its function in GBC is still unknown. To investigate the role of miR-3138 in GBC, miR-3138 mimics were transfected into the GBC-SD and NOZ cells, which resulted in high expression of mir-3138. After 24 hours, the cells were harvested and the transfection efficiency of miR-3138 mimics was tested. The qRT-PCR data indicated that after the transfection of miR-3138 mimics, the expression level of miR-3138 in the tested GBC-SD and NOZ cells was significantly increased (Fig. 4A), while the expression of SNHG16 and CDC25B mRNA was obviously reduced (Fig. 4B).

The result of the in vitro cell proliferation assay revealed that with the increase of miR-3138 expression, the GBC cell activity was inhibited (Fig. 4C) and the clone formation rate was decreased (Fig. 4D). Moreover, flow cytometry-based cell cycle analysis indicated that the number of GBC-SD and NOZ cells in the G2/M phase was increased after SNHG16 knockdown (Fig. 4E). Meanwhile, the western blot assay results showed that the up-regulation of miR-3138 in cells led to a reduced expression of CDC25B and an increased expression of phosphorylated CDK1 (Fig. 4F). The results of flow cytometry-based cell apoptosis analysis and western blot assay of apoptotic marker protein demonstrated that the overexpression of miR-3138 can induce cell apoptosis (Fig. 4G, 4H).

These results indicated that miR-3138 played an anticancer role in GBC, prevented the dephosphorylation of CDK1 from activating its activity by inhibiting the expression of downstream CDC25B, and inhibited G2/M transition to weaken the cell proliferation.

The miR-3138-dependent Carcinogenic Effect of SNHG16 in GBC

To further confirm the involvement of SNHG16 in the regulatory network of GBC cells through miR-3138, the rescue assay was performed by transfecting miR-3138 inhibitor into the GBC-SD and NOZ cells with SNHG16 knockdown. The qRT-PCR analysis demonstrated that the transfection of a miR-3138 inhibitor can effectively reduce the expression of miR-3138 (Fig. 5A). Meanwhile, the interference of miR-3138 in GBC-SD and NOZ cells by SNHG16 knockdown increased the expression of CDC25B (Fig. 5B). Then the results from the subsequent flow cytometry-based analysis of cell cycle and cell apoptosis, western blot of cell cycle-related protein and apoptotic marker protein, and in vitro cell proliferation assay demonstrated that the inhibition of miR-3138 expression may reduce the effect of SNHG16 knockdown on GBC cell cycle, apoptosis, and proliferation (Fig. 5C-G, Supplementary Figure S1A-C). These results demonstrated that the SNHG16 in GBC cells can act as a competitive endogenous RNA and compete with CDC25B for binding on miR-3138, thus enhancing the dephosphorylation of CDK1, activating its activity, inducing G2/M transition, and promoting cell proliferation.

GBC is often considered one of the most lethal malignancies with a poor prognosis. The lncRNA SNHG16 has been reported as an oncogenic regulator in several cancers. However, its expression and function in GBC remain largely unknown. In this study, the link between SNHG16 and GBC was very strong. First, we found that the expression of SNHG16 was increased in GBC tissues and cell line, and knockdown of SNHG16 expression prevented G2/M transition, induced cell apoptosis, and inhibited cell proliferation in vitro and in vivo. Furthermore, bioinformation analysis showed that the binding sites of SNHG16, miR-3138, and CDC25B were identical. miR-3138 expression was reduced in GBC-SD and NOZ cells, and compared with decreased SNHG16 expression, increased miR-3138 expression produced the same effect in cell proliferation and G2/M transition. Excitingly, the side effects of SNHG16 knockdown expression were reversed by the miR-3138 inhibitor. CDC25B/CDK1 functions as key proteins in the cell cycle, and is regarded as the targeted gene and regulated by the SNHG16. In general, studies have shown that as a competitive endogenous RNA, SNHG16 promotes GBC cell proliferation through the miR-3138 /CDC25B/CDK1 axis (Fig. 5H).

G2/M checkpoint is a key cell-cycle checkpoint. If genomic DNA is damaged during replication, the G2/M checkpoint can prevent the cells in the G2 phase from entering the mitosis phase until the damaged DNA is completely repaired. G2/M checkpoint can ensure that mitosis is not initiated until the damaged DNA is repaired. However, the cells with defective G2/M checkpoints allow the damaged DNA to enter the mitosis phase before the repair is complete. As a result, the defective cells have genomic instability and uncontrolled cell proliferation and are gradually transformed into tumor cells that eventually lead to tumors (Lobrich and Jeggo, 2007). Based on this study, it was revealed that the G2/M checkpoint is reactivated in the GBC cells with SNHG16 knockdown by the inhibition of the dephosphorylation of CDK1, and the reactivation of the G2/M checkpoint can induce the apoptosis of the tumor cells with damaged genomic DNA and greatly reduce the potential of cell proliferation. However, the precise molecular mechanism of the activation of the G2/M checkpoint by SNHG16 knockdown needs to be further investigated.

The conclusions of previous studies suggested that lncRNA can participate in the regulatory network of genes at the levels of epigenetic modification, transcription, or post transcription (Mercer, et al., 2009). The literature has revealed that SNHG16 mainly acts as ceRNA and competes with the genes with the same binding sites to bind miRNA, thus playing a carcinogenic role. As a key regulator of G2/M transition in the eukaryotic organism, CDK1 activity is inhibited when it is in the state of phosphorylation during the interphase of cell division. However, CDC25B can reactivate CDK1 by CDK1 dephosphorylation during the G2/M transition phase, thereby promoting cell entry into the mitosis phase (Kang, et al., 2013, Zhong, et al., 2017). Bioinformatics analysis has suggested that CDC25B and SNHG16 have the same binding site as miR-3138 (CTACCTC). This study showed that the expression of miR-3138 was low in GBC cells, while the CDC25B was highly expressed. In addition, it was also demonstrated that SNHG16, as ceRNA, can directly bind to miR-3138, and CDC25B was the downstream gene of miR-3138. These results suggest that SNHG16 knockdown may inhibit the expression of CDC25B through miR-3138 and activate the G2/M checkpoint.

In the regulatory network of the eukaryotic cell cycle, CDC25 family genes can activate CDKs by dephosphorylating CDKs, thus playing an important role in different transitions of the cell cycle (Boutros, et al., 2007, Sur and Agrawal, 2016). As a member of the CDC25 family, CDC25B has been reported to be highly expressed in a variety of tumors. In tumor cells, these highly expressed CDC25B can activate CDK1 through dephosphorylation and induce G2/M transition, which can greatly increase the potential for cell proliferation (Galaktionov, et al., 1995, Miyata, et al., 2001, Yan, et al., 2008). In this study, CDC25B was demonstrated to be the downstream gene of miR-3138. Moreover, to further clarify the molecular mechanism by which SNHG16 promotes GBC progression, miR-3138 mimics were transfected into the GBC cells with low miR-3138 expression. It was discovered that the overexpression of miR-3138 and SNHG16 knockdown had the same effect, i.e., reducing the expression of CDC25B to inhibit the dephosphorylation of CDK1, thereby suppressing G2/M transition, promoting cell apoptosis, and weakening cell proliferation. The result of the rescue assay further demonstrated that the inhibition of miR-3138 can reverse the effect of SNHG16 knockdown on the GBC cell cycle, apoptosis, and proliferation, suggesting SNHG16 may play its role in GBC etiology through miR-3138. In GBC cells, SNHG16 and CDC25B competitively bind to miR-3138, resulting in increased CDC25B expression and further enhancing the dephosphorylation and activation of CDK1, as well as inducing G2/M transition and promoting cell proliferation.

In conclusion, this study reveal the SNHG16/miR-3138/CDC25B/CDK1 signal pathway plays an important in the regulatory network of the GBC cell cycle, deepen the understanding of the function of lncRNA SNHG16, and provide new insights for the molecular mechanism on the involvement of lncRNAs signal pathway in the occurrence and progression of GBC.

Finding information

This work was supported by the following funding agencies: National Natural Science Foundation of China (No. 82103571 to Tong Wang); Youth Natural Science Foundation of Shandong Province (No. ZR2021QH295 to Tong Wang, No. ZR2021QH367 to Fujun Peng); Tai-Shan Scholar Program from Shandong Province (No. tsqn202103116 to Xiangyu Zou); and Student Innovation and Entrepreneurship Training Program of Shandong Province (No. x2021003 to Shuxin Chen)

Conflicts of Interest: The authors declare that they have no conflict of interest.

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Ethics approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Human Ethics Committee of Weifang Medical University.

Abbreviations

CDC25B, Cell Division Cycle 25B; CDK1, cyclin-dependent kinase 1; GBC, Gallbladder cancer; lncRNA, long non-coding RNA; miR-3138, micro RNA-3138; RIP, RNA-binding protein immunoprecipitation assay; sh-Ctrl, negative control shRNA

Authors’ Contributions

Fujun Peng and Shengguang Li conceived the project, supervised the study, provided guidance and revised the manuscript for scholarly publication. Yun Li, Lujie Zhao and Tong Wang analysed the data and wrote the manuscript. Yun Li helped with data discussion. Jiquan Pan, Jingye Wang, Shuxin Chen collected the samples and conducted the samples. Lujie Zhao and Yahui Tian fed the rats and carried the animals experiments. Zhongfa Yang and Xiangyu Zou provided specialized expertise in data analysis. All authors reviewed and approved the final manuscript as submitted.

Bajalia, E.M., Azzouz, F.B., Chism, D.A., Giansiracusa, D.M., Wong, C.G., Plaskett, K.N., and Bishayee, A. (2022) Phytochemicals for the Prevention and Treatment of Renal Cell Carcinoma: Preclinical and Clinical Evidence and Molecular Mechanisms, Cancers 14.
Boutros, R., Lobjois, V., and Ducommun, B. (2007) CDC25 phosphatases in cancer cells: key players? Good targets?, Nat Rev Cancer 7: 495–507.
Braoudaki, M., Lambrou, G.I., Papadodima, S.A., Stefanaki, K., Prodromou, N., and Kanavakis, E. (2016) MicroRNA expression profiles in pediatric dysembryoplastic neuroepithelial tumors, Med Oncol 33: 5.
Ding, X., Yang, Z., Zhou, F., Wang, F., Li, X., Chen, C., et al. (2013) Transcription factor AP-2α regulates acute myeloid leukemia cell proliferation by influencing Hoxa gene expression, The international journal of biochemistry & cell biology 45: 1647–1656.
Evan, G.I., and Vousden, K.H. (2001) Proliferation, cell cycle and apoptosis in cancer, Nature 411: 342–348.
Fan, K., Wang, J., Shen, S., Ni, X., Gong, Z., Zheng, B., et al. (2022) ERBB2 S310F mutation independently activates PI3K/AKT and MAPK pathways through homodimers to contribute gallbladder carcinoma growth, Medical oncology (Northwood, London, England) 39: 64.
Galaktionov, K., Lee, A.K., Eckstein, J., Draetta, G., Meckler, J., Loda, M., and Beach, D. (1995) CDC25 phosphatases as potential human oncogenes, Science 269: 1575–1577.
Hu, Y.L., Feng, Y., Chen, Y.Y., Liu, J.Z., Su, Y., Li, P., et al. (2020) SNHG16/miR-605-3p/TRAF6/NF-κB feedback loop regulates hepatocellular carcinoma metastasis, Journal of cellular and molecular medicine 24: 7637–7651.
Kang, H., Hwang, S.C., Park, Y.S., and Oh, J.S. (2013) Cdc25B phosphatase participates in maintaining metaphase II arrest in mouse oocytes, Mol Cells 35: 514–518.
Kastan, M.B., and Bartek, J. (2004) Cell-cycle checkpoints and cancer, Nature 432: 316–323.
Lobrich, M., and Jeggo, P.A. (2007) The impact of a negligent G2/M checkpoint on genomic instability and cancer induction, Nat Rev Cancer 7: 861–869.
Lu, G., Li, Y., Ma, Y., Lu, J., Chen, Y., Jiang, Q., et al. (2018) Long noncoding RNA LINC00511 contributes to breast cancer tumourigenesis and stemness by inducing the miR-185-3p/E2F1/Nanog axis, J Exp Clin Cancer Res 37: 289.
Malumbres, M., and Barbacid, M. (2009) Cell cycle, CDKs and cancer: a changing paradigm, Nature reviews. Cancer 9: 153–166.
Mercer, T.R., Dinger, M.E., and Mattick, J.S. (2009) Long non-coding RNAs: insights into functions, Nature reviews. Genetics 10: 155–159.
Miyata, H., Doki, Y., Yamamoto, H., Kishi, K., Takemoto, H., Fujiwara, Y., et al. (2001) Overexpression of CDC25B overrides radiation-induced G2-M arrest and results in increased apoptosis in esophageal cancer cells, Cancer Res 61: 3188–3193.
Morgan, D.O. (1995) Principles of CDK regulation, Nature 374: 131–134.
Prensner, J.R., and Chinnaiyan, A.M. (2011) The emergence of lncRNAs in cancer biology, Cancer Discov 1: 391–407.
Sur, S., and Agrawal, D.K. (2016) Phosphatases and kinases regulating CDC25 activity in the cell cycle: clinical implications of CDC25 overexpression and potential treatment strategies, Mol Cell Biochem 416: 33–46.
Wu, W., Guo, L., Liang, Z., Liu, Y., and Yao, Z. (2020) Lnc-SNHG16/miR-128 axis modulates malignant phenotype through WNT/β-catenin pathway in cervical cancer cells, Journal of Cancer 11: 2201–2212.
Xia, W., Liu, Y., Cheng, T., Xu, T., Dong, M., and Hu, X. (2021) Extracellular Vesicles Carry lncRNA SNHG16 to Promote Metastasis of Breast Cancer Cells via the miR-892b/PPAPDC1A Axis, Frontiers in cell and developmental biology 9: 628573.
Xin, X., Wu, M., Meng, Q., Wang, C., Lu, Y., Yang, Y., et al. (2018) Long noncoding RNA HULC accelerates liver cancer by inhibiting PTEN via autophagy cooperation to miR15a, Mol Cancer 17: 94.
Yan, X., Chua, M.S., He, J., and So, S.K. (2008) Small interfering RNA targeting CDC25B inhibits liver tumor growth in vitro and in vivo, Mol Cancer 7: 19.
Yang, L., Qiu, J., Xiao, Y., Hu, X., Liu, Q., Chen, L., et al. (2018) AP-2β inhibits hepatocellular carcinoma invasion and metastasis through Slug and Snail to suppress epithelial-mesenchymal transition, Theranostics 8: 3707–3721.
Yu, M., Ohira, M., Li, Y., Niizuma, H., Oo, M.L., Zhu, Y., et al. (2009) High expression of ncRAN, a novel non-coding RNA mapped to chromosome 17q25.1, is associated with poor prognosis in neuroblastoma, Int J Oncol 34: 931–938.
Zhong, Y., Yang, J., Xu, W.W., Wang, Y., Zheng, C.C., Li, B., and He, Q.Y. (2017) KCTD12 promotes tumorigenesis by facilitating CDC25B/CDK1/Aurora A-dependent G2/M transition, Oncogene 36: 6177–6189.
Zhu, A.X., Hong, T.S., Hezel, A.F., and Kooby, D.A. (2010) Current management of gallbladder carcinoma, Oncologist 15: 168–181.
Zou, Y., Ruan, S., Jin, L., Chen, Z., Han, H., Zhang, Y., et al. (2020) CDK1, CCNB1, and CCNB2 are Prognostic Biomarkers and Correlated with Immune Infiltration in Hepatocellular Carcinoma, Medical science monitor: international medical journal of experimental and clinical research 26: e925289.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Inhibitory effect of lncRNA SNHG16 Knockdown on G2/M Transition and Proliferation of Gallbladder Carcinoma Cells via miR-3138/CDC25B/CDK1 Axis Running title: SNHG16’s mechanisms in Gallbladder cancer

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials And Methods

Patients and Specimens

Cell Lines and Culture

RNA Extraction and qRT-PCR

Lentivirus-mediated SNHG16 Knockdown

Cell Transfection

Cell Cycle Analysis

Cell Apoptosis Analysis

Western Blot Analysis

Cell Viability Assay

Colony Formation Assay

Tumor Xenograft Experiments

Dual-luciferase Reporter Assay

RNA-binding Protein Immunoprecipitation assay (RIP)

Statistical Analysis

Results

SNHG16 is Highly Expressed in GBC Tissues and Cells

Competitive Binding of SNHG16 and CDC25B to miR-3138 in GBC Cells

The Biological Function of miR-3138 in GBC Cells

The miR-3138-dependent Carcinogenic Effect of SNHG16 in GBC

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1