Kisspeptin modulation of nonapeptide and cytochrome P450 aromatase mRNA expression in the brain and ovary of the catfish Heteropneustes fossilis: in vivo and in vitro studies

doi:10.21203/rs.3.rs-2079229/v1

Download PDF

Research Article

Kisspeptin modulation of nonapeptide and cytochrome P450 aromatase mRNA expression in the brain and ovary of the catfish Heteropneustes fossilis: in vivo and in vitro studies

https://doi.org/10.21203/rs.3.rs-2079229/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 15 Nov, 2023

Read the published version in Fish Physiology and Biochemistry →

You are reading this latest preprint version

In the catfish Heteropneustes fossilis, Kisspeptins (Kiss) and nonapeptide (NP) hormones (vasotocin, Vt; isotocin, Itb; the Val8 isotocin paralog, Ita) stimulate the brain-pituitary-gonadal (BPG) axis. The present study investigated the functional interactions between these two systems, and that between Kiss and P450 aromatase (P450 arom) in the catfish brain and ovary. Human Kiss1 and catfish Kiss2 produced dosage-dependent effects on vt, itb and ita expression in vivo: 1 ng/g body weight (BW) and 2 ng/g BW inhibited, and 3 ng/g BW stimulated the expressions. The Kiss peptides (5, 10 and 15 nM) for 24 h produced a concentration - dependent stimulation of the gene expression in vitro. Kiss2 was more effective than Kiss1, both in vivo and in vitro. The Kiss1 administration stimulated ovarian vt, itb and ita expression at 2 and 3 ng/g BW and the Kiss2 treatment inhibited the expression at 1 ng/g BW and stimulated it at 2 and 3 ng/g BW. The Kiss receptor antagonist peptide 234 inhibited the NP mRNA expressions in a dosage/concentration-dependent manner. The Kiss peptide administration stimulated brain-specific cyp19a1b and ovary-specific cyp19a1a P450 arom expression dosage-dependently, both in vivo and in vitro. Peptide 234 inhibited the enzyme gene expression significantly, both in vivo and in vitro. The results show that Kiss peptides modulate functional targets like NP and E₂ in the brain and ovary to influence reproductive functions.

Catfish brain and ovary

Synthetic Kiss peptides

Nonapeptide gene expression

P450 aromatase expression

Following the discovery of Kisspeptin (KISS1/Kiss1) and its cognate receptor (GPR54 or KISS1/Kiss1R) in humans and mammals (Kotani et al. 2001; de Roux et al. 2003; Seminara et al. 2003; Messager et al. 2005), Kiss1 is recognized as the critical regulator of the brain-pituitary-gonadal (BPG) axis, controlling reproduction and fertility. In this regulation, the gonadotropin-releasing hormone (Gnrh) is considered its primary target, stimulating pituitary gonadotropins (Fsh and Lh) and gonadal hormones, notably sex steroids. The Gnrh system apart, Kiss1 has also been reported to interact with other neuropeptide systems involved in reproduction. Nonapeptide (NP) hormones oxytocin (OT) and vasopressin (VP) secreted by the supraoptic and paraventricular nuclei are targeted by the Kiss system. Scott and Brown (2011) reported that Kiss1 modified the firing rates of OT and VP neurons. In female rats, intravenous administration of Kiss1 increased plasma OT level, and the intracerebro-ventricular injection increased plasma VP level, indicating Kiss roles in OT- and VP-dependent physiological functions (Kotani et al. 2001; Ten et al. 2010). In the arcuate nucleus (AR), Kiss1 is co-localized with neurokinin B and dynorphin (KNDy neurons), shows dimorphic differences and mediates the steroid feedback control of GnRH secretion (Smith et al. 2005; Clarkson and Herbison 2006; Oakley et al. 2009; Cheng et al. 2010; Herbison et al. 2010; Navarro et al. 2011; Hrabovszky 2014; Wang and Moenter 2020). In the mouse anteroventral periventricular nucleus (AVPV), another steroid- sensitive center, estrogen receptors (Erα) are expressed in the Kiss1 neurons and mediates the E₂ regulation of Gnrh secretion (Wang and Moenter 2020). The two aforesaid centers participate in a differential manner: E₂ increases the Kiss1 mRNA expression in the AVPV and decreases it in the AR. While the role of gonadal E₂ in the feedback control of Gnrh/Lh secretion is extensively documented, the role of locally produced E₂ (neuroestrogen) has received little attention. In the study in female rhesus monkeys, a significant effect of locally produced E₂ on the pulsatile (episodic) and preovulatory release of Gnrh was reported (Terasawa 2018). In the ovary, Kiss1 has no significant role in the production of E₂ in rat luteal cells and its role in developing granulosa cells is not ascertained (Peng et al. 2013). The report that Kiss1 induced P450 aromatase (P450 arom) and GPR54 mRNA expression in the breast cancer cell line MCF7, which was abolished by the Kiss 1 receptor inhibitor (Yilmaz and Oksuz 2019), has opened up yet another domain of Kiss function but sparsely reported in animals.

In lower vertebrates, unlike mammals, two forms of Kiss genes, corresponding peptides, and receptors (kiss1/Kiss1/Kiss1R and kiss2/Kiss2/Kiss2R types) are identified (Lee et al. 2009; Pasquier et al. 2012; Chaube et al. 2020; Wang et al. 2022). Teleost fishes show considerable diversity in their distribution, retaining one or both forms. The two Kiss forms, when present in a species, show discrete or overlapping spatial distribution in the brain, as in zebrafish (Servili et al. 2011) and chub mackeral (Ohga et al. 2018). In others like medaka (Oryzias latipes), fugu (Takifugu niphobles), tetradon (Tetradon nigroviridis), stickleback (Gasterosteus aculeatus) and catfish (H. fossilis), a single form was described (Kanda et al. 2008; Pasquier et al. 2012; Chaube et al. 2020). In medaka hypothalamus, the Kiss1 neurons show sex dimorphic differences, numerically high in the nucleus ventralis tuberis of males (Kanda et al. 2008). The hypothalamic distribution and seasonal differences in the expression patterns strongly support the reproductive role of the Kiss peptides (Filby et al. 2008; Gopurapilly et al. 2013; Song et al. 2015; Ohga et al. 2018; Somoza et al. 2020; Chaube et al. 2022; Wang et al. 2022). A Kiss system is characterized in fish, indicating a direct involvement of the system in gonadal functions (Fairgrieve et al. 2016; Ohga et al. 2018; Chaube et al. 2020).

Evidence of functional interactions between Kiss peptides and NP hormones has been presented in a few teleosts like medaka (Kanda et al. (2013) and striped sea bass (Morone saxatilis; Zmora et al. 2015). In medaka, gpr54-2 mRNA is expressed in neurons of the VP ortholog vasotocin (Vt) and OT ortholog isotocin (It) in the nucleus preopticus pars magnocellularis (NPOpmc) (Kanda et al. 2013). In the striped sea bass, kiss2r and vt mRNAs were co-localized in the NPOpmc and kiss1r and it mRNAs in the neurons of the anterior periventricular nucleus (AVPv). These authors (Zmora et al. 2015) further reported that Kiss receptor antagonists (peptide 234 and peptide 359) downregulated vt mRNA, but not it mRNA expression, indicating a direct Kiss signaling of the vt gene expression. As in mammals, steroid-sensitive Kiss systems are identified in the brain of medaka, goldfish, zebrafish and striped sea bass (Mitani et al. 2010; Klenke et al. 2011; Servili et al. 2011; Kanda et al. 2012). However, Kiss signaling of steroid metabolism is not investigated either in the ovary or brain.

In teleosts, estrogens are synthesized in the ovary and brain by specific P450 arom: Cyp19a1a in the ovary and Cyp19a1b in the brain. The teleost brain is a major site of estrogen synthesis owing to the high expression of the brain-specific Cyp19a1b or P450 arom B (Forlano et al. 2001; Menuet et al. 2003; Marsh et al. 2006; Diotel et al. 2010).

The objective of the present study was to investigate the functional interactions between Kiss peptides and NP on the one hand, and P450 arom on the other. For this, effects of both Kiss1 and Kiss2 on the expression of the NP genes vt, ita, and itb, and P450 arom coding genes, respectively, cyp19a1a and cyp19a1b in the brain and ovary were demonstrated under in vivo and in vitro conditions. The experiments were conducted on H. fossilis, a freshwater air-breathing catfish, a species widely used in reproductive endocrinology research and cultured in South East Asian countries as a table fish. In this species, kiss2, vt, the conventional it (itb) and a novel it paralog (ita) mRNAs are localized in the NPOpmc and NPO parvocellularis (NPOppc) in the preoptic area (POA) and in the ovarian follicular layer (Banerji et al. 2015, 2016, 2018; Chaube et al. 2020). Ovary- and brain-specific P450 arom (cyp19a1a and cyp19a1b, respectively) cDNAs were characterized, and the transcripts were localized in the oocyte follicular layer in the ovary and different regions of the brain, especially in the telencephalon and hypothalamus (Chaube et al. 2015). Further, the reproductive role of Kiss2 and NPs has been investigated in this species (Joy and Chaube 2015; Acharjee et al. 2018; Chaube et al. 2022). Therefore, the catfish is an ideal model to study the functional interactions among Kiss, NPs and steroid hormones at the brain (central) and ovarian (peripheral) levels.

Animal collection and acclimatization

Live female catfish H. fossilis (Bloch) (Order: Siluriformes; Family Heteropneustidae or Saccobranchidae) weighing 50–65 g were purchased from fish markets in Varanasi in the prespawning phase (gonado-somatic index, GSI − 9.6 ± 1.2%) of the reproductive cycle. The fish were maintained in the laboratory for two weeks under natural photoperiod (13.0L: 11.0 D) and temperature (25 ± 2°C) to overcome stress due to transportation and fed with goat liver ad libitum.

Chemicals and reagents

Human Kisspeptin-10 (YNWNSFGLRF-NH₂, Cat. No. 2570/1) and Peptide 234 (Kisspeptin 234, Ac-ANWNGFGWRF-NH_2, Cat.no. 3881/1) (Tocris Bioscience, Bristol, UK) were purchased through Spectra Labs, Thiruvananthapuram, Kerala, India. Catfish Kisspeptin2 (FNFNPFGLRF-NH₂) was custom-synthesized (Lot no. A1093-2) by Bio-Synthesis, Lewisville, Texas, USA. The purity of the peptide was > 95%. Gene- specific primers for vt, ita, itb, cyp19a1a, cyp19a1b and β-actin were designed and custom-synthesized by Integrated DNA Technologies, Hyderabad, India. RNeasy lipid tissue mini kit (Qiagen, Hilden, Germany), Revert-Aid H minus first strand cDNA synthesis kit (Fermentas, Foster, CA USA), DNase I, RNase-free (Ambion, Foster, CA USA), RNAlater (Ambion, Foster, CA USA), 2 x PCR Mastermix (Fermentas, Foster, CA USA), VeriQuest™ SYBR Green qPCR Master mix with ROX (Affymetrix, Inc. Cleveland, Ohio USA) were purchased through local suppliers. Tricaine methanesulfonate (MS 222), TRIS base, HEPES and EDTA were purchased from Sigma-Aldrich, New Delhi, India. Agarose. Leibovitz L-15 medium, and other chemicals were purchased from Himedia Laboratories Pvt Ltd, Mumbai, India.

In vivo experiments

Preparation of peptides

Stock solutions of human Kiss1 (hKiss1), catfish Kiss2 (cfKiss2) and peptide 234 [GPR54 (Kiss receptor) antagonist] were prepared in distilled water on the day of the experiments and kept at 0 ^ºC. The stock solutions were diluted with 0.7% NaCl (fish saline) or with the incubation medium to give different working concentrations.

Effects of kisspeptins and peptide 234 on the brain and ovarian gene expression

Fifty acclimatized female catfish were divided into 10 groups of 5 fish each. and treated as follows:

Kiss1 groups – Three groups of the fish were given intraperitoneal (ip) injections of Kiss1, each given 1.0, 2.0 or 3.0 ng/g BW.

Kiss2 groups – Three groups of the fish received ip injections of Kiss2, each given 1.0, 2.0 or 3.0 ng/g BW.

Peptide 234 groups – Three groups of fish received ip injections of peptide 234, each given 5, 10 or 20 ng/g BW.

Vehicle control – A group of fish was injected with 0.7% fish saline, ip.

After 24 h, the fish in all the groups were anesthetized with 0.01% MS222 solution. The fish were decapitated, and the brain and ovaries were aseptically dissected. Brains (70–80 mg) and ovaries (100 mg) from each group were snap frozen and stored in RNAlater at − 80 ^ºC for qPCR assays.

In vitro experiments

Sixty acclimatized female fish were anaesthetized with MS222 and sacrificed by decapitation. Brains and ovaries were dissected out rapidly under aseptic conditions. The organs were rinsed with phosphate-buffered saline (PBS) several times to remove traces of blood and tissue debris. The brains and ovary pieces were divided into 12 groups of 5 each separately. The brain was cut into 2 halves in the mid-sagittal plane, and ovaries were cut transversely in the middle into ~ 100 mg pieces so as to allow uniform percolation of culture medium. The tissues were transferred to multi-well culture plates containing 2.5 mL Leibovitz L-15, supplemented with 10% fetal bovine serum, 10 mM HEPES, 100 IU/ mL penicillin and 100 mg/mL streptomycin. The medium was changed, and the tissues were incubated in fresh medium to which different concentrations of Kiss1 (5, 10 and 15 nM), Kiss2 (5, 10 and 15 nM), peptide234 (5, 10 and 20 nM) or vehicle (0.7% fish saline) were added. The tissues were incubated at 22 ^ºC for 24 h in a CO₂ incubator maintained at 5% CO₂ atmosphere. After completion of the incubation, the tissues were stored in RNAlater at -80 ^ºC until processed for qPCR assays.

qPCR assay

The RNAlater- stored brain and ovary tissues were used for total RNA extraction using the RNeasy mini kit, according to the manufacturer’s protocol. The preparations were analyzed after resolving on a 2% agarose gel containing 2.2 M formaldehyde to determine the quality of RNA. Absorbance was taken at 260 and 280 nm, and the purity of RNA was checked by calculating the A260/A280 ratio. The preparations with a ratio of 2.0 or higher were used for the cDNA synthesis. Contamination of the RNA preparations with genomic DNA was checked by using non-reverse transcribed samples as templates and by treating the samples with DNAase I before the first strand cDNA synthesis. Total RNA (5 µg) was reverse transcribed using random hexamer primers and Revert Aid M-MuLV reverse transcriptase in a 20 µL reaction volume (first strand cDNA synthesis kit, Fermentas), using the manufacturer’s protocol. Gene-specific primers for catfish vt, ita, itb, cyp19a1a, cyp19a1b and β-actin were used in the PCR (Table 1). The primer specificity was checked by dissociation curve analysis. Quantitative PCR assays were performed in triplicate for different samples using the forward and reverse primers and VeriQuest TM SYBR Green qPCR master mix with ROX (Affymetrix, Inc. Cleveland, Ohio USA) in an ABI Prism 7500 thermal cycler (Applied Biosystems, Foster, CA, USA) at 95°C (15 s) and 60°C (1 min) for 40 cycles. Each sample was run in a final volume of 20 µL containing 1 µL of cDNA, 10 pM of specific primer, and 10 µL of SYBR Green PCR master mix. Specificity of amplicons was verified by melting curve analysis (60–95 ^ºC) after 40 PCR cycles. The details of the assays were described earlier (Chaube et al. 2015; Banerjee et al. 2015, 2018). As controls, the assays were performed without templates and reverse transcriptase. No amplification was observed in the control samples. Cycle threshold (Ct) values were obtained from the exponential phase of PCR amplification and the target gene expression was normalized against catfish β-actin expression to generate 2^−ΔΔCt values to quantify the target gene abundance (Livak and Schmittgen 2001). The catfish β-actin expression was shown to be stable in the earlier validation studies for this species (Chaube et al. 2017).

Table 1

Primers used in expression analysis of *H. fossilis cyp19a1b, cyp19a1a, vt, it, ita* and *β-actin*
Primers	Sequences (5’-3’)	Amplicon size	References
β-actin (DNA control)	Forward: TGGCCGTGACCTGACTGAC Reverse: CCTGCTCAAAGTCAAGAGCGAC	157 bp	Chaube et al. 2015
cyp19a1b	Forward: GTGCTGATCCAGCCTGACGTGTTCTT Reverse: TGTCAGGAGCAGCGATTACCATCTC	136bp	Chaube et al. 2015
cyp19a1a	Forward: AAACAGAACACTGAGGTGGAGAGAC Reverse: ATGTGTTTACCTACACAGGAACGAG	128bp	Chaube et al. 2015
vt	Forward: TGTTACATCCAGAACTGCCCCAGA Reverse: CAGCCAGTCCTTCTCCACAGCA	137bp	Banerjee et al. 2018
it	Forward: TCAATCTTCTGCATGCTGTGTCT Reverse: CACACGCCATGCACTGTCTATTG	118bp	Banerjee et al. 2018
ita	Forward: TCAATCTTCTGCATGCTGTGTCT Reverse: CACACGCCATGCACTGTCTATTG	120bp	Banerjee et al. 2018

Statistical analysis

The gene expression data were presented as the mean of Log RQ ± SEM. The control sample was taken as the calibrator to give a relative ratio of the mRNA expression. All data were checked for homogeneity and normality. The data showed a normal distribution in Kolmogorov-Smirno test and were analyzed by one way and two way analysis of variance (ANOVA) (P < 0.001), followed by Newman-Keuls’ multiple group test (P < 0.05) using the Statistical Package for the Social Sciences software program (version 10.0; SPSS).

In vivo and in vitro effects of Kiss and peptide 234 on brain nonapeptide mRNA expression

The administration of Kiss peptides elicited an overall significant effect on the expression of vt, ita and itb in the brain (Fig. 1; one way ANOVA, P < 0.001 (hKiss1: F_vt = 4.15, F_ita = 4.23, F_itb = 5.08; cfKiss2: F_vt = 6.18; F_ita = 4.73, F_itb = 4.96). The effects of hKiss1 and cfKiss2 on the mRNA expression varied significantly with a higher response of cfKiss2 (two way ANOVA, P < 0.001 (F_{vt Kiss1xKiss2} = 5.07; F_{itaKiss1xKiss2} = 5.93; F_{itbKiss1xKiss2} = 5.38). The low doses of 1 ng and 2 ng inhibited the expression, and the 3 ng dose upregulated the mRNA levels (Newman-Keuls’ test, P < 0.05). The effect (inhibition or stimulation) on vt expression was higher than that of the neutral peptides.

Under in vitro conditions, the hKiss1 treatment elicited an overall significant effect on the nonapeptide mRNA expression (Fig. 2; one way ANOVA, P < 0.01 (F_vt = 3.86, F_ita = 3.91, F_itb = 3.76). The stimulation of vt mRNA level was moderate in a concentration (5, 10 and 15 nM) - dependent manner (Newman-Keuls’ test, P < 0.05). While ita and itb expression was stimulated mildly at 5 and 10 nM, a differential response was elicited at 20 nM with the ita expression strongly upregulated and the itb expression only mildly stimulated. The cfKiss2 treatment produced an overall significant effect on the expression of vt (F = 4.80, P < 0.001), ita (F = 4.32, P < 0.01) and itb (F = 4.03; P < 0.01) in the one way ANOVA. The treatment stimulated the vt mRNA expression concentration-dependently (Newman-Keuls’ test, P < 0.05). The neutral peptide mRNA levels were highly stimulated at 10 nM, more than the vt expression and the ita expression was strongly upregulated at 15 nM with a fold change of 3.02, more than the itb expression. The hKiss1 and cfKiss2 effects were significantly different in the two way ANOVA (P < 0.001, F_{vt Kiss1xKiss2} = 6.73, F_{itb Kiss1xKiss2} = 6.12, F_{ita Kiss1xKiss2} = 6.84).

The administration of peptide 234 (5, 10, 20 ng/g BW) inhibited the mRNA expression dose-dependently (Fig. 3; one way ANOVA, P < 0.001 (F_vt = 6.41, F_ita = 10.17, F_itb = 6.82). At 20 ng dose, the vt and itb mRNA levels were strongly inhibited. The incubation of the brain with peptide 234 produced an overall significant effect on the mRNA expression (Fig. 4; one way ANOVA, P < 0.001; F_vt = 6.01, F_ita = 6.38, F_itb = 6.72) and inhibited the expression concentration-dependently (Newman-Keuls’ test, P < 0.05).

In vivo and in vitro effects of Kiss and peptide 234 on ovarian nonapeptide mRNA expression

Ovarian vt, ita and itb mRNA levels showed overall significant changes following the in vivo treatments with hKiss1 (P < 0.01; F_vt = 2.98, F_ita = 3.30, F_itb = 3.02) and cfKiss2 (P < 0.001; F_vt = 6.12, F_ita = 5.82, F_itb = 5.72; one way ANOVA; Fig. 5). Both peptides showed dose-related differences on the mRNA levels. The 1 ng hKiss1 dose inhibited, and the 3 ng dose stimulated the levels of all the mRNAs (Newman-Keuls’ test, P < 0.05). The 2 ng dose elicited mixed responses: inhibited vt expression, unchanged ita expression and elevated itb expression. The cfKiss2 inhibited the mRNA levels at the 1 ng dose, reduced insignificantly the expression at the 2 ng dose, and upregulated the expression at the 3 ng dose (P < 0.05). The hKiss1 and cfKiss2 effects varied significantly with higher responses of cfKiss2 in the two way ANOVA (F_{vt Kiss1xKiss2} = 8.17; F_{itbKiss1xKiss2} = 8.72; F_{itaKiss1xKiss2} = 7.56; P < 0.001).

The incubation of ovarian slices with hKiss1 produced overall significant effects on the nonapeptide mRNA expression (Fig. 6; one way ANOVA, P < 0.001 (F_vt = 9.14, F_ita = 8.52, F_itb = 8.36). The treatment resulted in an inhibition of the vt expression at 5 and 10 nM and an upregulation at 15 nM (Newman-Keuls’ test, P < 0.05). The neutral peptide mRNA levels, on the other hand, were stimulated equally at 5 and 10 nM, and further increased at 15 nM. The incubation of ovarian slices with cfKiss2 produced overall significant effects on the nonapeptide mRNA expression (Fig. 6; one way ANOVA, P < 0.001 (F_vt = 8.79, F_ita = 8.15, F_itb = 8.42). The expression was stimulated at all concentrations, with the highest expression at 15 nM (Newman-Keuls’ test, P < 0.05). The vt expression showed the highest increase at 15 nM compared to the neutral nonapeptide gene expression. The effects of hKiss1 and cfKiss2 were significantly different with higher responses of cfKiss2 (F_{vt Kiss1xKiss2} =11.32, F_{itaKiss1xKiss2} = 11.68, F_{itbKiss1xKiss2} = 11.46).

The administration of peptide 234 (5, 10, 20 ng/g BW) inhibited the mRNA expression concentration-dependently (Fig. 7; one way ANOVA, P < 0.001; F_vt = 4.28, F_itb = 5.07, F_ita = 6.17). Similarly, the incubation of the ovary slices with peptide 234 inhibited the mRNA expressions concentration-dependently (Fig. 8; one way ANOVA, P < 0.001; F_vt = 7.86, F_ita = 10.38, F_itb = 9.42; Newman-Keuls’ test, P < 0.05).

In vivo effects of Kiss and peptide 234 on cyp19a1b and cyp19a1a expression

The administration of hKiss1 and cfKiss2 elicited an overall significant effect on the brain-specific cyp19a1b and ovary-specific cyp19a1a expression (Fig. 9; one way ANOVA, P < 0.001; hKiss1- F_brain = 8.21, F_ovary = 7.82; cfKiss2- F_brain = 8.62, F_ovary = 8.17). The hKiss1 treatment stimulated the expression of cyp19a1b at 1 and 3 ng and inhibited it at 2 ng, but stimulated dose- dependently the expression of cyp19a1a (Newman-Keuls’ test, P < 0.05). On the other hand, cfKiss2 stimulated the expression of both cyp19a1b and cyp19a1a at all doses with high fold increases at 3 ng.

The administration of peptide 234 produced an overall significant effect on the cyp19a1b and cyp19a1a expression in the brain and ovary, respectively (Fig. 10; one way ANOVA, P < 0.001; F_cyp19a1b = 4.28, F_cyp19a1a = 4.88). The expression was inhibited dose-dependently (Newman-Keuls’ test, P < 0.05).

In vitro effects of Kiss and peptide 234 on cyp19a1b and cyp19a1a expression

Under in vitro, the incubation with hKiss1 and cfKiss2 caused an overall significant effect on the expression of cyp19a1b and cyp19a1a, respectively, in the brain and ovary (Fig. 11; one way ANOVA, P < 0.001; hKiss1- F_brain = 10.23, F_ovary = 10.62; cfKiss2- F_brain = 9.63, F_ovary = 9.05). The Newman-Keuls’ analysis showed that the treatments stimulated the transcript levels in a concentration-dependent manner with higher fold increases in the cfKiss2 groups (P < 0.05).

The incubation with peptide 234 produced an overall significant effect on cyp19a1b and cyp19a1a expression in the brain and ovary, respectively (Fig. 12; one way ANOVA, P < 0.001; F_cyp19a1b = 5.12, F_cyp19a1a = 5.47). While the expression of cyp19a1b was inhibited only at 20 nM, the expression of cyp19a1a was inhibited at all concentrations of peptide 234 (Newman-Keuls’ test, P < 0.05).

The study identifies, in addition to the Gnrh system, two more functional targets of Kiss peptides in the control of reproduction in the catfish. These targets are very much the components of the BPG endocrine axis and are acted upon by the Kiss peptides at both brain and ovarian levels. We have previously reported that both hKiss1 and cfKiss2 treatments stimulated gnrh1 and gnrh2 expression in the hypothalamus, pituitary and ovary, gonadotropin subunit gene expression in the pituitary, increased plasma and ovarian estradiol-17β, progesterone and 17,20β-dihydoxy-4-pregnen-3-one levels, germinal vesicle breakdown and ovulation (Chaube et al. 2022). The present findings compliment and strengthen the reproductive role of the Kiss peptides via additional pathways.

Kisspeptins and nonapeptide modulation

As stated in the Introduction, the NP genes, vt, itb and ita, were characterized and localized in the NPO and ovarian follicular layer of the catfish (Banerjee et al. 2015, 2018). The reproductive role of the NP was comprehensively studied in this species. Vt and Itb stimulated steroidogenesis, final oocyte maturation and ovulation, and follicular hydration at the ovarian level (Joy and Chaube 2015). Synthetic Vt, Itb and Ita were reported to stimulate gonadotropin subunit gene (fshβ, lhβ and Gpα) expression in the pituitary in vitro (Acharjee et al. 2018). The present study shows that the NP gene expression is controlled by the Kiss peptides. The NP genes are differentially modulated depending on the dosage/concentration of the Kiss peptides, experimental approaches and the concerned NP genes. The Kiss peptides elicited biphasic effects on the expression of the NP genes in vivo, albeit in a dose-dependent manner. The expression was inhibited strongly at low (1ng/g BW) dosage of Kiss1 and Kiss2, the inhibition was abolished partially or fully in the median dose (2 ng/g BW) dosage, and strongly upregulated in the high (3 ng/g BW) dosage. In contrast to the in vivo results, the NP gene expression was stimulated in vitro at all concentrations of the Kiss peptides. The biphasic responses in vivo may be due to other intervening mechanisms, which are absent under in vitro conditions. The most important mechanism identified across vertebrates is the estrogen sensitivity and feedback effects of the Kiss neurons, as shown in mammals (Wang and Moenter 2020). In fishes, different studies have reported that the Kiss mRNA expression is influenced by the estrogen status: as evident from seasonal, ovariectomy or E₂ treatment responses (Kanda et al. 2008, 2012; Mitani et al. 2010; Servili et al. 2011, Escobar et al. 2013). In the catfish, ovariectomy led to the downregulation of brain kiss2 expression and E₂ replacement reversed the effect (Chaube et al. 2020). Furthermore, tamoxifen (E₂ receptor antagonist) produced dosage-related changes in the brain and ovarian kiss2 expression. The results indicate that the brain and ovarian Kiss2 systems are subjected to E₂ feedback effects. That hKiss1 and cfKiss2 upregulated brain, and ovarian P450 arom gene expression (present data) supports this contention. The consequent increase in brain E₂ production may potentially invoke a local feedback control on the Kiss2 system.

In the present study, the endogenous peptide cfKiss2 elicited higher and significant expression changes in both brain and ovary compared to hKiss1. This is not surprising since Kiss1 is not the endogenous peptide in this species and the ligands may activate the receptors differently. In medaka and striped sea bass, both Gpr54-1 and Gpr54-2 are activated by Kiss1 and Kiss2 (Kanda et a. 2013; Zmora et al. 2015). Kiss2 activated the cAMP response element (cre) signalling more than Kiss1 in the medaka. In this species both Vt and It neurons expressed only gpr54-2 mRNA. In the striped sea bass M. saxatilis (Zmora et al. 2015), kiss2r and vt mRNAs are co-localized in the magnocellular neurons of the POA, and kiss1r and it neurons are co-expressed in the anterior periventricular nucleus. The Kiss1 antagonist peptide 234 and the Kiss2-specific antagonist peptide 359 inhibited the expression of vt mRNA in the POA (Zmora et al. 2015). In the catfish, though the Kiss receptors are not characterized, functional studies show that the reproductive effects (expression of gnrh1, gnrh2 and gonadotropin subunit mRNAs, and plasma and ovarian steroid hormone levels) of hKiss1 and cfKiss2 are inhibited by peptide 234 (Chaube et al. 2022). In the same manner, peptide 234 inhibited the expression of brain and ovarian vt, ita and itb both in vivo and in vitro in a dosage/concentration related manner suggesting that the Kiss actions are mediated by Kiss receptors. Whether the Kiss peptides employ both or a single type of Kiss receptors needs characterization of the receptors in the catfish in future studies.

Kisspeptins and P450 aromatase expression

The in vivo and in vitro Kiss peptide treatments stimulated the expression of cyp19a1a in the ovary and cyp19a1b in the brain. In this case also, cfKiss2 was more effective to upregulate the expression at all dosages/concentrations, suggesting a higher efficacy of the native peptide. The brain-specific cyp19a1b transcripts responded to the Kiss peptides more strongly, especially at the higher dosages/concentrations. Both cyp19a1a and cyp19a1b expression was inhibited by peptide 234, suggesting the involvement of Kiss receptors, as discussed above. The in vivo stimulation was more pronounced than that under in vitro and cyp19a1b responded significantly only at 20 nM in vitro. The stimulatory effects on the transcript levels may result in enhanced synthesis of estrogens in these tissues. The localization of cyp19a1a and kiss2 transcripts in the granulosa cells (Chaube et al. 2015, 2020) suggests the possibility of autocrine/paracrine control of the enzyme transcription (see below). The localization of NP mRNA transcripts in the granulosa layer (Banerjee et al. 2016, 2018) and modulation of E₂ secretion by Vt and Itb (Singh and Joy 2009) implies functional interactions among the Kiss2- P450 aromatase – NP systems. In this functional triad, Kiss may upregulate P450 arom and NP mRNA expression independently and NP stimulates E₂ secretion, under the influence of intrinsic and extrinsic environmental inputs.

In the catfish, cyp19a1b has a wide distribution in the brain especially in the telencephalon and hypothalamus (Chaube et al. 2015; Mishra and Chaube 2016), as in other teleosts (Forlano et al. 2001; Marsh et al. 2006; Diotel et al. 2010). The POA containing the NPO shows the highest immunoreactivity for Cyp19a1b, followed by the hypothalamus in different species (Diotel et al. 2010), indicating these forebrain areas (neuroendocrine centers) as major sites of neuroestrogen synthesis. Aromatase B (Cyp19a1b) - immunoreactive fibers and cell bodies were described in close association with Vt - immunoreactive neurons in the POA of the bluehead wrasse Thalassoma bifasciatum (Marsh et al. 2006). In the catfish, dense cyp19a1b mRNA signals were reported in the POA in the vicinity of the NPO using specific riboprobes (Mishra and Chaube 2016). Furthermore, brain E₂ elicited seasonal and brain regional differences (Chaube and Mishra 2012). Conversely, NPO neuronal perikarya/processes lies in, or extends to the ependymal layer forming cerebro-spinal fluid (csf)-contacting structures (Banerjee et al. 2016, 2018). Thus, in the POA, so far the evidence shows that Kiss2 is co-localized with NP-positive NPO neurons that are in anatomical proximity with the cyp19a1b- positive radial glial cells. As in the ovary, the existence of a functional triad of these regulatory systems is operative in the POA. Since peptide 234 inhibited the expression of NP and cyp19a1b mRNAs, a Kiss receptor-mediated autocrine/paracrine control is indicated in the brain too.

The Kiss regulation of P450 arom gene expression is reported apparently for the first time in this study. This finding along with the previously reported estrogen regulation of brain Kiss2 expression in the catfish (Chaube et al. 2020) indicates the existence of reciprocal functional relationships between the two systems both at the brain and ovary. The mechanism by which Kiss peptides act on the expression of P450 arom genes is not known. Since peptide 234 inhibited the expression, a receptor-mediated mechanism is the first step. In MCF7 (ER-positive) and SKBR3 (ER-negative) breast cancer cell lines, Kiss1 induced CYP19A1 and kiss receptor (GPR54) mRNA expression, which was abolished by the kiss receptor inhibitor in MCF7 cells (Yilmaz et al. 2019). In the SKBR3 cells, Kiss1 increased GPR54 mRNA expression without the induction of CYP19A1, suggesting the involvement of estrogen receptor mechanisms. In the proximal promoter region of brain-specific cyp19a1b of several species, a well conserved estrogen-responsive element (ERE) sequence is identified (see review: Diotel et al. 2010), indicating upregulation of the transcriptional activity. Since the Kisspeptides stimulated plasma E₂ levels (Chaube et al. 2022) in the catfish, the stimulated E₂, through feedback action, might have activated promoter activity of the cyp19a1b in the brain. Our data suggest that Kiss peptides have a functional role in neurogenesis via neuroestrogen synthesis, in addition to reproductive functions. The fact that EREs are present in the promoter region of cyp19a1b of several species including channel catfish, but not in the promoter region of cyp19a1a (only ERE half sites in medaka and tilapia) (Piferrer and Bla´zquez 2005), raises questions on the involvement of an E₂- mediated mechanism in the upregulation of ovarian cyp19a1a by the Kiss peptides. It is plausible that other potential regulators like Ad4BP/SF-1, GATA, SF-1, Sox, SRY and WT1-KTS, as reported in mammals (Piferrer and Bla´zquez 2005), may be involved in the activation of the ovary-specific cyp19a1a. The Kiss peptides may activate these regulators, and future studies on these lines will be rewarding.

The study shows that the Kiss peptides have multiple functional targets apart from the primary stimulation of the Gnrh system. These functional relationships in the catfish are schematically presented in Fig. 13. hKiss1 and cfKiss2 modulated NP and P450 aromatase gene expression in the brain and ovary, cfKiss2 being more effective. The Kiss peptide effects were inhibited by peptide 234, the Kiss receptor inhibitor. The additional pathways of Kiss actions contribute to the complexity of the regulatory mechanisms controlling the BPG axis. In the brain, the upregulation of cyp19a1b suggests a role of the Kiss peptides in neurogenesis.

Acknowledgments

The research was partly supported by grants from Department of Science and Technology, New Delhi (Fund for Improvement of S & T infrastructure) and Banaras Hindu University, Varanasi (Institute of Excellence) to Department of Zoology. The authors are thankful to BHU-Department of Biotechnology, New Delhi – Interdisciplinary School of Life Science for the qPCR facility.

Ethical approval

The experiments were conducted according to the guidelines of the Animal Ethics Committee of Banaras Hindu University, Varanasi

Funding

No specific funding is involved in this study other than mentioned under Acknowledgments

Conflict of interest

The authors declare no conflict of interests

Author contributions

RC and KPJ designed the experiments. SS conducted the experiments and collated and analysed the data. RC re-analysed the data and prepared the initial draft. KPJ finalized the writing of the manuscript. All the authors read, corrected and approved the final version of the manuscript for publication.

Data availability

Raw data and materials will be available on request.

Consent to participate

Not applicable

Consent for publication

Not applicable

Acharjee A, Chaube R, Joy KP (2018) Reproductive stage- and sex-dependent effects of neurohypophyseal nonapeptides on gonadotropin subunit mRNA expression in the catfish Heteropneustes fossilis: An in vitro study. Gen Comp Endocrinol 260: 80-89. doi: 10.1016/j.ygcen.2018.01.001
Banerjee P, Chaube R, Joy KP (2015) Molecular cloning, sequencing and tissue expression of vasotocin and isotocin precursor genes from Ostariophysian catfishes: phylogeny and evolutionary considerations in teleosts. Front Neurosci 9: 166. http://dx.doi.org/10.3389/fnins.2015.00166
Banerjee P, Chaube R, Joy KP (2016) In situ localization of vasotocin and isotocin precursor mRNA in brain and ovary of the catfish Heteropneustes fossilis and estrogen regulation of the gene expression. J Transl Neurosci 1:2
Banerjee P, Chaube R, Joy KP (2018) Molecular cloning and characterisation of an isotocin paralogue ([V8] isotocin) in catfishes (superorder Ostariophysi): Origin traced likely to the fish‐specific whole genome duplication. J Neuroendocrinol 30: e12647. doi: 10.1111/jne.12647
Chaube R, Mishra S (2012) Brain steroid contents in the catfish Heteropneustes fossilis: sex and gonad stage-specific changes. Fish Physiol Biochem 38:757–767. DOI 10.1007/s10695-011-9558-0
Chaube R, Rawat A, Joy KP (2015) Molecular cloning and characterization of brain and ovarian cytochrome P450 aromatase genes in the catfish Heteropneustes fossilis: Sex, tissue and seasonal variation in, and effects of gonadotropin on gene expression. Gen Comp Endocrinol 221: 120-133. http://dx.doi.org/10.1016/j.ygcen.2015.06.004
Chaube R, Rawat A, Inbaraj RM, Bobe J, Guiguen Y, Fostier A, Joy KP (2017). Identification and characterization of a catechol-o-methyltransferase cDNA in the catfish Heteropneustes fossilis: tissue, sex and seasonal variations, and effects of gonadotropin and 2-hydroxyestradiol-17β on mRNA expression. Gen Comp Endocrinol 246: 129–141
Chaube R, Sharma S, Senthilkumaran B, Bhat SG, Joy KP (2022)
Kisspeptins stimulate the hypothalamus - pituitary - ovarian axis and induce final oocyte maturation and ovulation in female stinging catfish (Heteropneustes fossilis): Evidence from in vivo and in vitro studies. Aquaculture 548: 737734
Clarkson J, Herbison AE (2006) Postnatal development of kisspeptin neurons in mouse hypothalamus; sexual dimorphism and projections to gonadotropin- releasing hormone neurons. Endocrinology 147: 5817–5825
Cheng G, Coolen LM, Padmanabhan V, Goodman RL, Lehman MN (2010) The Kisspeptin/Neurokinin B/Dynorphin (KNDy) cell population of the arcuate nucleus: sex differences and effects of prenatal testosterone in sheep. Endocrinology 151: 301–311
de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL, Milgrom E (2003) Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc Natl Acad Sci USA 100: 10972–10976
Diotel N, DoRego J-L, Anglade I, Vaillant C, Pellegrini E, Vaudry H, Kah O (2011) The brain of teleost fish, a source, and a target of sexual steroids. Front Neurosci 5 (137): 1–14. https://doi.org/10.3389/fnins.2011.00137
Escobar S, Felip A, Gueguen MM, Zanuy S, Carrillo M, Kah O, et al. (2013) Expression of kisspeptins in the brain and pituitary of the European sea bass (Dicentrarchus labrax). J Comp Neurol 521(4): 933–48. doi:10.1002/ cne.23211
Fairgrieve MR, Shibata Y, Smith EK, Hayman ES, Luckenbach JA (2016)
Molecular characterization of the gonadal kisspeptin system: cloning, tissue distribution, gene expression analysis and localization in sablefish (Anoplopoma fimbria). Gen Comp Endocrinol 225: 212–223
Filby AL, Aerle RV, Duitman J, Tyler CR (2008) The kisspeptin/gonadotropin-releasing hormone pathway and molecular signaling of puberty in fish. Biol Reprod 78 (2): 278–289. https://doi.org/10.1095/biolreprod.107.063420
Forlano PM, Deitcher DL, Myers DA, Bass AH (2001) Anatomical distribution and cellular basis for high levels of aromatase activity in the brain of teleost fish: aromatase enzyme and mRNA expression identify glia as source. J Neurosci 21(22): 8943–8955
Gopurappilly R, Ogawa S, Parhar IS (2013) Functional significance of GnRH and kisspeptin, and their cognate receptors in teleost reproduction. Front Endocrinol 4: 24. https://doi.org/10.3389/fendo.2013.00024
Herbison AE, d’Anglemont de Tassigny X, Doran J, Colledge WH (2010) Distribution and postnatal development of Gpr54 gene expression in mouse brain and gonadotropin-releasing hormone neurons. Endocrinology 151: 312–321
Hrabovszky E (2014) Neuroanatomy of the human hypothalamic kisspeptin system. Neuroendocrinology 99: 33–48
Joy KP, Chaube R (2015) Vasotocin – A new player in the control of oocyte maturation and ovulation in ﬁsh. Gen Comp Endocrinol 196: 91-99. http://dx.doi.org/10.1016/j.ygcen.2015.02.013
Kanda S, Akazome Y, Matsunaga T, Yamamoto N, Yamada S, et al. (2008) Identification of KiSS-1 product kisspeptin and steroid-sensitive sexually dimorphic kisspeptin neurons in medaka (Oryzias latipes). Endocrinology 149: 2467–2476
Kanda S, Oka Y (2012) Evolutionary insights into the steroid sensitive kiss1 and kiss2 neurons in the vertebrate brain. Front Endocrinol 3: 28. https://doi.org/10.3389/ fendo.2012.00028
Kanda S, Akazome Y, Mitani Y, Okubo K, Oka Y (2013) Neuroanatomical evidence that kisspeptin directly regulates isotocin and vasotocin neurons. PLoS ONE 8(4): e62776. doi:10.1371/journal.pone.0062776
Klenke U, Zmora N, Stubblefield J, Zohar Y (2011) Expression patterns of the kisspeptin system and GnRH1 correlate in their response to gonadal feedback in female striped bass. Indian J Sci Technol 4: 33–34
Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, Le Poul E, Brézillon S, Tyldesley R, Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN, Vassart G, Parmentier M (2001) The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J Biol Chem 276, 34631–34636
Lee YR, Tsunekawa K, Moon MJ, Um HN, Hwang JI, Osugi T, Otaki N, Sunakawa Y, Kim K, Vaudry H, Kwon HB, Seong JY, Tsutsui K (2009) Molecular evolution of multiple forms of kisspeptins and GPR54 receptors in vertebrates. Endocrinology 150: 2837–2846. https://doi.org/10.1210/en.2008-1679
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2-DDCT method. Methods 25: 402–408. https://doi.org/10.1006/meth.2001.1262
Marsh KE, Creutz LM, Hawkins MB, Godwin J (2006) Aromatase immunoreactivity in the bluehead wrasse brain, Thalassoma bifasciatum: immunolocalization and coregionalization with arginine vasotocin and tyrosine hydroxylase. Brain Res 1126 (1): 91–101
Messager S, Chatzidaki EE, Ma D, Hendrick AG, Zahn D, Dixon J, Thresher RR, Malinge I, Lomet D, Carlton MB et al. (2005) Kisspeptin directly stimulates gonadotropin-releasing hormone release via G protein-coupled receptor. Proc Natl Acad Sci 102: 1761–1766
Menuet A, Anglade I, Le Guevel R, Pellegrini E, Pakdel F, Kah O (2003) Distribution of aromatase mRNA and protein in the brain and pituitary of female rainbow trout: comparison with estrogen receptor alpha. J Comp Neurol 462(2):180-193. doi: 10.1002/cne.10726
Mishra S, Chaube R (2016) Localization of P450 aromatase in the brain of adult catfish Heteropneustes fossilis and regional distribution of estradiol-17b and testosterone: Gender and seasonal differences. J Neurol Neurosci 7: 77
Mitani Y, Kanda S, Akazome Y, Zempo B, Oka Y (2010) Hypothalamic Kiss1 but not Kiss2 neurons are involved in estrogen feedback in medaka (Oryzias latipes). Endocrinology 151: 1751–1759
Navarro VM, Castellano JM, McConkey SM, Pineda R, Ruiz-Pino F, Pinilla L, Clifton DK, Tena-Sempere M, Steiner RA (2011) Interactions between kisspeptin and neurokinin B in the control of GnRH secretion in the female rat. Am J Physiol Endocrinol Metab 300: E202–E210. doi:10.1152/ajpendo.00517.2010
Oakley AE, Clifton DK, Steiner RA, (2009) Kisspeptin signaling in the brain. Endocr Rev 30: 713–743
Ohga H, Selvaraj S, Matsuyama M (2018) The roles of kisspeptin system in the reproductive physiology of fish with special reference to chub mackerel studies as main axis. Front Endocrinol 9: 147. https://doi.org/10.3389/fendo.2018.00147
Pasquier J, Lafont AG, Tostivint H, Vaudry H, Rousseau K, Dufour S (2012) Comparative evolutionary histories of kisspeptins and kisspeptin receptors in vertebrates reveal both parallel and divergent features. Front Endocrinol 3:173. https://doi.org/10.3389/fendo.2012.00173
Peng J, Tang M, Zhang BP, Zhang P, Zhong T, Zong T et al. (2013) Kisspeptin stimulates progesterone secretion via the Erk1/2 mitogen-activated protein kinase signaling pathway in rat luteal cells. Fertil Steril 99:1436–1443.e1. doi:10.1016/j.fertnstert.2012.12.008
Piferrer F, Bla´zquez M (2005) Aromatase distribution and regulation in fish.
Fish Physiol Biochem 31:215–226. DOI 10.1007/s10695-006-0027-0
Scott V, Brown CH (2011) Kisspeptin activation of supraoptic nucleus neurons in vivo. Endocrinology 152: 3862–3870. doi: 10.1210/en.2011-1181
Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno JS Jr, Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM, Hendrick AG, Zahn D, Dixon J, Kaiser UB, Slaugenhaupt SA, Gusella JF, O’Rahilly S, Carlton MB, Crowley WF Jr, Aparicio SA, Colledge WH (2003) The GPR54 gene as a regulator of puberty. New Engl J Med 349: 1614–1627
Servili A, Le Page Y, Leprince J, Caraty A, Escobar S, Parhar IS, Seong JY, Vaudry H, Kah O (2011) Organization of two independent kisspeptin systems delivered from evolutionary-ancient kiss genes in the brain of zebrafish. Endocrinology 152: 1527–1540. https://doi.org/10.1210/en.2010-0948
Smith JT, Cunningham MJ, Rissman EF, Clifton DK, Steiner RA (2005)
Regulation of Kiss1 gene expression in the brain of the female mouse. Endocrinology 146: 3686–3692
Singh V, Joy KP (2009). Relative in vitro seasonal effects of vasotocin and isotocin on ovarian steroid hormone levels in the catfish Heteropneustes fossilis. Gen Comp Endocrinol 162: 257-264
Somoza GM, Mechaly AS, Trudeau VL (2020) Kisspeptin and GnRH interactions in the reproductive brain of teleosts. Gen Comp Endocrinol 298: 113568 https://doi. org/10.1016/j.ygcen.2020.113568
Song Y, Duan X, Chen J, Huang W, Zhu Z, Hu W (2015) The distribution of kisspeptin (kiss) 1-and kiss2-positive neurones and their connections with gonadotrophin-releasing hormone-3 neurones in the zebrafish brain. J Neuroendocrinol 27 (3): 198–211. https://doi.org/10.1111/jne.12251
Ten SC, Gu SY, Niu YF, An XF, Yan M, He M (2010) Central administration of kisspeptin-10 inhibits water and sodium excretion of anesthetized male rats and the involvement of arginine vasopressin. Endocr Res 35:128–136
Terasawa E (2018) Neuroestradiol in regulation of GnRH release. Horm Behav 104: 138–145. doi:10.1016/j.yhbeh.2018.04.003
Wang B, Mechaly AS, Somoza GM (2022) Overview and new insights into the diversity, evolution, role, and regulation of kisspeptins and their receptors in teleost fish. Front Endocrinol 13: 862614. doi: 10.3389/fendo.2022.862614
Wang L, Moenter SM (2020) Differential roles of hypothalamic AVPV and arcuate kisspeptin neurons in estradiol feedback regulation of female reproduction. Neuroendocrinology 110:172–184. DOI: 10.1159/000503006
Yilmaz MB, Oksuz H (2019) The role of kisspeptin on aromatase expression in breast cancer. Bratislava Med J.119 (12): 776-780. DOI: 10.4149/BLL_2018_141
Zmora N, Stubblefield JD, Wong T-T, Levavi-Sivan B, Millar RP, Zohar Y (2015) Kisspeptin antagonists reveal kisspeptin 1 and kisspeptin 2 differential regulation of reproduction in the teleost, Morone saxatilis. Biol Reprod 93(3):76, 1–12. DOI 10.1095/biolreprod.115.131870

No competing interests reported.

Download PDF

Journal Publication

published 15 Nov, 2023

Read the published version in Fish Physiology and Biochemistry →

Editorial decision: Major revision
04 Jul, 2023
Reviews received at journal
14 Jun, 2023
Reviewers agreed at journal
12 Jun, 2023
Reviewers agreed at journal
21 May, 2023
Reviewers invited by journal
13 Oct, 2022
Editor assigned by journal
01 Oct, 2022
Submission checks completed at journal
27 Sep, 2022
First submitted to journal
19 Sep, 2022

You are reading this latest preprint version

Kisspeptin modulation of nonapeptide and cytochrome P450 aromatase mRNA expression in the brain and ovary of the catfish Heteropneustes fossilis: in vivo and in vitro studies

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Material And Methods

Statistical analysis

Results

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1