Artificial microRNA suppresses C9ORF72 variants and decreases toxic dipeptides in vivo

doi:10.21203/rs.3.rs-2081412/v1

Download PDF

Article

Artificial microRNA suppresses C9ORF72 variants and decreases toxic dipeptides in vivo

https://doi.org/10.21203/rs.3.rs-2081412/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 26 Sep, 2023

Read the published version in Gene Therapy →

You are reading this latest preprint version

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that affects motor neurons, causing progressive muscle weakness and respiratory failure. The presence of an expanded hexanucleotide repeat in chromosome 9 open reading frame 72 (C9ORF72) accounts for most cases of familial ALS and frontotemporal dementia (FTD). To determine if suppressing expression of C9ORF72 gene products can reduce toxicity, we designed a set of artificial microRNAs (amiRNA) targeting the human C9ORF72 gene. Here we report that an AAV9-mediated amiRNA significantly suppresses expression of the C9ORF72 mRNA, protein, and toxic poly-dipeptides generated by the expanded repeat in the brain and spinal cord.

Amyotrophic lateral sclerosis is a lethal neurodegenerative disease that affects approximately 2 in every 100,000 people worldwide (1). ALS patients develop progressive muscle wasting and respiratory failure and have an average life expectancy of 2–5 years after symptom onset (2). A hexanucleotide repeat expansion (HRE) consisting of GGGGCC_n in intron 1 of the Chromosome 9 Open Reading Frame 72 (C9ORF72) gene is the most common cause of both inherited (40%) and sporadic (5–6%) ALS (3–5) as well as the most common genetic cause of frontotemporal dementia (FTD) (6). Healthy individuals typically harbor 2–24 repeats, while patients with C9ORF72 ALS harbor hundreds or even thousands of the repeats (7, 8). While the repeat length varies in number in different tissues, the most extensive expansions observed to date are in the brain (9, 10).

Three main splice variants have been validated by NCBI as the major products of the C9ORF72 gene: Variant 1 (NM_145005.5), Variant 2 (NM_018325.3), and Variant 3 (NM_001256054.1). Variants 1 and 3 contain the hexanucleotide expansion and are the least abundant; by contrast, the most abundant variant, V2, does not encompass the expansion. C9ORF72 is involved in multiple processes, including endosomal trafficking, nucleocytoplasmic transport, autophagy induction, and lysosomal biogenesis in diverse cell types, including motor neurons (11, 12). The HRE appears to exert diverse adverse effects.

The HRE gives rise to three pathological hallmarks of C9ORF72 ALS: (1) haploinsufficiency, with reduced levels of mRNA leading to compromised neuronal viability (12, 13); (2) nuclear accumulation of sense and antisense transcripts of the C9ORF72 HRE that sequester RNA binding and/or splicing proteins, forming RNA foci (3, 14, 15); (3) repeat-associated non-ATG (RAN) translation of sense and antisense transcripts generating toxic poly-dipeptides (glycine-alanine (GA), glycine-proline (GP), and glycine-arginine (GR) poly-dipeptides in the sense direction and GP, proline-alanine (PA), and proline-arginine (PR) in the anti-sense direction (15, 16)). These aggregation-prone poly-dipeptides are found in the CNS and cerebrospinal fluid of C9ORF72-ALS and FTD patients (16–18) and are toxic in cell culture (19–21) and in animal models (22–24). Although the full mechanisms by which the HRE causes motor neuron death are unknown, studies suggest a prominent role for the two gain of function pathologies, toxic poly-dipeptides and RNA foci. Haploinsufficiency of C9ORF72 by itself does not lead to motor neuron death as C9orf72 knockout mice do not show a motor phenotype. It is likely that there is evidence for a cooperative pathogenesis between gain- and loss-of-function mechanisms, in which C9ORF72 haploinsufficiency impairs clearance of poly-dipeptides, making motor neurons hypersensitive to poly-dipeptide pathology (12).

Currently, treatment options in ALS are restricted to two FDA-approved medications that demonstrate only modest clinical efficacy (riluzole (25) and edaravone (26, 27)). To develop an effective treatment for C9ORF72-mediated ALS, we have explored the use of RNA interference (RNAi) to achieve post-transcriptional suppression of the C9ORF72 gene. We hypothesized that adeno-associated virus (AAV) administered via the cerebrospinal fluid will provide access to the cytoplasm of cells in the central nervous system and permit delivery of an artificial microRNA (amiR) targeting C9ORF72 transcripts. Silencing of C9ORF72 in this manner should reduce cytoplasmic levels of C9ORF72 transcripts, including transcripts carrying the disease-causing repeat expansion. While the amiR, which is expressed in the cytoplasm, is not expected to permeate the nucleus and affect RNA foci, it is expected to depress levels of cytoplasmic C9ORF72 transcripts containing the HRE, thereby ameliorating extra-nuclear toxicity from poly-dipeptides.

amiRNA design and cloning

A 22-nucleotide artificial miRNA against exon 3 of the C9ORF72 gene was designed and cloned into the miR-155 backbone. The artificial miR was cloned into two entry plasmids. The first was in the 3’UTR of a GFP encoding AAV proviral plasmid under the control of the chicken beta actin (CB) promoter with a CMV enhancer. The second was in a plasmid containing H1 promoter driving the miR a CMV enhancer followed by a CB promoter diving the expression of GFP. Both were packaged into rAAV9 vectors.

Table 1

amiRNA Target sequences
amiR	Oligo Sequence	Target Exon
amiR123	Top strand: 5'- TGCTGTTTGGAGCCCAAATGTGCCTTGTTTTGGCCACTGACTGACAAGGCACATGGGCTCCAAA − 3' Bottom strand: 5'- CCTGTTTGGAGCCCATGTGCCTTGTCAGTCAGTGGCCAAAACAAGGCACATTTGGGCTCCAAAC − 3'	3
amiRC9	Top strand: 5'- TGCTGTATAGCACCACTCTCTGCTAAGTTTTGGCCACTGACTGACTTAGCAGAGTGGTGCTATA − 3' Bottom strand: 5'- CCTGTATAGCACCACTCTGCTAAGTCAGTCAGTGGCCAAAACTTAGCAGAGAGTGGTGCTATAC − 3'	3
amiR228	Top strand: 5'- TGCTGTTTACATCTATAGCACCACTCGTTTTGGCCACTGACTGACGAGTGGTGATAGATGTAAA − 3' Bottom strand 5'- CCTGTTTACATCTATCACCACTCGTCAGTCAGTGGCCAAAACGAGTGGTGCTATAGATGTAAAC − 3'	3
amiR496	Top strand: 5'- TGCTGAATACTCTGACCCTGATCTTCGTTTTGGCCACTGACTGACGAAGATCAGTCAGAGTATT − 3' Bottom strand: 5'- CCTGAATACTCTGACTGATCTTCGTCAGTCAGTGGCCAAAACGAAGATCAGGGTCAGAGTATTC − 3'	4–5

Cell culture

For plasmid screening, HEK293T cells were seeded (1.2 E5 cell/ml) in a 24 well plate, maintained with DMEM media (11995-073; Gibco), 10% Fetal Bovine Serum FBS (F-0926, Sigma-Aldrich) and 1% Penicillin/Streptomycin (30-001-CI, Corning). The cells were transfected after 24h using jetPRIME Reagent (Polyplus) and 1µg of each plasmid DNA (CB-GFP, CB-GFP-amiRs) (Table 1). Forty-eight hours post-transfection, GFP expression was visually assessed; cells were rinsed with PBS and collected using Trizol Reagent (Gibco BRL, Life Technologies, NY, and USA) for RNA isolation.

For primary cortical neuron experiments, homozygous BAC112 mice (JAX Stock# 023099) were crossed with female WT C57BL/6 mice to generate heterozygous embryos. Cortical cells were dissected at embryonic day 15 and pooled from multiple embryos. Mouse cortical cells were seeded at 50,000 cells/cm² in six well plates treated with poly-d-lysine (P4707; Sigma-Aldrich) and four-well chamber slides (154917; Thermo Scientific). Cells were maintained with Neurobasal media (21103049; Invitrogen), Glutamax (35050-061; Invitrogen), 2% Penicillin-Streptomycin (15110122; Invitrogen) and B27 supplement (17504-001; Invitrogen). At day in vitro four (DIV4) cells were infected with rAAV9-CB-GFP and rAAV9-H1-amiRC9-CB-GFP at a MOI of 50,000. At DIV10, cells were rinsed with PBS and collected for RNA or protein isolation or for RNA foci analysis.

Animal experiments

All mouse experiments were conducted at UMASS medical school following strict protocols approved by the Institutional review board. For animal studies we used heterozygous BAC112 mice (JAX Stock# 023099, previously described by O’Rourke (29)). Homozygous male BAC112 mice were crossed with female WT C57BL/6 mice to generate heterozygous mice.

Bilateral striatal injections

Heterozygous BAC112 mice were age 4–6 months, gender and copy number matched, into three groups: PBS, rAAV9-CB-GFP, rAAV9-H1-amiRC9-CB-GFP. Mice were anesthetized with an intraperitoneal injection of Ketamine (100mg/kg) and Xylazine (10mg/kg). Mice were positioned in a stereotaxic frame following (Stoica, Lorelei et al. “AAV-Mediated Gene Transfer to the Mouse CNS.” Current protocols in microbiology 0 14 (2013): Unit14D.5. PMC. Web. 20 Apr. 2018). Sterile disposable scalpels (Dynarex # 4111) were used to cut through the skin. Following Stereotaxic Atlas coordinates for the striatum, the skull was drilled at positions (AP + 1, ML+-2, DV-2.5). The mice were injected at a 0.5nl/ml flow with a volume of 5 µl per side, at a final dose of 1E11 GC per mouse. Tissues were collected 16 weeks post injections. The animals were PBS cardiac perfused and the brain dissected. Brains were placed in an acrylic 1MM mouse Matrix (CP68-1175-1 SouthPoint surgical supply) and sections 2–6 were taken. A GFP positive 2mm punch encompassing the injection site, was taken and used for either RNA or protein. The samples were flash frozen in liquid nitrogen and stored in a -80 freezer for tissue processing.

ICV injections in Neonates

Postnatal day 1 pups were separated from their mother and individually anesthetized with isoflurane and placed on a heated pad. Prior to the injection, special adaptors RN Compression fitting 1mm Catalog # 55750-01 were used to attach to the Hamilton Syringe 10µl, gastight model: 1701 RN, and Micro-capillary FHC: Borosil 1.0 mm OD x 0.5mm ID/Fiber (100mm, 250 pack) were pulled in a Sutter Instrument: P-97 Flaming/Brown Micropipette puller. The pups were injected with 2µl of vector into the lateral ventricle of each hemisphere, 2mm from the transverse sinus and 1mm to either side of the superior sagittal sinus, to a depth of 2 mm. Afterwards, they were placed on a heating pad until they regained consciousness. The pups were then rubbed against the bedding and placed back with the mother. Multiple litters were injected with the vectors: AAV9-CB-GFP ~ 8.5E12 GC; AAV9- CB-GFP-amiRC9 ~ 1E13 GC; AAV9-H1-amiRC9-CB-GFP ~ 5E12 GC. Animals were euthanized 16 weeks post injection. Following a 3-minute cardiac perfusion using PBS, the whole brain and spinal cord were extracted, and the frontal lobe was dissected. The left side was flash frozen, and the right side was embedded in OCT for cryo-sectioning and staining.

Temporal vein injections in Neonates

Postnatal day 1 pups were separated from their mother and individually anesthetized with isoflurane and placed on a heated pad. A Hamilton Syringe 10µl, gastight model: 1701 RN was used to inject 50µl of vector at a final dose of 2E11 GC. We used the same vectors as described for the ICV treatment. After injection the pups were rubbed against their bedding to prevent rejection from their mother and placed back in the cage. Mice were culled 16 weeks post injection following the same collection procedure as for the ICV samples.

Laser Capture Microdissection of motor neurons

Flash-frozen cervical cords were cryo-sectioned into 7µm thick sections and collected on VWR VistaVision™ HistoBond® Adhesive Microscope Slides (Germany) glass slides. Sections were first treated with RNAlater™-ICE (AM7030, Invitrogen, USA), which was followed by staining using a Histogene™ LCM Frozen Section Staining Kit (KIT0401, Applied biosystems). Then sections were fixed and dehydrated with 70-95-100% ethanol followed by xylene. LCM was then performed using the ArcturusXT™ Laser Capture Microdissection system (ThermoFisher, Waltham, MA, USA). The motor neurons were captured on CapSure™ Macro LCM Caps (LCM0211, ThermoFisher, Waltham, MA, USA). Three caps per animal were collected with approximately ~ 200 ventral horn motor neurons per cap.

RNA extraction, cDNA synthesis, DNA extraction and ddPCR

Frozen tissue samples were homogenized in a gentleMACS Dissociator (Miltenyi Biotec, USA) before total RNA extraction with Trizol (Life Technologies, USA) following manufactures protocol. For RNA extraction of cells, samples were collected in Trizol reagent (Gibco, Life Technologies), the aqueous phase was added to a Zymo column for RNA purification following the Zymo Direct-zol (Zymo research R2050) extraction protocol. RNA extraction of LCM isolated motor neurons was executed using the PicoPure RNA extraction kit following manufactures instructions and sent to a bio-analyzer for RNA concentration and quality. Reverse transcription to cDNA was performed using a High-Capacity RNA-to-cDNA Kit (Life Technologies). cDNA was diluted and a master mix was prepared for Droplet Digital PCR (ddPCR).

ddPCR was run as a 20µl reaction containing ddPCR Supermix for Probes (no dUTP) (Bio-Rad, Gladesville, NSW, Australia), cDNA or gDNA, 1µl of each primer/probe (20x). The 20µl sample, along with 70µl of ddPCR-oil was loaded into a DG8 cartridge and covered with a gasket according to manufacturer’s instructions; the cartridge was then placed in a QX100 droplet generator. Into a 96 well PCR plate 40µl of sample was transferred and then placed in a PCR thermocycler (Eppendorf, North Ryde, NSW, and Australia). The plate was then placed in the QX100 ddPCR reader (Bio-Rad, Gladesville, NSW, Australia) for quantification.

To measure C9ORF72, assays with FAM labels that detect each variant were used; mouse HPRT with a HEX label was used as an endogenous control (Table 2). Ratios were obtained by dividing absolute values from each variant to HPRT. Samples were normalized in respect to GFP controls. GraphPad Prism Program was used to graph and run One-way ANOVAs for three biological replicates.

To detect the mature amiRC9 product of rAAV9-H1-amiRC9-Cb-GFP, the RNA extracted from cells or tissue was further diluted to 10ng/µl. cDNA was generated using the TaqMan microRNA reverse transcription kit (4366597; Life Technologies). We used a custom TaqMan small RNA assay that detects the mature artificial microRNA C9 (Table 2) and used small nuclear RNA 135 as an endogenous control. For comparing the expression levels of amiRC9 with an endogenous microRNA, we used miR128a (Table 2) which had demonstrated to be highly expressed in the brain.

Copy number variance (CNV) of the C9ORF72 transgene in BAC 112 mice was measured as follows: brains were fresh frozen and cut in a sagittal section to extract DNA. Tissues were lysed overnight at 55⁰C, RNAse treated and eluted following manufacturer’s instructions (Gentra Puregene Tissue Kit, Qiagen). The DNA was diluted to 20ng/µl and 2µl was added to the ddPCR master mix along with probes for genomic C9ORF72 and mouse EIF2C1 or RPP30 diploid genome. CNV was determined by dividing the absolute value of C9ORF72 by the absolute value of mEIF2C1 divided by 2 for diploid genome (Table 2). GraphPad Prism Program was used to graph the values. Homozygote mice have a CNV of 38–40, and heterozygote mice 18–20.

Western Blot

Samples were lysed in RIPA buffer and a cOmplete protease inhibitor tablet (Roche), at 4˚C and the supernatant collected. Then, 5µg of protein lysates were run on Novex 12% Tris-Glycine gels (Life Technologies, USA) using Tris-Glycine SDS running buffer (Invitrogen, USA). Protein was transferred to nitrocellulose membranes using an i-Blot transfer device (Invitrogen, USA). Membranes were blocked for 1 hour at room temperature with Odyssey Blocking Buffer (LiCor, USA) before being probed overnight with primary antibodies (SiGMA ABN 1644–1645). IR labeled secondary antibodies were applied, and blots visualized. The band intensity was quantified using the Odyssey Infrared imaging system (LiCor, USA).

Table 2

List of probes
Probe		Location	Sequence
V1 Life Technologies	GEX: Hs00331877_m1	1a-3	AGATGACGCTTGATATCTCCGGAGC
V2 Life Technologies	GEX: Custom	2–3	Fwd: AGGCGGTGGCGAGTGGATA Rev: TTGGAGCCCAAATGTGCCTTA Probe: CGACTCTTTGCCCACCG
V3 Life Technologies	GEX: Custom	1b-3	Fwd: GCGGGGTCTAGCAAGAGCAG Rev: TTGGAGCCCAAATGTGCCTTA Probe: CCACCGCCATCTC
Vall Life Technologies	GEX: HS00376619	3	AGAATATGGATGCATAAGGAAAGAC
HPRT hum: Bio-Rad	GEX: qHsaCIP0030549		Chromosome location X:133627547–133632465
HPRT mus: Bio-Rad	GEX: qMmuCEP0054164		Chromosome location X:53021117–53021221
C9ORF72 genomic (CMV)	CNV: Custom	4 -intron	Fwd: AAGGCACAGAGAGAATGGAAG REV: AGGCTTATTCGTATGTCTCCAAG Probe: AGGTTGATGGCTACATTTGTCAAGGC
mEIF2C1	CNV: Custom		Fwd: CCTGCCATGTGGAAGATGAT Rev: GAGTGTGGTTGGCTGGATTTA Probe: TGGGGAGAGCTGGAGCCAG
amiRC9: Life Technology	custom		ATAGCACCACTCTCTGCATT
snoRNA135: Life Technology	001230		CTAAAATAGCTGGAATTACCGGCAGATTGGTAGTGGTGAGCCTATGGTTTTCTGAAG
Hsa-miR-128a: Life Technology	002216		UCACAGUGAACCGGUCUCUUU

MSD ELISA

Samples were lysed in RIPA buffer and a cOmplete protease inhibitor tablet (Roche), using lysing Matrix D Beads (MP Bio) and a Tissuelyser II (Qiagen 85300, 3x 3min 30HZS). Then, samples were placed in a new Eppendorf 1.5ml tube and sonicated. After sonication, samples were centrifuged at 16,000 x g for 20 min and supernatants collected. The protein concentration of lysates was determined by a BCA assay (Thermo Scientific, USA). Poly-GP levels in lysates were measured using a previously described sandwich immunoassay that utilizes Meso Scale Discovery (MSD) electrochemiluminescence detection technology (59). Lysates were diluted in Tris-buffered saline (TBS) and tested using 35µg of protein per well in duplicates. Serial dilutions of recombinant (GP)₈ in TBS were used to prepare the standard curve. Response values corresponding to the intensity of emitted light upon electrochemical stimulation of the assay plate using the MSD QUICKPLEX SQ120 were acquired, and background corrected using the average response from lysates obtained from non-transgenic mice prior to interpolation of poly-GP levels using a standard curve.

Fluorescent in situ hybridization

Cryosections of 20µm were serially collected (1/20) throughout the motor cortex and cervical spinal cord. Sections were fixed in 4% PFA for 20 min, followed by five 20-min washes in DEPC-treated PBS containing 0.1% Tween and 50µg/ml of Heparin. Sections were pre-hybridized for 1 hour at 55^oC in 2x Sodium citrate (SSC) containing 0.1% Tween 20, 50% of dextran sulfate, water, 50µg/ml heparin, 1mg/ml heat-denatured salmon sperm and 40% deionized sulfate. For hybridization, samples were incubated overnight at 55^oC in pre-hybridization buffer containing a 1:500 dilution of 1µM DNA probe (Sense: GGGGCC4) with a Cy3 label. After hybridization, the samples were washed in a pre-warmed mix 1:1 of hybridization buffer and in 2XSSC for 30 mins at 55^oC. This was followed by 2 washes in pre-warmed 2XSSC for 30 mins at 55^oC, 2 washes with 0.2XSSC for 30 min at 55^oC, and 2 washes in 1XPBS + 0.1%Tween + 50µg/ml Heparin for 30 min, at room temperature. Sections were stained with DAPI (1:10,000) for 5 min, and auto fluorescence was quenched by incubation in 0.5% Sudan Black in 70% ethanol for 5 min. Glass coverslips were mounted using Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Scientific Shandon, USA).

RNAscope Fluorescent Multiplex Assay

Cervical cords were embedded in OCT, frozen and cryo-sectioned into 7µm thick sections and collected on plus/plus slides for staining. Sections were fixed in 10% NBF for 1 hour, followed by two washes in 1X PBS and four 5-min washes in ethanol (50%, 70%, 100%, and 100%) at room temperature. The fixed sections were covered with 5 drops of Protease IV for 30 min at room temperature followed by two washes in 1X PBS prior to proceeding to the RNAscope Fluorescent Multiplex Assay protocol. Probes were warmed for 10 min at 40⁰C, cooled to room temperature, and a 1:50 C2:C1 and C3:C1 hybridization mixture was prepared. Approximately 180µl of hybridizing probe mixture was used to cover the sections completely, which was incubated for 2 hours at 40⁰C. Two 2 min washes in 1X Wash Buffer (2.94L distilled water to 1 Bottle (60mL) RNAscope Wash Buffer Reagents) with minor agitation preceded all of the Fluorescent Multiplex Detection Reagent additions. Approximately 180µl of each of the fluorescent detection reagents was added to completely cover all sections within the hydrophobic barrier prior to incubation in the HybEZ™ Oven at 40⁰C. A 30 min incubation was used for Amp 1-Fl, 15 min for Amp 2-Fl, 30 min for Amp 3-Fl, and 15 min for Amp 4-Fl-Alt C. Sections were counterstained with DAPI for 30 sec at room temperature and glass coverslips were mounted using Prolong Gold Antifade Mountant.

All images were taken using a Leica DM5500 B microscope with a Leica DFC365 FX camera. A total magnification of 100.8X (63X oil lens * 1.6X camera) was used to generate the images, while using the acquisition settings (Table 3) for the various probes. A maximum projection of z-stacks with a range of 1–3µm was used for quantification. Approximately 15 images were taken from three different cervical spinal cord sections for each animal, each with at least one motor neuron present, n = 3 per group. The quantification of intron, exon, and co-localized targets was conducted manually for motor neurons in the ventral horn. Cervical spinal motor neurons were identified by location, morphology, and larger nuclei. Because tissues were fixed prior to staining, GFP expression was weak, rendering it impossible to count the GFP-positive cells (i.e. virally transduced cells) selectively. We therefore counted all RNA targets identified regardless of GFP transduction. Intron RNA targets were additionally classified as inside or outside of the nucleus by the presence of puncta within the DAPI signal. Co-localization of intron and exon puncta was determined using the z-stack and spectral color change as observed by light color properties of the RGB additive color model.

Table 3

Fluorescent Microscope Acquisition and Filter Settings (AMP 4 Alt-C-FL)
Probe Channel ID	Excitation [nm]	Emission [nm]	Filter Set	Exposure [ms]	Gain	Intensity
C1	Atto 550 nm	580 ± 10nm	Cy3	645.00	3.2	5.0
C2	Atto 647 nm	690 ± 10nm	Cy5	466.00	3.2	5.0
	358 nm	461 nm	DAPI	36.00	1.2	3.0
	~ 488 nm	~ 509 nm	eGFP	300.00	3.0	4.0

eGFP immunofluorescence

Mice were sacrificed by perfusion with PBS and 4% paraformaldehyde (PFA). The whole body was then immersed in 4% PFA. After overnight fixation, brains were dissected and cryo-preserved by being immersed in 10%, 20%, and 30% sucrose, overnight for each gradient, and embedded in O.C.T. Compound (Tissue-Tek; cat no. 4583). Tissues were cut into 40-µm coronal sections using a cryostat. Sections were stained with DAPI and antibodies against eGFP (Thermo Fisher Scientific; cat no. A-11122; 1:1,000 diluted), NeuN (Millipore; cat no. MAB377; 1:1,000 diluted), GFAP, (Abcam; cat no. ab4674; 1:1,000) and Iba1 (Wako Chemicals; cat no. NC9288364; 1:1,000) and proper fluorophore-labeled secondary antibodies (Invitrogen). Stained sections were mounted using Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Scientific Shandon, USA). Immunofluorescence signal from sections was captured using an upright fluorescence microscope (Leica Microsystems).

Design of amiRNA to target C9ORF72 variants

As a first step toward ameliorating the molecular hallmarks of the C9ORF72 HRE, we designed four amiRNAs targeting all variants of C9ORF72. The constructs were cloned into two different plasmids. Expression was driven in the first plasmid by the chicken β-actin (CBA, polymerase II) promoter, and the second plasmid has the human H1 promoter (polymerase III), which is anticipated to be stronger than the CBA promoter. Both constructs incorporated enhanced Green Fluorescent Protein (eGFP) and Inverted Terminal Repeat (ITR) flanks (Fig. 1A).

The target location for the amiRNAs is depicted in Fig. 1B and Table 1. Efficacy of the amiRNAs to target C9ORF72 was screened in HEK293T cells, and mRNA levels for each variant were evaluated by quantitative Droplet Digital PCR (ddPCR). The results were normalized to the GFP control. amiRC9, which incorporates the more powerful H1 promoter, most consistently suppressed expression of all three C9ORF72 isoforms (Fig. 1C). Given these results and the published data from Pfister et al (28), we anticipated that the weaker CBA promoter would not be adequate for in vivo experiments in a mouse model with multiple copies of the transgene. Therefore, we undertook neuronal cell culture and in vivo experiments using the H1-driven amiRC9 construct, which was packaged in AAV9.

amiRC9 silences C9ORF72 in vitro

We next assessed silencing by the packaged AAV9-H1-amiRC9 in primary cortical cultures from the BAC112 mouse model (29). Two independent cultures were transduced with a GFP control vector, a PBS-mock control, and the amiRC9 vector at day in vitro (DIV) 4 at a multiplicity of infection (MOI) of 50,000 vector particles. The cultures were harvested at DIV10 (Fig. 1D), and total RNA was extracted. ddPCR quantification revealed that amiRC9 significantly reduced each variant of the C9ORF72 mRNA (Fig. 1E).

To further confirm that C9ORF72 silencing reflected post-transcriptional regulation of gene expression by amiRC9, we designed a custom miRNA assay to quantify the mature form of amiRC9 levels by ddPCR (Fig. 1F). As expected, only treated samples had detectable levels of amiRC9. In addition to detecting amiRC9, we wanted to compare the expression levels to other endogenous miRNAs. We therefore assayed levels of microRNA128a, which is highly expressed in brain (30, 31) and found that amiRC9 is 19–25-fold less abundant than miR128a. This provides assurance that the observed level of amiRC9 is not likely to be saturating the RNAi machinery or inducing toxicity by competing with endogenous miRNAs entering the RISC complex.

We had previously shown that amiRC9 can also decrease poly-GP dipeptides in primary neuronal cultures (32). To determine if we could attain a similar reduction in cultured neurons derived from a high copy transgenic mouse model, we quantified the poly-GP levels in treated and control neuronal cultures derived from the BAC112. Notably, the MSD ELISA assay showed the GP dipeptides were significantly reduced in treated cultures (Fig. 1G), in alignment with our previous results (32).

While microRNAs primarily act in the cytoplasm (33–35), published data (36–38) suggest that they can be shuttled back into the nucleus and thereby decrease the number of RNA foci (39). To test this possibility, we used fluorescent in situ hybridization (FISH) to detect sense foci. Multiple 4-well chamber slides were scored for foci number per nucleus (Fig. 1H). Quantification revealed no significant differences in numbers of intranuclear foci between treated and control samples, suggesting that amiRC9 had not suppressed C9ORF72 transcripts inside the nucleus.

Striatal brain injections silence C9ORF72 variants in vivo

Multiple lines of transgenic BAC mouse models have been generated (23, 29, 32, 40–42) that differ with respect to mouse background, expansion size, transgene insertion site, copy number, and C9ORF72 expression levels. While these models recapitulate the molecular hallmarks C9ORF72 in humans (RNA foci and toxic dipeptides of C9ORF72-linked ALS), they do not recapitulate motor neuron loss and paralysis. For in vivo studies, we elected to use the BAC112 transgenic mouse model created by the Baloh Lab (29) (Jackson Laboratories, 023099). This mouse line has a C57BL/6 background and harbors the full-length human C9ORF72 gene with an expansion of 550 repeats. Heterozygous mice have 16–20 copies of the transgene and homozygous 32–40 copies. This model recapitulates the pathological molecular aspects of the disease, including RNA foci and poly-dipeptides (Suppl. Figure 1).

To determine its efficacy in vivo, we first delivered AAV9-H1-amiRC9 vector into adult heterozygous mice via tail vein injection. Two weeks post injection, liver tissues were collected C9ORF72 mRNA levels were analyzed by ddPCR (Suppl. Figure 2). We found a 50% mRNA decrease of all three C9ORF72 variants in the liver. After confirming the vector’s effectiveness, we next injected the vector directly into the striatum of adult homozygous BAC112 mice. We opted to use striatal injections because they are a comparatively easy method for injecting a large volume of vector to a well-defined and relatively circumscribed region of the brain.

Homozygous 4-month-old mice were gender and copy-number matched and separated into three injection groups: PBS-mock, AAV9-CB-GFP-control, and AAV9-H1-amiRC9. We performed bilateral striatal injections, delivering 5 µl of vector per side for a final dose of 1E11 genomic copies (GC) per mouse (Fig. 2A). Mice were culled 16 weeks post injection, PBS-perfused, and dissected. Two-millimeter punches were taken from each hemisphere for RNA and protein extraction. As in treated primary culture experiments, we found significant diminution of each of the C9ORF72 mRNA variants (~ 50% reduction) when comparing amiRC9 to GFP-control and PBS-mock injected mice (Fig. 2B). This was consistent with the presence of significant levels of the mature form of amiRC9 in treated samples only (Fig. 2C).

To quantify the protein levels of C9ORF72, we performed Western blot studies using an antibody with relative specificity for human C9ORF72. We were able to detect the mouse C9ORF72 ortholog, which was not detected in brain samples from C9ORF72 knock-out mice (43). To control for endogenous mouse C9orf72 detection, we ran three wild type C57BL/6 brain samples side-by-side the treated samples and controls. With densitometry, we quantified protein levels and subtracted the average of the WT mouse samples as background. Protein levels of both the long (481 aa ~ 51kDa) (Fig. 2D, E), and short (222 aa ~ 25kDa) (Suppl. Figure 3) forms were significantly decreased by more than 50% in treated mice.

Having observed efficient knockdown of C9ORF72 transcript and protein levels, we next sought to determine whether this RNAi-mediated knockdown would reduce toxic poly-dipeptide proteins, one of the major pathogenic gain-of-function hallmarks of C9-ALS/FTD. Using an immunoassay that detects poly-GP, we detected a 50–60% reduction of GP poly-dipeptides in treated mice compared to controls (Fig. 2F).

CSF-based and peripheral delivery yield comparable transduction of the rostral CNS and spinal cord

Multiple delivery routes provide therapeutic access to the neuroaxis. To optimize suppression of C9ORF72 expression through amiRC9, we compared the intracerebroventricular (ICV) injection route to the peripheral intravenous (IV) temporal (facial) vein route in neonatal mice.

Heterozygous P1 pups were bilaterally ICV injected (44) with 2µl of AAV9-H1-amiRC9 (5E12 GC), AAV9-CB-GFP (8.5E12 GC), or PBS (Fig. 3A). At 16 weeks post injection, whole brain and spinal cords were harvested from treated and control mice. Frontal lobes were dissected and freshly frozen for RNA extraction or immunofluorescence staining. We assessed knockdown for each variant as described above. There was silencing of all C9ORF72 isoforms in the treated samples (Fig. 3B), which reached statistical significance for V2, V3, and total C9ORF72 transcripts. We documented the presence of the mature amiRC9 in all injected animals and quantitated levels via ddPCR (Fig. 3C). By performing immunofluorescent co-staining in the brain, we confirmed that transduction of AAV9-H1-amiRC9-GFP occurred in neurons and astrocytes, but we noted a lack of co-localization of GFP with microglia, as defined by immunostaining with the antibody Iba1 (Suppl. Figure 4). These results are consistent with other reports using AAV9 to transduce the CNS (45). By ELISA, we also observed a trend toward a decrease in GP poly-dipeptides in these frontal lobe preparations (Fig. 3D). Using FISH analysis, we did not detect significant differences in the number of sense RNA foci in layer V of the frontal cortex (Figs. 3E, 3F).

We next tested the efficacy of temporal vein injections. P1 pups were injected with 50µl of vector at a dose of 2E11 GC (Fig. 4A). At 16 weeks post injection, we investigated C9ORF72 mRNA expression in the frontal lobes and found detectable levels of the mature amiRC9a but no significant decrease of C9ORF72 mRNA (Suppl. Figure 5), which is in contrast with the C9ORF72 mRNA silencing we observed in the frontal lobe of ICV-injected pups (Fig. 3B).

While the efficacy of these delivery methods was distinguishable for the frontal cortex, we anticipated that systemic delivery would provide greater mRNA silencing in the spinal cord (44). To test this, we next investigated which of these two delivery methods most efficiently silenced C9ORF72 in the spinal cord. We assayed C9ORF72 expression in motor neurons specifically using laser capture microdissection (LCM) of motor neurons within the ventral horn of cervical cord sections. We then quantified both the mRNA levels of the C9ORF72 variants and the presence of the mature amiRC9. Temporal vein delivery achieved only slightly better suppression of C9ORF72 (~ 50%, Fig. 4B, C), than ICV delivery (30–35% decrease, Fig. 4D, E).

amiRC9 targets misspliced transcript that produces the cytoplasmic toxic dipeptides

We next sought to define the mechanism by which amiRC9 decreases levels of toxic dipeptides. We anticipated that, in general, there should be both intronic and exonic targets for silencing of RNA in the nucleus. We further anticipated that only the exonic targets would be present in the cytoplasm. In the case of mutant C9ORF72, however, the existence of the dipeptides suggests that there is a fragment of misspliced intronic RNA that is present not only in the nucleus, but also in the cytoplasmic compartment. Indeed, it has further been reported that intron-HRE fragments are present in the cytoplasm of C9ORF72 motor neurons (46, 47). It is also possible that such intron-HRE fragments might contain exons as well. If the intron-HRE and any exons are retained within the misspliced transcript, we expected to see these colocalize in both the nucleus and the cytoplasm. We further expected that amiRC9 would decrease levels of both intron and exon targets in the cytoplasm of treated cervical cord samples. To evaluate this hypothesis, we used RNA in situ hybridization (RNAscope) on cervical cord sections from the temporal vein-injected group and designed two probes: the first targeting the intronic area just before the HRE (intron target) and the second targeting spliced joint exons 3–6 (exon target) (Fig. 5A). Ventral horn motor neurons were imaged as Z-stacks and each punctum detected was quantified as an RNA target. Representative images in (Fig. 5B) illustrate results from the three different groups: mock, control, and H1-amiRC9 treated cervical spinal cords. The first column shows DAPI staining of the nucleus of the cell followed by the exon target in red, the intron target in green, and the overlay in yellow. Dotted areas on the top right corners emphasize magnified cytoplasmic regions containing colocalized targets. We scored for total exon targets, cytoplasmic intron targets, and colocalized targets (Fig. 5C). Treatment with AAV9-amiRC9 resulted in a ~ 40% decrease of total exon targets, ~ 60% cytoplasmic intron targets, and ~ 50% of colocalized targets. We also identified the presence of cytoplasmic intron targets that did not colocalize with the exon target. We hypothesize that these are the unaccompanied intron-HRE transcript, which cannot be targeted by amiRC9, and which contribute to the generation of the dipeptides.

Recent publications from our group and others have documented that AAV-mediated delivery of amiRNAs can suppress expression of mutant genes that cause disorders such as Huntington’s disease and ALS (28, 32, 44, 48, 49). Here we designed and tested multiple amiRNAs targeting exonic regions within the C9ORF72 gene. After screening in HEK293T cells, we selected the top silencing candidate and further validated its efficiency in primary cortical cultures and in vivo in a C9ORF72 transgenic mouse model. This model overexpresses C9ORF72 from multiple tandem copies of the transgene (29). However, in a clinical setting most patients carry a single copy of the C9ORF72-HRE mutation, and only a few cases are homozygous. Mindful of these differences, we set out to demonstrate that our therapeutic strategy could silence C9ORF72 and its toxic counterparts sustainably.

The primary neuronal culture experiments confirmed the effectiveness of rAAV9-amiRC9 at transducing cortical neurons shown by eGFP expression, proper processing of amiRC9 into mature miRNA, and reduction of C9ORF72 mRNA and dipeptide levels. As anticipated, numbers of intranuclear RNA foci were not reduced; like most miRNAs, amiRC9 appears not to shuttle back into the nucleus (36–38, 50).

We next tested the efficiency of amiRC9 in vivo, by performing stereotaxic striatal injections in adult mice to deliver a high dose of vector to a broad area of the brain. We confirmed proper distribution of the vector into the striatum by eGFP expression, where medium spiny neurons compose most of the neuronal population transduced. Significant silencing of HRE-retaining C9ORF72 mRNA resulted in a ~ 50% suppression of GP poly-dipeptides, supporting the view that AAV9-mediated amiRC9 delivery in adult mice successfully suppressed C9ORF72 and the toxic byproducts of the HRE.

We compared two different delivery approaches in neonatal mice: local delivery with ICV injections and systemic delivery through the temporal vein. ICV-injection significantly reduced C9ORF72 variant mRNA isoforms and a revealed a trend toward reduction of GP poly-dipeptides. By contrast, the temporal vein injection did not reduce the C9ORF72 mRNA (Suppl. Figure 5). This may reflect a dilution effect of dissemination of the virus in the venous circulation. To investigate C9ORF72 suppression specifically in motor neurons, we used LCM in the cervical spinal cord. We found significant silencing in the motor neurons of both ICV and temporal vein injected mice, but remarkably, most silencing was achieved in the motor neurons of temporal vein injected mice.

Assuming that most cells are transduced, and the majority of silencing is post-translational, we hypothesized that some fraction of C9ORF72 mRNA is located in the nucleus and therefore is inaccessible to amiRC9. Similarly, any misspliced intron-HRE RNA or intron-HRE-exon RNA that is retained in the nucleus will also be inaccessible to amiRC9. By contrast, species of misspliced intron-HRE-exon 3 containing RNA in the cytoplasm would be targeted by amiRC9 and, moreover, should show co-localization of probes to the intron and the associated exons. Because amiRC9 targets exon 3, any exon-free intron-HRE RNA in the cytoplasm should not be suppressed by amiRC9. To address these questions of localization, we performed in situ hybridization using specific probes targeting either the first intron or the joint exons 3–6. We detected the exon RNA target in both cellular compartments at a nuclear to cytoplasmic ratio of ~ 2:3. Quantification of the exon target showed it to be significantly reduced only in the cytoplasm of treated mice.

Normally, one would expect intron-containing mRNA to be nuclear or perhaps perinuclear. Our observation that they are detected broadly in the cytoplasm is consistent with the concept that it is this misspliced intron-HRE RNA that participates in atypical translation of the HRE. The infrequent, co-localized exon-intron transcripts were significantly decreased in the cytoplasm of treated mice. This indicates that these abnormal transcripts containing exon 3 and HRE are accessible for amiRC9 targeting. On the other hand, the cytoplasmic intron-HRE RNAs that do not co-localize with the exon target cannot be targeted by amiRC9 and are likely the source of the residual poly-GP production that is not diminished by amiRC9 treatment. Other publications (51, 52) similarly document the presence of the retained intron-HRE and additionally demonstrate that there is a potential translational start site (CUG) upstream of the intron, driving the translation of the HRE (53). Further aspects of the expansion, however, remain to be studied. We cannot exclude the possibility that a portion of the HREs remains within a lariat or as an unaccompanied intron-HRE transcript. How the intron-HRE transcript avoids degradation remains to be determined.

These considerations and an overview of the mechanism of action of amiR9 are summarized in Fig. 6. The first two steps depict the C9ORF72 gene and the 3 variant transcripts it produces. Variants 1 and 3, which are less abundant, harbor the HRE in the first intron. When missplicing occurs, variants 1 and 3 retain the intron and the HRE, which is exported to the cytoplasm, permitting repeat-associated translation of toxic poly-dipeptides (24). With rAAV9-mediated delivery of amiRC9, the primary microRNA enters the RNAi silencing pathway, is exported to the cytoplasm to be further cleaved to enter the RISC complex and binds in perfect complementarity to the target mRNA. Since amiRC9 targets exon 3, both properly spliced C9ORF72 mRNA and intron-HRE-exon-3 retaining mRNA are targeted for silencing.

While the approach described here targeted all C9ORF72 transcript variants, another would be to design amiRNAs that target either the expansion carrying V1 and V3, or the intron-HRE for both sense and antisense strands. Because V1 and V3 represent a small fraction of total C9ORF72 mRNA, targeting V1 and V3 should spare the abundant normal transcript V2 and thus preserve levels of the C9ORF72 protein. Recently, encouraging data using different amiR scaffolds and AAV5 as a delivery vehicle also support the use of AAV-mediated amiR silencing as a safe and reliable approach for the treatment of ALS (39, 54). Antisense oligonucleotides (ASOs) targeting V1 and V3 are an alternative strategy to target C9ORF72, with encouraging early results in small clinical trials (55, 56). An advantage of ASOs is their capability to penetrate the nucleus, although a drawback is the requirement for recurrent treatments, which in combination with the challenges of direct delivery in the CNS, adds additional strain on already physically vulnerable ALS patients (57). AAV has the advantage of long-term expression of cargo in post-mitotic cells such as neurons (58). This renders AAV-mediated delivery of amiRNAs a particularly appropriate strategy for the treatment of ALS. In previous studies we explored the use of AAV-mediated amiRNAs targeting SOD1 and found significant reductions of SOD1 and preservation of motor neurons in treated animals and in a human study treating two SOD1-ALS patients (49).

Data availability

The source data underlying Figures 1c, e-h; 2b, c, e, f; 3b–d, f; 4b–d; 5c, are provided as a Source Data file.

Acknowledgements

We acknowledge G. Gao and Q. Su at University of Massachusetts Medical School who supervised the vector production. We thank Lorelei Stoica for training on all mouse surgeries, Lina Song for aiding with plasmid cloning and instruction, Qiushi Tang for assisting with vector constructs, Meghan Blackwood for aiding with tissue collections, Ozgun Uyan for scientific conversations and suggestions, and Allison Keeler for scientific conversations and editing the manuscript.

Author contributions

G.T.C. led design, analysis, interpretation of the study, and prepared the manuscript. Performed screenings, cultures, surgeries, ddPCR analysis, RNA FlSH and quantifications. K.E.M. prepared manuscript for publication, did analyses and statistics and performed immunohistochemistry and microscopy experiments. A.A. aided with surgeries and temporal injections, primary cultures, scientific input, and editing. H.T. performed MSD ELISA assays for dipeptide detection, aided with scientific input. Z.F. performed animal tissue collection and sectioning including RNAscope quantification. A.W. managed the mice colony and aided with stereotaxic surgeries. NW performed Western blots for detection of C9ORF72 protein. R.S. performed cryosections of spinal cord and LCM microdissections. T.G. performed ELISA assays for dipeptide detection. A.Gr. aided with temporal injections and manuscript editing. A.Gi. aided with primary culture dissection. R.H.B. and C.M. conceived of the project and supervised all aspects of its execution and analysis.

Funding

This study was supported by ALS Alliance Therapy (R.H.B.), the ALS-FindingACure (R.H.B.), and NINDS NS088689 (C.M. and R.H.B.). R.H.B. also received funding from the NINDS (NS079836), the ALS Association, ALSOne, the Angel Fund, the Cellucci Fund for ALS Research, the Michael Rosenfeld ALS Fund, the Pierre L. de Bourgknecht ALS Research Foundation, Project ALS and Target ALS.

Ethical approvals

All mouse experiments were conducted at UMass Medical School following protocols approved by the Institutional Review Board. The University of Massachusetts Medical School Institutional Animal Care and Use Committee approved all experiments involving animals.

Competing interests

R.H.B. and C.M. are inventors on the patent for the technology described within this report (rAAV-Based Compositions and Methods for Treating Amyotrophic Lateral Sclerosis, WO2015143078A1) and may be entitled to royalty payments in the future. The patent has been licensed to Apic-Bio for which C.M. and R.H.B. are founders with equity. All other authors declare no competing financial interests.

Chiò A, Logroscino G, Traynor BJ, Collins J, Simeone JC, Goldstein LA, et al. Global epidemiology of amyotrophic lateral sclerosis: a systematic review of the published literature. Neuroepidemiology. 2013;41(2):118–30.
Wijesekera LC, Leigh PN. Amyotrophic lateral sclerosis. Orphanet Journal of Rare Diseases. 2009 Feb 3;4(1):3.
DeJesus-Hernandez M, Mackenzie IRR, Boeve BFF, Boxer ALL, Baker M, Rutherford NJJ, et al. Expanded GGGGCC Hexanucleotide Repeat in Noncoding Region of C9ORF72 Causes Chromosome 9p-Linked FTD and ALS. Neuron. 2011 Oct 20;72(2):245–56.
Majounie E, Renton AE, Mok K, Dopper EGPP, Waite A, Rollinson S, et al. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study. The Lancet Neurology. 2012 Apr 1;11(4):323–30.
Renton AE, Majounie E, Waite A, Simón-Sánchez J, Rollinson S, Gibbs JR, et al. A Hexanucleotide Repeat Expansion in C9ORF72 Is the Cause of Chromosome 9p21-Linked ALS-FTD. Neuron. 2011 Oct 20;72(2):257–68.
Devenney E, Hornberger M, Irish M, Mioshi E, Burrell J, Tan R, et al. Frontotemporal Dementia Associated With the C9ORF72 Mutation: A Unique Clinical Profile. JAMA Neurology. 2014 Mar 1;71(3):331–9.
Van Mossevelde S, van der Zee J, Cruts M, Van Broeckhoven C. Relationship between C9orf72 repeat size and clinical phenotype. Vol. 44, Current Opinion in Genetics and Development. Elsevier Ltd; 2017. p. 117–24.
Iacoangeli A, Al Khleifat A, Jones AR, Sproviero W, Shatunov A, Opie-Martin S, et al. C9orf72 intermediate expansions of 24–30 repeats are associated with ALS. Acta Neuropathologica Communications. 2019 Dec 17;7(1):115.
Renton AEE, Majounie E, Waite A, Simón-Sánchez J, Rollinson S, Gibbs JRR, et al. A Hexanucleotide Repeat Expansion in C9ORF72 Is the Cause of Chromosome 9p21-Linked ALS-FTD. Neuron. 2011 Oct;72(2):257–68.
DeJesus-Hernandez M, Mackenzie IRR, Boeve BFF, Boxer ALL, Baker M, Rutherford NJJ, et al. Expanded GGGGCC Hexanucleotide Repeat in Noncoding Region of C9ORF72 Causes Chromosome 9p-Linked FTD and ALS. Neuron. 2011 Oct;72(2):245–56.
Amick J, Ferguson SM. C9orf72: At the intersection of lysosome cell biology and neurodegenerative disease. Vol. 18, Traffic. Blackwell Munksgaard; 2017. p. 267–76.
Shi Y, Lin S, Staats KA, Li Y, Chang WH, Hung ST, et al. Haploinsufficiency leads to neurodegeneration in C9ORF72 ALS/FTD human induced motor neurons. Nature Medicine. 2018 Mar 5;24(3):313–25.
Zhu Q, Jiang J, Gendron TF, McAlonis-Downes M, Jiang L, Taylor A, et al. Reduced C9ORF72 function exacerbates gain of toxicity from ALS/FTD-causing repeat expansion in C9orf72. Nat Neurosci. 2020;23(5):615–24.
Mizielinska S, Lashley T, Norona FE, Clayton EL, Ridler CE, Fratta P, et al. C9orf72 frontotemporal lobar degeneration is characterised by frequent neuronal sense and antisense RNA foci. Acta Neuropathologica. 2013 Dec;126(6):845–57.
Gendron TF, Bieniek KF, Zhang YJJ, Jansen-West K, Ash PEAA, Caulfield T, et al. Antisense transcripts of the expanded C9ORF72 hexanucleotide repeat form nuclear RNA foci and undergo repeat-associated non-ATG translation in c9FTD/ALS. Acta Neuropathologica. 2013 Dec;126(6):829–44.
Mori K, Weng SM, Arzberger T, May S, Rentzsch K, Kremmer E, et al. The C9orf72 GGGGCC Repeat Is Translated into Aggregating Dipeptide-Repeat Proteins in FTLD/ALS. Science. 2013 Mar 15;339(6125):1335–8.
Zu T, Liu Y, Banez-Coronel M, Reid T, Pletnikova O, Lewis J, et al. RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia. Proceedings of the National Academy of Sciences. 2013 Dec 17;110(51):E4968–77.
Ash PEA, Bieniek KF, Gendron TF, Caulfield T, Lin WL, DeJesus-Hernandez M, et al. Unconventional Translation of C9ORF72 GGGGCC Expansion Generates Insoluble Polypeptides Specific to c9FTD/ALS. Neuron. 2013 Feb 20;77(4):639–46.
May S, Hornburg D, Schludi MH, Arzberger T, Rentzsch K, Schwenk BM, et al. C9orf72 FTLD/ALS-associated Gly-Ala dipeptide repeat proteins cause neuronal toxicity and Unc119 sequestration. Acta Neuropathol. 2014 Oct 1;128(4):485–503.
Wen X, Tan W, Westergard T, Krishnamurthy K, Markandaiah SS, Shi Y, et al. Antisense Proline-Arginine RAN Dipeptides Linked to C9ORF72-ALS/FTD Form Toxic Nuclear Aggregates that Initiate In Vitro and In Vivo Neuronal Death. Neuron. 2014 Dec 17;84(6):1213–25.
Sun Y, Eshov A, Zhou J, Isiktas AU, Guo JU. C9orf72 arginine-rich dipeptide repeats inhibit UPF1-mediated RNA decay via translational repression. Nat Commun. 2020 03;11(1):3354.
West RJH, Sharpe JL, Voelzmann A, Munro AL, Hahn I, Baines RA, et al. Co-expression of C9orf72 related dipeptide-repeats over 1000 repeat units reveals age- and combination-specific phenotypic profiles in Drosophila. Acta Neuropathol Commun. 2020 07;8(1):158.
Zhang YJ, Guo L, Gonzales PK, Gendron TF, Wu Y, Jansen-West K, et al. Heterochromatin anomalies and double-stranded RNA accumulation underlie C9orf72 poly(PR) toxicity. Science. 2019 15;363(6428).
Zhang YJ, Gendron TF, Ebbert MTW, O’Raw AD, Yue M, Jansen-West K, et al. Poly(GR) impairs protein translation and stress granule dynamics in C9orf72-associated frontotemporal dementia and amyotrophic lateral sclerosis. Nat Med. 2018;24(8):1136–42.
Miller RG, Mitchell JD, Moore DH. Riluzole for amyotrophic lateral sclerosis (ALS)/motor neuron disease (MND). Cochrane Database Syst Rev. 2012 Mar 14;(3):CD001447.
Takei K, Takahashi F, Liu S, Tsuda K, Palumbo J. Post-hoc analysis of randomised, placebo-controlled, double-blind study (MCI186-19) of edaravone (MCI-186) in amyotrophic lateral sclerosis. Amyotroph Lateral Scler Frontotemporal Degener. 2017 Oct;18(sup1):49–54.
Cruz MP. Edaravone (Radicava): A Novel Neuroprotective Agent for the Treatment of Amyotrophic Lateral Sclerosis. P T. 2018 Jan;43(1):25–8.
Pfister EL, Chase KO, Sun H, Kennington LA, Conroy F, Johnson E, et al. Safe and Efficient Silencing with a Pol II, but Not a Pol lII, Promoter Expressing an Artificial miRNA Targeting Human Huntingtin. Mol Ther Nucleic Acids. 2017 Jun 16;7:324–34.
O’Rourke JG, Bogdanik L, Muhammad AKMG, Gendron TF, Kim KJ, Austin A, et al. C9orf72 BAC Transgenic Mice Display Typical Pathologic Features of ALS/FTD. Neuron. 2015 Dec;88(5):892–901.
Bak M, Silahtaroglu A, Møller M, Christensen M, Rath MF, Skryabin B, et al. MicroRNA expression in the adult mouse central nervous system. RNA. 2008 Mar;14(3):432–44.
Adlakha YK, Saini N. Brain microRNAs and insights into biological functions and therapeutic potential of brain enriched miRNA-128. Mol Cancer. 2014 Feb 21;13:33.
Peters OM, Cabrera GT, Tran H, Gendron TF, McKeon JE, Metterville J, et al. Human C9ORF72 Hexanucleotide Expansion Reproduces RNA Foci and Dipeptide Repeat Proteins but Not Neurodegeneration in BAC Transgenic Mice. Neuron. 2015 Dec;88(5):902–9.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281–97.
Lewis BP, Shih I hung, Jones-Rhoades MW, Bartel DP, Burge CB. Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787–98.
Ambros V. The evolution of our thinking about microRNAs. Nat Med. 2008 Oct;14(10):1036–40.
Hoffer P, Ivashuta S, Pontes O, Vitins A, Pikaard C, Mroczka A, et al. Posttranscriptional gene silencing in nuclei. Proc Natl Acad Sci U S A. 2011 Jan 4;108(1):409–14.
Huang V, Li LC. miRNA goes nuclear. RNA Biol. 2012 Mar;9(3):269–73.
Nishi K, Nishi A, Nagasawa T, Ui-Tei K. Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. RNA. 2013 Jan;19(1):17–35.
Martier R, Liefhebber JM, Miniarikova J, van der Zon T, Snapper J, Kolder I, et al. Artificial MicroRNAs Targeting C9orf72 Can Reduce Accumulation of Intra-nuclear Transcripts in ALS and FTD Patients. Mol Ther Nucleic Acids. 2019 Mar 1;14:593–608.
Batra R, Lee CW. Mouse Models of C9orf72 Hexanucleotide Repeat Expansion in Amyotrophic Lateral Sclerosis/ Frontotemporal Dementia. Front Cell Neurosci. 2017;11:196.
Jiang J, Zhu Q, Gendron TF, Saberi S, McAlonis-Downes M, Seelman A, et al. Gain of toxicity from ALS/FTD-linked repeat expansions in C9ORF72 is alleviated by antisense oligonucleotides targeting GGGGCC-containing RNAs. Neuron. 2016 May 4;90(3):535–50.
Liu Y, Pattamatta A, Zu T, Reid T, Bardhi O, Borchelt DR, et al. C9orf72 BAC Mouse Model with Motor Deficits and Neurodegenerative Features of ALS/FTD. Neuron. 2016 May;90(3):521–34.
Burberry A, Suzuki N, Wang JY, Moccia R, Mordes DA, Stewart MH, et al. Loss-of-function mutations in the C9ORF72 mouse ortholog cause fatal autoimmune disease. Sci Transl Med. 2016 13;8(347):347ra93.
McLean JR, Smith GA, Rocha EM, Hayes MA, Beagan JA, Hallett PJ, et al. Widespread neuron-specific transgene expression in brain and spinal cord following synapsin promoter-driven AAV9 neonatal intracerebroventricular injection. Neurosci Lett. 2014 Jul 25;576:73–8.
Aschauer DF, Kreuz S, Rumpel S. Analysis of transduction efficiency, tropism and axonal transport of AAV serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain. PLoS One. 2013;8(9):e76310.
Foust KD, Nurre E, Montgomery CL, Hernandez A, Chan CM, Kaspar BK. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol. 2009 Jan;27(1):59–65.
Borel F, Gernoux G, Cardozo B, Metterville JP, Toro Cabreja GC, Song L, et al. Therapeutic rAAVrh10 Mediated SOD1 Silencing in Adult SOD1G93A Mice and Nonhuman Primates. Human Gene Therapy. 2016 Jan;27(1):19–31.
Pfister EL, DiNardo N, Mondo E, Borel F, Conroy F, Fraser C, et al. Artificial miRNAs Reduce Human Mutant Huntingtin Throughout the Striatum in a Transgenic Sheep Model of Huntington’s Disease. Hum Gene Ther. 2018 Jun;29(6):663–73.
Mueller C, Berry JD, McKenna-Yasek DM, Gernoux G, Owegi MA, Pothier LM, et al. SOD1 Suppression with Adeno-Associated Virus and MicroRNA in Familial ALS. N Engl J Med. 2020 Jul 9;383(2):151–8.
Boeynaems S, Bogaert E, Michiels E, Gijselinck I, Sieben A, Jovičić A, et al. Drosophila screen connects nuclear transport genes to DPR pathology in c9ALS/FTD. Sci Rep. 2016 Feb 12;6:20877.
Sznajder ŁJ, Thomas JD, Carrell EM, Reid T, McFarland KN, Cleary JD, et al. Intron retention induced by microsatellite expansions as a disease biomarker. Proc Natl Acad Sci U S A. 2018 Apr 17;115(16):4234–9.
Niblock M, Smith BN, Lee YB, Sardone V, Topp S, Troakes C, et al. Retention of hexanucleotide repeat-containing intron in C9orf72 mRNA: implications for the pathogenesis of ALS/FTD. Acta Neuropathol Commun. 2016 Feb 25;4:18.
Tabet R, Schaeffer L, Freyermuth F, Jambeau M, Workman M, Lee CZZ, et al. CUG initiation and frameshifting enable production of dipeptide repeat proteins from ALS/FTD C9ORF72 transcripts. Nature Communications. 2018 Dec;9(1):152–152.
Martier R, Liefhebber JM, García-Osta A, Miniarikova J, Cuadrado-Tejedor M, Espelosin M, et al. Targeting RNA-Mediated Toxicity in C9orf72 ALS and/or FTD by RNAi-Based Gene Therapy. Mol Ther Nucleic Acids. 2019 Feb 11;16:26–37.
Liu Y, Andreucci A, Iwamoto N, Yin Y, Yang H, Liu F, et al. WVE-004, an investigational stereopure antisense oligonucleotide for the treatment of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (2302). Neurology [Internet]. 2021 Apr 13 [cited 2022 Apr 7];96(15 Supplement). Available from: https://n.neurology.org/content/96/15_Supplement/2302
Tran H, Moazami MP, Yang H, McKenna-Yasek D, Douthwright CL, Pinto C, et al. Suppression of mutant C9orf72 expression by a potent mixed backbone antisense oligonucleotide. Nat Med. 2022 Jan;28(1):117–24.
Meijboom KE, Brown RH. Approaches to Gene Modulation Therapy for ALS. Neurotherapeutics. 2022 Sep 6;
Wang D, Tai PWL, Gao G. Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov. 2019 May;18(5):358–78.
Schoch KM, Miller TM. Antisense Oligonucleotides: Translation from Mouse Models to Human Neurodegenerative Diseases. Neuron. 2017 Jun 21;94(6):1056–70.

Yes there is potential conflict of interest. R.H.B. and C.M. are inventors on the patent for the technology described within this report (rAAV-Based Compositions and Methods for Treating Amyotrophic Lateral Sclerosis, WO2015143078A1) and may be entitled to royalty payments in the future. The patent has been licensed to Apic-Bio for which C.M. and R.H.B. are founders with equity. All other authors declare no competing financial interests.

Download PDF

Journal Publication

published 26 Sep, 2023

Read the published version in Gene Therapy →

Editorial decision: revise
28 Mar, 2023
Review #3 received at journal
16 Mar, 2023
Reviewer #3 agreed at journal
05 Mar, 2023
Review #1 received at journal
11 Nov, 2022
Reviewer #2 agreed at journal
31 Oct, 2022
Reviewer #1 agreed at journal
28 Oct, 2022
Reviewers invited by journal
21 Sep, 2022
Editor assigned by journal
21 Sep, 2022
Submission checks completed at journal
21 Sep, 2022
First submitted to journal
19 Sep, 2022

You are reading this latest preprint version

Artificial microRNA suppresses C9ORF72 variants and decreases toxic dipeptides in vivo

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Methods

amiRNA design and cloning

Cell culture

Animal experiments

Bilateral striatal injections

ICV injections in Neonates

Temporal vein injections in Neonates

Laser Capture Microdissection of motor neurons

RNA extraction, cDNA synthesis, DNA extraction and ddPCR

Western Blot

MSD ELISA

Fluorescent in situ hybridization

RNAscope Fluorescent Multiplex Assay

eGFP immunofluorescence

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1