Knock-down of Annexin A10 in trigeminal ganglion attenuates trigeminal neuropathic pain in mice

doi:10.21203/rs.3.rs-2082977/v1

Download PDF

Research Article

Knock-down of Annexin A10 in trigeminal ganglion attenuates trigeminal neuropathic pain in mice

https://doi.org/10.21203/rs.3.rs-2082977/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Trigeminal neuropathic pain (TNP) is an intense chronic orofacial pain syndrome, which the pathogenesis and treatment of it are still limited (Cruccu et al. 2020; Yadav et al. 2017). We induced TNP from adult male mice via partial infraorbital nerve ligation (pIONL)(Xu et al. 2008). The upregulated genes were screened in the trigeminal ganglion (TG) 7 days after pIONL and found that Annexin A10 (Anxa10) mRNA was up-regulated by up to 19-fold. PIONL induced persistent upregulation of Anxa10 mRNA and protein in trigeminal ganglion (TG). In addition, Anxa10 colocalized with the astrocyte marker glial fibrillary acidic protein (GFAP), the neuronal marker TUJ1 and with the microglial marker IB4. To knock-down of Anxa10 expression, lentivirus containing Anxa10-shRNA (LV-Anxa10-shRNA) was microinjected into TG, and successful infection of the lentivirus was verified by immunofluorescence. After inhibiting Anxa10, the mechanical pain threshold of pIONL mice decreased accompanied decreasing of TNF-α and IL-1β. Also, whole-cell patch-clamp recording showed that knock-down of Anxa10 suppressed nerve injury-induced hyperexcitation of TG neurons. In conclusion, Anxa10 is participated in the maintenance of trigeminal neuropathic pain, and we try to explore more about trigeminal neuropathic pain in the future.

Anxa10

trigeminal neuropathic pain

trigeminal ganglion

neurons

glial cells

A debilitating neuropathic pain disorder, TNP is characterized by spontaneous electric shock-like or tingling pains in the face (Lambru et al. 2021). TNP is considered to be one of the most refractory disorders in chronic pain conditions. The investigation of multiple underlying pathophysiologies, with no clear frontier, indicates that more research is needed to explore the pathogenesis of TNP and provide new ideas for the cure of the disease (Yadav et al . 2017 ; Lambru et al . 2021 ) . A highly conserved protein superfamily named Annexins has been found in more than 100 species. Annexins have different expression and localization patterns. It is Ca²⁺ dependent and featured by the ability of reversible binding to negatively charged phospholipids (Gerke et al. 2002). Studies displayed that Annexins is vital in regulating membrane transport, cell differentiation,calcium signaling pathway, tumor cell development, and progression (Rentero et al. 2018; Enrich et al. 2017; Mussunoor et al. 2008). Anxa 10 is important in the annexin family and plays a key molecule in a variety of physiological processes, covering growth regulation, cell division, apoptosis, differentiation and proliferation. As we can see, annexins have been given a new meaning, they can develop and even preserve inflammatory and neuropathic pain. Anxa10 is the most studied molecule of Annexins with respect to pain. Preceeding studies have demonstrated that Anxa10 take part in neuropathic pain caused by SNL, Anxa10 can mediate neuropathic pain by activating ERK1/2 signaling and promoting the expression of TNF-α and IL-1β (Sun et al. 2019; Lu et al. 2016; Li et al. 2018). Our early gene sequencing showed that the expression of Anxa10 was up-regulated 19 times after pIONL in the trigeminal ganglion. For all that, we speculated that Anxa10 take part in the trigeminal neuragia, but the specific mechanism remains to be investigated.

Studies have shown that microglia and astrocytes modulate neuronal and brain functions actively. These glial cells are also crucial in the development and progression of diverse neuropathologies (Jha et al. 2019). Microglia is a part of the early stages of neuroinflammation (Dottorf et al. 2022). Astrocytes function after 1-2 weeks (Zhou et al. 2019). Microglia can secrete cytokines to promote the proliferation or activation of astrocytes. Astrocytes function as the richest glial cells in the central nervous system. Under physiological conditions, astrocytes are crucial in keeping the homeostasis of the central nervous system by providing nutritional support to neurons and participating in the construction of the blood-brain barrier and synapses (Rudge et al. 1990). However, under pathological conditions, overactivated astrocytes secrete a variety of pro-inflammatory factors, which facilitate the occurrence of peripheral and central sensitization. They can induce neuronal degeneration and even form astrocytic scars, hindering neuronal repair and regeneration ( Paterniti et al. 2014; Yuan et al. 2017).

Multiple studies have found increased expression of pain markers in TG after pIONL. Electrophysiological results show increased excitability of neuronal postsynaptic potentials (Inoue et al 2021; Cui et al 2020). As important cytokines, TNF-α and IL-1β can directly measure ion channel function in primary neuroreceptors, which (Wei et al. 2021; Noh et al. 2019). Lu et al showed that Anxa10 is co-expressed with astrocytes and neurons in the spinal cord following spinal nerve ligation (Lu et al. 2016). In this study, we established a mouse model of trigeminal neuropathic pain by partial infraorbital nerve ligation (pIONL). On the basis of this model, we examined the expression of Anxa10 and the localization of Anxa10 cells in the trigeminal ganglion (TG). We used shRNA to compare pain threshold changes after knocking it out to obtain the role of Anxa10 in TNP. Afterwards, we also examined the expression of inflammatory factors, TNF-α and IL-1β.

Animals and surgery

We purchased adult male 2–8 week ICR mice from Nantong University Experimental Animal Center. They could eat and drink and were kept in the animal facility, which temperature is 22℃. The Animal Care and Use Committee of Nantong University reviewed and approved all animal handling in this study. Animals were selected and divided into different groups randomly, namely the operation, the control and the sham. The operation underwent ligation of the left infraorbital nerve with 8-0 line through an intraoral incision. Only the left infraorbital nerve was isolated and exposed without ligation in the sham. The control received no surgical intervention.

Behavior test

Mice will be tested in a quiet and comfortable environment and acclimatized 3 days in advance. Each test takes place at 3:00 pm on the same day and acclimates 30 minutes beforehand. Series of graded Von Frey fibers were used for mechanical stimulation of the left mandibular region (the smallest filament was 0.02 g, the largest was 1.4 g). Each filament was stabbed 5 times, and a rapid withdrawal or avoidance of the mouse after the fiber was bent would be considered a positive response. When there were more than 3 positive reactions, the size of the filament was recorded as the pain threshold of the mouse. In the whole experiment, in order to reduce the stimulation to the mice, the time of each prick was controlled at 10 seconds, and each prick was performed after the mice were calm.

Quantitative PCR (qPCR)

We extracted total RNA from the TG using Trizol reagent (Invitrogen, Carlsbad, CA, USA), which was noted before. We used a real-time detection system (Rotor Gene 6000, Qiagen) and SYBR Green I dye to detect quantitative polymerase chain reaction (qPCR) (Takara, Japan). We used these primers: β-Actin, TNF-α, IL-1β and Anxa10 (forward Primer, ATGTTTTGCGGGGAATATGTCC; reverse Primer , CAATCAGCATGTCTTTGTTGCAG). PCR amplification was made for 3 min at 95°C, then we made 40 cycles at 95°C for 10 seconds and 60°C for 30 seconds. We normalized with β-Actin as an internal control and calculated mRNA levels using the −ΔΔCt method (2−ΔΔCt ).

Western blots

We perfused the mice with normal saline. Ipsilateral TG tissue was isolated and triturated homogenate containing protease inhibitors (Promega, Madison, WI, USA) of the lysate. Test protein concentration by BCA protein assay. Similar to previous experiments(Lu et al. 2016), We performed sodium dodecyl polyacrylamide gel electrophoresis and Western blotting on the obtained protein samples. We used the following antibodies: Anxa10 (rabbit, 1:500, Bioss Inc) and β-actin (mouse, 1:20000, Millipore, Billerica, MA). We incubated blots with HRP-conjugated secondary antibodies. Finally, we used an Odyssey infrared imaging system (LI-COR, Lincen, NE, USA) to quantify the intensities of the spectral bands, showing the bands on the films.

Immunofluorescence staining

The mice were anesthetized far gone with sodium pentobarbital (50 mg/kg, intraperitoneal) and perfused with normal saline and formaldehyde, we isolated the trigeminal ganglia of the mice for immunofluorescence staining. TG tissue was cut (10 μm) using a cryostat. And take a similar approach for immunostaining (Lu et al. 2016). We used the following antibodies: Anxa10 (Boster Biotechnology, rabbit, 1:200), TUJ1 (R&D Systems, mouse, 1:500, ), GFAP (Millipore, mouse, 1:5000), CD11b (AbD, mouse) , 1:50) and IBA-1 (Wako, Rabbit, 1:3000). We incubated sections with Cy3 or Alexa 488-conjugated secondary antibodies (Jackson, 1:1000). For negative controls, we ignored the primary antibody and incubated the sections with only the secondary antibody. Finally, we examined the stained sections by microscopy (Leica SP8) and obtained pictures.

Trigeminal ganglion microinjection

IntraTG microinjection of recombinant lentivirus covering Anxa10 shRNA1 (LV-Anxa10-shRNA1, 5'-CTG AAC TTT GAC AGA ACC T-3'), Anxa10 shRNA2 (LV-Anxa10-shRNA2, 5'-CTG AAC TTT GAC AGA ACC T -3') Anxa10 shRNA3 (LV-Anxa10-shRNA3, 5'-CTG AAC TTT GAC AGA ACC T-3') or negative control shRNA (LV-NC, 5'-TTC TCC GAA CGT GTC ACG T-3' ) by using the pGCSIL-GFP vector. During the intra-TG microinjection, the mice were far gone anesthetized with sodium pentobarbital (50 mg/kg, intraperitoneal), and after stabilizing the mouse's head, the needle tip was placed at an angle of 10°parallel to the midline of the head, Inward puncture and through the infraorbital foramen, through the round foramen to reach the brain, touch part of the inner wall of the cranial fossa, and then slowly inject 6 µL of lentivirus.

Complete Trigeminal Ganglion Patch Clamp Recording

We isolated and cultured mouse trigeminal neurons and recorded changes in cell membrane excitability by patch clamp. Briefly, the trigeminal ganglia of mice were isolated after anesthesia with isoflurane,, the fibrous membrane covering the surface of the ganglion was removed, and the ganglia were grown in Dulbecco's modified Eagle's medium (DMEM, Gibco, Grand Island, NY). Incubate at 37˚C for 0.5 hours. Then add to DMEM containing 10% fetal bovine serum (FBS, Gibco, Grand Island, NY) and vortex gently with a 1 ml pipette tip. Finally, detached cells were seeded on poly-D-lysine-coated glass coverslips for 3 min in DMEM/FBS supplemented with 10% FBS and 30 ng/mL nerve growth factor. The seeded cells were placed in a cell incubator at 37˚C with 5% carbon dioxide.

We recorded trigeminal ganglion neurons after the culturing of 8 to 16 hours in accordance with the previous description. Small diameter TG neurons (<25 mm) were chosen to record current diaphragm clamp at room temperature. The bath solution and the pipette solution are same as previous experiment.The resistance of the glass electrode after fire polishing is controlled at 4-8MΩ.We acquired the data by applying a HEKA EPC-10 amplifier, Pulse software (version 8.80; HEKA Elektronik, Lambrecht, Germany). Then evoked the action potentials (APs) by depolarizing current steps (1000 ms in duration and 10 pA increments). The signals were low-pass filtered at 5 kHz, then sampled at 20 kHz, and analyzed offline ultimately.

Quantification and Statistics

Results are demonstrated as the mean ± SEM. We analyzed the behavioral statics by double-way repeated measures (RM) ANOVA following with the Bonferroni test. We analyzed the qPCR data by Student’s t-test. Image J software (NIH) was used to test the density of specific bands in Western blots. We compared the differences between two communities by applying Student’s t-test. We used the GraphPad Prism v8.0 for statistical explanation, and considered P < 0.05 was significant.

Anxa10 is one of the most upregulated genes in the trigeminal ganglion.

In order to find the brand-new pain processing genes, which in charge for remaining trigeminal neuropathic pain, we collected the ipsilateral trigeminal ganglion 7 days after pIONL and gene expression profiling was applied by applying mouse gene microarrays. In gene profiling, hierarchical cluster analysis revealed overall changes in differentially expressed genes between the sham and pIONL groups (Fig1.a). 150 genes became up-regulated, and 47 genes became down-regulated (Fig1.b). Among the 10 most up-regulated differential genes, the level of the expression of Anxa10 gene in the trigeminal ganglion was increased 19-fold (Fig1.c). Quantitative RT-PCR verified the result further (Fig1.d). The mechanisms involved in the formation of neuropathic pain are complex. For example, stimulation caused by persistent inflammation and nerve injury can lead to excitability of the spinal cord, which is called "central sensitization"; glial cells are activated to produce and release a large amount of excitatory neuronal substances, including a large number of cytokines, inflammation Sexual mediators and neuroactive substances, etc. GO and KEGG pathway analysis of DEG showed that multiple pathways were associated with our study, including neuropeptide receptor binding, neuroactive ligand-receptor interaction, and calcium signaling pathway (Fig1.e-f).

The expression and distribution of Anxa10 in the TG after pIONL

We examined the time course of Anxa10 expression in the ipsilateral TG after sham or pIONL to validate the Anxa10 mRNA expression pattern. Anxa10 mRNA levels increased greatly at day 3, peaked at day5 and remained same at day 7. No significant differences exist between the mRNA levels of naïve and sham-operated mice at every time point (Fig2. a). Western blots further displayed that pIONL added the Anax10 protein level greatly, compared to sham (Fig2. b). Immunofluorescence staining indicated that the fluorescence intensity of Anxa10 in pIONL mice is lighter than in sham mice. To further observe the cellular distribution of Anxa10 in the TG, we performed immunofluorescence double staining in pIONL mice, used the neuronal marker TUJ1 (Fig2.c), the microglial marker IB4(Fig2. e), and the astrocytic marker GFAP (Fig2. d). The results dispalyed that Anxa10 had a large colocalization in the TG with the astrocyte marker glial fibrillary acidic protein (GFAP) and the microglia marker IB4. It also had a small amount of colocalization with small and medium-sized neurons.

Anxa10 takes participate in the pathogenesis of trigeminal neuropathic pain

pIONL induced persistent mechanical allodynia, starting at day 3 and lasting over 21 days in accordance with the previous report (Fig3.a). Furthermore, to test that Anxa10 takes part in the regulation of TNP, we microinjected LV-Anxa10 shRNA 1-3 or NC into the TG. As shown, LV-Anxa10-shRNA1 mainly attenuated the mechanical allodynia induced by pIONL on the 5th, 7th, and 10th days after injection. The pain behavior of mice in the pIONL+LV-Anxa10-shRNA2 group was the same as that of mice in the pIONL+LV-NC group. The pIONL+LV-Anxa10-shRNA3 group was only affected on the 7th day after surgery (Fig3.b). Furthermore, qPCR showed that LV-Anxa10 shRNA1 decreased Anxa10 mRNA levels greatly, verifying the knockdown effect of LV-Anxa10 shRNA1 in TG (Fig4.c). Obviously, LV-Anxa10-shRNA1 effectively inhibited the facial mechanical pain in mice and in the following experiments, we adopted it to knock down of Annexin A10. Given this, we concluded that Anxa10 in TG is drawn into the pathogenesis of trigeminal neuropathy.

It is acknowledged that TNF-α and IL-1β have indispensable roles in monitoring inflammatory and neuropathic pain. We examined expression in TG after pIONL, which increased TNF-α and IL-1β mRNA levels in pIONL mice compared to sham (Fig4. a-b). Microinjection of shRNA-1 or shRNA-NC into pIONL mice showed that inhibition of Anxa10 could also reduce TNF-α and IL-1β’s expressions (Fig4. d-e). Fig4. f-k shows that LV-Anxa10-shRNA could successfully transfect the trigeminal ganglia of mice 7 days after microinjection. This method did not cause significant damage to the trigeminal ganglia. Collectively, Anxa10 may be involved in the activation of TNF-α and IL-1β in trigeminal neuropathic pain. However, we did not observe the effect of using inhibitors or agonists of TNF-α and IL-1β on pain thresholds in this experiment, so it cannot be concluded that these two inflammatory factors are directly involved in Anxa10-induced TNP in this experiment.

Excitability of trigeminal ganglion neurons is controlled by Anxa10

Neuronal hyperexcitability of TG is correlated with neuropathic pain. We checked if Anxa10 is drawn into the increased neuronal excitability after pIONL. We recorded trigeminal neurons from naive and lentivirus-infected mice through using whole-cell patch-clamp and compared the evoked action potentials (APs) of lentivirus-injected TG 7 days after pIONL. Fig5.a-b displays typical traces of action potentials caused by 2-fold rheostatic currents in TG neurons. ( 2×rheobase) , which was increased after pIONL and decreased in neurons infected by LV- Anxa10-shRNA-1.( P <0.001, Sham vs pIONL; P .<0.05, pIONL +shRNA-NC vs pIONL +shRNA-1, Student’s t-test). In contrast with the sham-operated mice, the neurons of the operated ipsilateral mice displayed apparent hyperexcitability, which featured with obviously lower rheobase and neurons infected with LV-Anxa10-shRNA-1. Fig5.c showed a significant shift 7days after pIONL (P <0.001, Sham vs pIONL; P .<0.001, pIONL +shRNA-NC vs pIONL +shRNA-1, Student’s t-test). The firing frequency of neurons responding to the depolarizing current step was higher after 7 days with PIONL (P < 0.001, Sham vs pIONL, Two-way ANOVA). Figure5.d). This elevated frequency was reversed by knocking down of Anxa10 (P <0.01, pIONL +shRNA-NC vs pIONL +shRNA-1, Two-way ANOVA, Fig5.e). During the experiment, Small-diameter TG neurons are primarily selected for whole-cell patch-clamp recordings. In these different groups, we compared passive membrane properties, resting membrane potential (RMP) and membrane capacitance (Cm). The neurons exhibited nearly identical RMP and Cm (P >0.05, Sham vs pIONL; P >0.05, pIONL +shRNA-NC vs pIONL +shRNA-1, Student’s t-test; Fig5.f-g). During the experiment, the cells with green fluorescence infected by lentivirus were selected for recording in pIONL +shRNA-NC and pIONL +shRNA-1 groups (Fig5.h). These data imply that Anxa10 is drawn into the increased neuronal excitability after pIONL.

Trigeminal nerve is the fifth of the 12 pairs of cranial nerves. It is a mixture of sensory and motor. TNP is the most common clinical neurological disease(Smith et al. 2021; Basic et al. 2017). Understanding the exact mechanism leading to the progression of TNP will not only help to elucidate its pathophysiology but also to develop effective treatment methods (Maarbjerg et al. 2017). This study is the first to discover Anxa10 in neuropathic pain caused by pIONL. Firstly, we demonstrated that Anxa10 increased in the TG after pIONL. Then we injected the shRNA of Anxa10 in the TG, we found that knocking down of it can suppress the pIONL-induced mechanical hyperalgesia restrain the expression of some cytokines and decrease the excitability of neurons in the TG. Our findings supported a pivotal role of Anxa10 in TNP.

Annexins are a family of Ca²⁺ binding proteins and phospholipids, which contain over 500 different gene products and are expressed in most phyla and species(Koerdt er al. 2019) . Previous studies mostly focused on cancer( Mendez et al. 2021). Recently, people began to pay attention to the role of such molecules in pain. For example, Annexin A1 inhibits remifentanil-induced hyperalgesia. It can suppress remifentanil-induced hyperalgesia and play down NMDA receptor phosphorylation by CXCL12 / CXCR4 in rat spinal cord(Li et al. 2019). Anxa2 can bind a variety of ion channels and regulate TRPA1 channels in sensory neurons in vivo(Avenali et al. 2014). The expression of Anxa3 is co-localized with microglia and is participated in the CCI-induced rat neuropathic pain model(Zou et al. 2017). Annexin A5 is widely used as an indicator of early cell apoptosis(Kuge el al. 2007). Annexin A8 controls the recruitment of leukocytes to activated endothelial cells by delivering CD63 on the cell surface (Poeter et al. 2014). Anxa10 has only previously been shown to increase expression after SNL and has not been studied in other pain models. Here, our gene microassay firstly reveals the expression of Anxa10 increased significantly after pIONL. Our study examined mechanical allodynia induced by pIONL can be reversed by microinjection of Anxa10-shRNA in the TG. Given these,we concluded that Anxa10 participates in the trigeminal pain induced by pIONL. We carried out this study to explore the involvement of Anxa10 in the formation and development of TNP.

Considerable evidences suggests that glial-neuronal cross-talk is a vital part in the growth of neuropathic pain including trigeminal pain by pIONL(Asano et al. 2020; Won et al. 2014; Luo et al. 2019). In previous study, CCL2/CCR2 in the trigeminal spinal subnucleus caudalis can be regarded as the signaling molecules between astrocytes and neurons and contribute to TNP (Zhang et al. 2012 ). Consistent with these, Lu et al. discoverd that the spinal Anxa10 gene was significantly upregulated in astrocytes and neurons in a SNL-induced neuropathic pain mouse model and was an important component of neuropathic pain pathogenesis (Lu et al. 2016). Given this, we hypothesized that Anxa10 probably also participate in TNP through this mechanism. The double-immunofluroescence analysis in the present research proved that Anxa10-positive double-labeled with TUJ1, IBA4 and GFAP. Take together all above, we reasonly infered that the glial-neuronal Anxa10 pathway participated in the TNP after pIONL. In a basic research on TNP, it was pointed out that the expression of inflammatory factors such as Interleukin-1β and Tumor necrosis factor-α in TG would be upregulated, and they could induce neurons and glial cells to overexcited inflammatory responses through paracrin( Goto et al. 2016). Recently, Sun et had reported that Anxa10 could induce the expression of inflammatory factors in the spinal cord(Sun et al. 2019). In our current research, we found that TNF-α and IL-1β increased after pIONL, the expression of them decreased after knocking down of Anxa10. In view of these, it can be guessed that IL-1β and TNF-α are the key mediators. Activated glial cells release them to sensitize neurons.

In recently research, peripheral nerve injury was connected with DRG’s changes of excitability of sensory neurons. (Takeda et al. 2007; Xie et al. 2018 ). Our findings firstly recorded the changes in neuronal excitability after pIONL and after injection of Anxa10 shRNA. We observed that neuronal excitability increased after pIONL and decreased after shRNA injection. Few studies pointed that the inflammatory factors can control the amplitude of the synaptic response, enhance the excessive activity of neurons, and at the same time, they that can be released again stimulate the proliferation of glial cells, and the activated glial cells further promote pro-inflammatory cytokines( Zhang et al. 2016; Stemkowski et al. 2021). In this research, we infered that the expression of these factors forms a crosstalk between glial cells and neurons, changing the excitability of sensory neurons in the TG, resulting in a sustained release of pain mediators.

This study also has some shortcomings. In this study, shRNA was injected immediately after modeling, but shRNA was not injected before and after modeling some days. We will further study and compare its impact on behavior in the future. At present, there are no agonists and inhibitors of Anxa10 on sale. The shRNA of Anxa10 is used in this research, which may affect on the results. Anxa10 is considered to be a calcium binding protein. We speculate that its role in trigeminal neuralgia may be related to calcium channels. We hope to further explore this speculation in the future through agonists.

This study proved for the first time that Anxa-10 in the occurrence and maintenance of TNP, but the ligands for Anxa-10 can be further studied. In the future, we will further study which cytokines regulate Anxa-10 and then lead to the proliferation of glial cells and the excitement of neurons in the occurance of hyperalgesia and allodynia.

Anxa-10 can generate and maintain neuropathic pain caused by pIONL by activating glial cells, promoting the expression of inflammatory molecules, increasing the excitability of neurons, and contacting neurons and glial cells.

Acknowledgements The authors are grateful to all staff members of Research Center of Clinical Medicine, Affiliated Hospital of Nantong University for their technical support.

Funding All authors never received funds, grants, or other finical support during the writing process.

Conflict of Interest All authors declare no conflicts of interest.

Ethical Approval This study was conducted in accordance with the principles of the Declaration of Helsinki. We gained the approval from Ethics Committee of Nantong University (date2021.03.25/number S20210325-933).

Informed Consent We promised that every author have read the submission guidelines. We have ensured that the thesis complies with these guidelines in all aspects.

Author Contribution All authors actively participated in the planning and development of the study and contributed to the submitted article earnestly. MXH and JY carried out the study with the help of ZP, JF and LL. JY wrote the main manuscript text and ZH prepared figures.JY, ZH and CQ analyzed the data. All authors reviewed the manuscript and approved the final version..

Cruccu, G., Di Stefano, G., & Truini, A. (2020). Trigeminal Neuralgia. The New England journal of medicine, 383(8), 754–762. DOI:10.1056/NEJMra1914484.
Yadav, Y. R., Nishtha, Y., Sonjjay, P., Vijay, P., Shailendra, R., & Yatin, K. (2017). Trigeminal Neuralgia. Asian journal of neurosurgery, 12(4), 585–597. DOI: 10.4103/ajns.AJNS_67_14.
Xu, M., Aita, M., & Chavkin, C. (2008). Partial infraorbital nerve ligation as a model of trigeminal nerve injury in the mouse: behavioral, neural, and glial reactions. The journal of pain, 9(11), 1036–1048. DOI: 10.1016/j.jpain.2008.06.006.
Lambru, G., Zakrzewska, J., & Matharu, M. (2021). Trigeminal neuralgia: a practical guide. Practical neurology, 21(5), 392–402. DOI: 10.1136/practneurol-2020-002782
Koerdt, S. N., Ashraf, A., & Gerke, V. (2019). Annexins and plasma membrane repair. Current topics in membranes, 84, 43–65. DOI: 10.1016/bs.ctm.2019.07.006.
Gerke V, Moss SE.(2002). Annexins: From Structure to Function. Physiol Rev, 82:331–371. DOI: 10.1152/physrev.00030.2001.
Rentero C, Blanco-Muñoz P, Meneses-Salas E, Grewal T, Enrich C. (2018). Annexins—Coordinators of Cholesterol Homeostasis in Endocytic Pathways. Int J Mol Sci, 19:1444. DOI: 10.3390/ijms19051444.
Enrich C, Rentero C, Meneses-Salas E, Tebar F, Grewal T.(2017). Annexins: Ca²⁺ Effectors Determining Membrane Trafficking in the Late Endocytic Compartment. In: Krebs J, editor. Membrane Dynamics and Calcium Signaling. Advances in Experimental Medicine and Biology. Cham: Springer International Publishing, 981: 351–385. DOI: 10.1007/978-3-319-55858-5_14.
Mussunoor S, Murray G.(2008). The role of annexins in tumour development and progression. J Pathol, 16:131–140. DOI: 10.1002/path.2400.
Sun L, Xu Q, Zhang W, Jiao C, Wu H, Chen X.(2019). The involvement of spinal annexin A10/NF-κB/MMP-9 pathway in the development of neuropathic pain in rats. BMC Neurosci, 20:28. DOI: 10.1186/s12868-019-0513-9.
Lu Y, Ni S, He L-N, Gao Y-J, Jiang B-C. (2016). Annexin A10 is involved in the development and maintenance of neuropathic pain in mice. Neurosci Lett, 631:1–6. DOI: 10.1016/j.neulet.2016.08.009.
Li F, Xue Z-Y, Liu X, Bai G, Wang Y-L. (2018). Annexin A10 contributes to chronic constrictive injury-induced pain through activating ERK1/2 signalling in rats. Int J Neurosci ,128:125–132. DOI: 10.1080/00207454.2017.1375913.
Jha, M. K., Jo, M., Kim, J. H., & Suk, K. (2019). Microglia-Astrocyte Crosstalk: An Intimate Molecular Conversation. The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry, 25(3), 227–240. DOI: 10.1177/1073858418783959.
Pottorf, T. S., Rotterman, T. M., McCallum, W. M., Haley-Johnson, Z. A., & Alvarez, F. J. (2022). The Role of Microglia in Neuroinflammation of the Spinal Cord after Peripheral Nerve Injury. Cells, 11(13), 2083. DOI: 10.3390/cells11132083.
Zhou, B., Zuo, Y. X., & Jiang, R. T. (2019). Astrocyte morphology: Diversity, plasticity, and role in neurological diseases. CNS neuroscience & therapeutics, 25(6), 665–673.DOI: 10.1111/cns.13123.
Rudge, J. S., & Silver, J. (1990). Inhibition of neurite outgrowth on astroglial scars in vitro. The Journal of neuroscience : the official journal of the Society for Neuroscience, 10(11), 3594–3603. DOI: 10.1523/JNEUROSCI.10-11-03594.1990
Paterniti, I., et al., (2014). Docosahexaenoic acid attenuates the early inflammatory response following spinal cord injury in mice: in-vivo and in-vitro studies. J Neuroinflammation. 11, 6. DOI: 10.1186/1742-2094-11-6.
Yuan, J., Liu, W., Zhu, H., Chen, Y., Zhang, X., Li, L., Chu, W., Wen, Z., Feng, H., & Lin, J. (2017). Curcumin inhibits glial scar formation by suppressing astrocyte-induced inflammation and fibrosis in vitro and in vivo. Brain research, 1655, 90–103. DOI: 10.1016/j.brainres.2016.11.002.
Inoue, H., Kuroda, H., Ofusa, W., Oyama, S., Kimura, M., Ichinohe, T., & Shibukawa, Y. (2021). Functional Coupling between the P2X7 Receptor and Pannexin-1 Channel in Rat Trigeminal Ganglion Neurons. International journal of molecular sciences, 22(11), 5978.DOI: 10.3390/ijms22115978.
Wei, S., Qiu, C. Y., Jin, Y., Liu, T. T., & Hu, W. P. (2021). TNF-α acutely enhances acid-sensing ion channel currents in rat dorsal root ganglion neurons via a p38 MAPK pathway. Journal of neuroinflammation, 18(1), 92. DOI: 10.1186/s12974-021-02151-w.
Noh, M. C., Stemkowski, P. L., & Smith, P. A. (2019). Long-term actions of IL-1β on K+, Na + and Ca2 + channel currents in small, IB4-positive dorsal root ganglion neurons; possible relevance to the etiology of neuropathic pain. Journal of neuroimmunology, 332, 198–211. DOI: 10.1016/j.jneuroim.2019.05.002.
Smith CA, Paskhover B, Mammis A.(2021). Molecular mechanisms of trigeminal neuralgia: A systematic review. Clin Neurol Neurosurg ,200:106397. DOI: 10.1016/j.clineuro.2020.106397
Maarbjerg, S., Di Stefano, G., Bendtsen, L., & Cruccu, G. (2017). Trigeminal neuralgia - diagnosis and treatment. Cephalalgia : an international journal of headache, 37(7), 648–657. DOI: 10.1177/0333102416687280.
Bašić Kes, V., & Zadro Matovina, L. (2017). Accommodation to Diagnosis of Trigeminal Neuralgia. Acta clinica Croatica, 56(1), 157–161. DOI: 10.20471/acc.2017.56.01.21.
Koerdt, S. N., Ashraf, A., & Gerke, V. (2019). Annexins and plasma membrane repair. Current topics in membranes, 84, 43–65. DOI: 10.1016/bs.ctm.2019.07.006
Méndez-Barbero, N., Gutiérrez-Muñoz, C., Blázquez-Serra, R., Martín-Ventura, J. L., & Blanco-Colio, L. M. (2021). Annexins: Involvement in cholesterol homeostasis, inflammatory response and atherosclerosis. Anexinas: implicación en la homeostasis del colesterol, la respuesta inflammatory la aterosclerosis. Clinica e investigacion en arteriosclerosis : publicacion oficial de la Sociedad Espanola de Arteriosclerosis, 33(4), 206–216. DOI: 10.1016/j.arteri.2020.12.010
Li T, Wang H, Wang J, Chen Y, Yang C, Zhao M, Wang G, Yang Z.(2019). Annexin 1 inhibits remifentanil-induced hyperalgesia and NMDA receptor phosphorylation via regulating spinal CXCL12/CXCR4 in rats. Neurosci Res ,144:48–55. DOI: 10.1016/j.neures.2018.07.007
Avenali L, Narayanan P, Rouwette T, Cervellini I, Sereda M, Gomez-Varela D, Schmidt M. (2014). Annexin A2 Regulates TRPA1-Dependent Nociception. J Neurosci ,34:14506–14516. DOI: 10.1523/JNEUROSCI.1801-14.2014.
Zou W, Xu W, Song Z, Zhong T, Weng Y, Huang C, Li M, Zhang C, Zhan X, Guo Q. (2017). Proteomic Identification of an Upregulated Isoform of Annexin A3 in the Spinal Cords of Rats in a Neuropathic Pain Model. Front Neurosci, 11:484. DOI: 10.3389/fnins.2017.00484
Kuge Y, Zhao S, Takei T, Tamaki N. (2009). Molecular Imaging of Apoptosis with Radio-Labeled Annexin A5 Focused on the Evaluation of Tumor Response to Chemotherapy. Anticancer Agents Med Chem ,9:1003–1011. DOI: 10.2174/187152009789377736.
Poeter M, Brandherm I, Rossaint J, Rosso G, Shahin V, Skryabin BV, Zarbock A, Gerke V, Rescher U. (2014). Annexin A8 controls leukocyte recruitment to activated endothelial cells via cell surface delivery of CD63. Nat Commun ,5:3738. DOI: 10.1038/ncomms4738.
Asano, S., Hayashi, Y., Iwata, K., Okada-Ogawa, A., Hitomi, S., Shibuta, I., Imamura, Y., & Shinoda, M. (2020). Microglia-Astrocyte Communication via C1q Contributes to Orofacial Neuropathic Pain Associated with Infraorbital Nerve Injury. International journal of molecular sciences, 21(18), 6834. DOI: 10.3390/ijms21186834.
Won, K. A., Kim, M. J., Yang, K. Y., Park, J. S., Lee, M. K., Park, M. K., Bae, Y. C., & Ahn, D. K. (2014). The glial-neuronal GRK2 pathway participates in the development of trigeminal neuropathic pain in rats. The journal of pain, 15(3), 250–261. DOI: 10.1016/j.jpain.2013.10.013.
Luo, D., Lin, R., Luo, L., Li, Q., Chen, T., Qiu, R., & Li, Y. (2019). Glial Plasticity in the Trigeminal Root Entry Zone of a Rat Trigeminal Neuralgia Animal Model. Neurochemical research, 44(8), 1893–1902. DOI: 10.1007/s11064-019-02824-2.
Zhang, Z. J., Dong, Y. L., Lu, Y., Cao, S., Zhao, Z. Q., & Gao, Y. J. (2012). Chemokine CCL2 and its receptor CCR2 in the medullary dorsal horn are involved in trigeminal neuropathic pain. Journal of neuroinflammation, 9, 136. DOI: 10.1186/1742-2094-9-136
Goto, T., Oh, S. B., Takeda, M., Shinoda, M., Sato, T., Gunjikake, K. K., & Iwata, K. (2016). Recent advances in basic research on the trigeminal ganglion. The journal of physiological sciences : JPS, 66(5), 381–386. DOI: 10.1007/s12576-016-0448-1.
Takeda, M.; Tanimoto, T.; Kadoi, J.; Nasu, M.; Takahashi, M.; Kitagawa, J.; Matsumoto, S. (2007). Enhanced excitability of nociceptive trigeminal ganglion neurons by satellite glial cytokine following peripheral inflflammation Pain, 129, 155–166. DOI: 10.1016/j.pain.2006.10.007.
Xie, R. G., Chu, W. G., Hu, S. J., & Luo, C. (2018). Characterization of Different Types of Excitability in Large Somatosensory Neurons and Its Plastic Changes in Pathological Pain States. International journal of molecular sciences, 19(1), 161. DOI: 10.3390/ijms19010161
Zhang, Q., Cao, D. L., Zhang, Z. J., Jiang, B. C., & Gao, Y. J. (2016). Chemokine CXCL13 mediates orofacial neuropathic pain via CXCR5/ERK pathway in the trigeminal ganglion of mice. Journal of neuroinflammation, 13(1), 183. DOI: 10.1186/s12974-016-0652-1.
Stemkowski, P. L., Bukhanova-Schulz, N., Baldwin, T., de Chaves, E. P., & Smith, P. A. (2021). Are sensory neurons exquisitely sensitive to interleukin-1β and TNF-α Journal of neuroimmunology, 354, 577529. DOI: 10.1016/j.jneuroim.2021.577529.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Knock-down of Annexin A10 in trigeminal ganglion attenuates trigeminal neuropathic pain in mice

Status:

Version 1

Abstract

Figures

Introduction

Methods And Materials

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1