Inhibition of the TRIM24 bromodomain reactivates latent HIV-1

doi:10.21203/rs.3.rs-2083312/v1

Download PDF

Article

Inhibition of the TRIM24 bromodomain reactivates latent HIV-1

https://doi.org/10.21203/rs.3.rs-2083312/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 11 Jan, 2023

Read the published version in Scientific Reports →

You are reading this latest preprint version

Expression of the HIV-1 genome by RNA Polymerase II is regulated at multiple steps, as are most cellular genes, including recruitment of general transcription factors and control of transcriptional elongation from the core promoter. We discovered that tripartite motif protein TRIM24 is recruited to the HIV-1 Long Terminal Repeat (LTR) by interaction with TFII-I and causes transcriptional elongation by stimulating association of PTEF-b/ CDK9. Because TRIM24 is required for stimulation of transcription from the HIV-1 LTR, we were surprised to find that IACS-9571, a specific inhibitor of the TRIM24 C-terminal bromodomain, induces HIV-1 provirus expression in otherwise untreated cells. IACS-9571 reactivates HIV-1 in T cell lines bearing multiple different provirus models of HIV-1 latency. Additionally, treatment with this TRIM24 bromodomain inhibitor encourages productive HIV-1 expression in newly infected cells and inhibits formation of immediate latent repressed provirus. IACS-9571 synergizes with PMA, ionomycin, TNF-α, PEP005, and JQ1 to activate HIV-1 expression. Furthermore, co-treatment of CD4⁺ T cells from individuals with HIV-1 on antiretroviral therapy (ART) with PEP005 and IACS-9571 caused robust provirus expression. Notably, IACS-9571 did not cause global activation of T cells; rather, it inhibited induction of IL2 and CD69 expression in human PBMCs and Jurkat T cells treated with PEP005 or PMA. These observations indicate the TRIM24 bromodomain inhibitor IACS-9571 represents a novel HIV-1 latency reversing agent (LRA), and unlike other compounds with this activity, causes partial suppression of T cell activation while inducing expression of latent provirus.

TRIM24

bromodomain

IACS-9571

HIV-1

latency-reversing agent

shock and kill

LTR

transcriptional elongation

CDK9

P-TEFb

The global HIV pandemic has persisted for 40 years¹. Despite intensive research over this time, an estimated 38 million people are currently living with HIV-1, the vast majority of whom will require anti-retroviral therapy (ART) for the remainder of their lives². Current anti-retroviral therapy (ART) for HIV-1 can suppress virus replication to undetectable levels, but does not affect the population of latently infected cells that harbor transcriptionally silenced provirus developed during the course of infection³. These latently infected cells represent a major barrier for development of a cure for HIV-1 infection, and consequently a variety of therapeutic strategies to eliminate these cells are currently under intense investigation^4,5. One potential strategy that has garnered considerable attention, initially designated "Shock and Kill" would involve intervention to force reactivation of latent provirus such that latently infected cells become exposed to the host immune response and/ or additional therapeutic means for their elimination⁶. This potential strategy has prompted development and characterization of small molecule drugs and compounds that are capable of inducing expression of latent provirus, collectively referred to as latency reversing agents (LRAs). LRAs characterized to date inhibit a variety of functions that impact regulation of transcription from the HIV-1 LTR, including histone modification, transcriptional elongation, and signal transduction⁷.

The 5' long terminal repeat (LTR) of integrated HIV-1 provirus contains numerous cis-elements for host cell factors that respond to multiple cellular signaling pathways involved in immune cell stimulation as well as growth factors and cytokines⁸. Considering the number and variety of transcription factors capable of binding the HIV-1 LTR, many of which have transcriptional activation function⁹, it is remarkable that this virus invariably develops transcriptionally silenced provirus in resting memory T cells and monocyte-derived macrophages. Latent provirus is produced by multiple pathways in unstimulated cells, involving layers of regulation including, but not limited to, down regulation of transcription factors responsive to immune signaling pathways, binding of transcriptional repressors to the 5' LTR that recruit histone deacetylases (HDACs) and histone methyltransferases (HMTs), and subsequent recruitment of silencing complexes that promote spreading of repressive chromatin marks from the silenced LTR¹⁰. Consequently, HIV-1 expression in cells that revert to a resting state becomes shut down over a period of days through a combination of epigenetic silencing and additional mechanisms that include loss of the viral transactivator protein TAT. Additionally, ~ 50% of cells newly infected with HIV-1 produce a population of provirus that is transcriptionally repressed immediately¹¹. This mode of latency was denoted early or immediate latency, and appears to involve mechanism(s) that are influenced by signaling downstream of the T-cell receptor¹² and possess the capability of bypassing the function of TAT¹³, and typified by association of YY1 with the 5' LTR¹⁴.

Latent HIV-1 provirus in resting memory T helper cells becomes reactivated in response to T-cell receptor (TCR) engagement with antigen presenting dendritic cells. TCR signaling stimulates the activity of multiple transcriptional activators capable of binding the 5' HIV-1 LTR which cause recruitment of general transcription factors necessary for transcription of the provirus genome¹⁵. Like many cellular genes, the 5' LTR promoter of latent HIV-1 is associated with RNA Pol II that is paused shortly after initiation because of inhibition by the factors NELF and DSIF^16,17. Consequently, a key event for reactivation of HIV-1 provirus involves recruitment of viral TAT protein which binds nascent HIV-1 TAR RNA associated with paused RNA Polymerase II. TAT directly recruits the P-TEFb complex containing CDK9, which phosphorylates the pausing factors NELF and DSIF, and RNA Pol II CTD S2 to promote transcriptional elongation¹⁸. Reactivation of HIV-1 expression in response to TCR signaling requires multiple factors specifically bound to the 5' LTR, including TFII-I which is constitutively associated with two highly conserved cis-elements flanking the LTR enhancer region in association with USF1/2^19,20. We discovered that TFII-I recruits the coactivator protein Tripartite-Motif containing protein 24 (TRIM24) to the LTR, and this interaction promotes transcriptional elongation from the LTR core promoter by RNA Polymerase II²¹, an effect that is associated with enhanced recruitment of CDK9 and increased RNA Pol II CTD on serine 2 phosphorylation. These observations indicate that TRIM24 may function as a transcriptional coactivator by promoting recruitment of P-TEFb.

TRIM24, previously designated TIF-1α, was initially discovered as a co-factor for transcriptional activation by nuclear hormone receptors²². Like other TRIM protein family members, TRIM24 contains conserved N-terminal RING, B-Box zinc finger, and coiled-coil domains, in addition to C-terminal PHD (plant homeodomain) and bromodomain motifs, which bind histone H3 with the combination of unmodified K4 and acetylated K23 epigenetic marks²³. Overexpression of TRIM24 is associated with poor prognosis of a variety of cancers including breast, non-small cell lung, hepatocellular and glioblastomas^24,25, but overall the molecular mechanism(s) by which this factor regulates transcription has not been elucidated. Specific inhibitors that target bromodomains have been developed, as this motif is considered to be "druggable"²⁶. Using protein structure guided design, a TRIM24 bromodomain binding compound, IACS-9571, was developed with nanomolar affinity that inhibits interaction with histone H3K23Ac peptides²⁷. Interestingly, IACS-9571 was found to inhibit cell growth and metastatic invasive potential of glioblastomas from patients²⁵. These observations support the contention that TRIM24 may contribute to cancer progression through interaction of chromatin through its bromodomain.

In this study we examine the effect of IACS-9571 on HIV-1 transcription, and surprisingly, find this compound causes reactivation of latent provirus in multiple different T cell line models of provirus latency, and produces synergistic effects in combination with T cell signaling agonists. Treatment of T cells with IACS-9571 inhibits production of immediate latent provirus, and encourages productive expression of HIV-1 in newly infected cells. IACS-9571 treatment caused elevated association of TRIM24 with the LTR suggesting that inhibition of the bromodomain may cause redistribution of this factor from cellular genes. Treatment of CD4⁺ T cells from individuals with HIV-1 on ART with a combination of PEP005 and IACS-9572 resulted in robust viral transcription, while also suppressing expression of T cell activation markers IL2 and CD69. These results indicate that the TRIM24 bromodomain inhibitor IACS-9571 represents a novel class of latency reversing agent which may prove useful for strategies to purge latently infected cells.

The TRIM24 bromodomain inhibitor IACS-9571 promotes HIV-1 expression. We discovered that TRIM24 is recruited to the HIV-1 LTR by interaction with TFII-I, and this causes enhanced elongation from the HIV-1 LTR through elevated CDK9 recruitment and RNA Pol II CTD S2 phosphorylation²¹. Importantly, Jurkat cell lines bearing TRIM24 gene knockouts are defective for reactivation of latent HIV-1 in response to T cell signaling. Consequently, we examined what effect an inhibitor of the TRIM24 bromodomain might have on expression of HIV-1, using the Jurkat TAT mHIV-Luciferase cell line which bears an HIV-1 mini-virus reporter where luciferase is expressed as a fusion with Gag (Fig. 1A)^14,21. Surprisingly, rather than inhibiting HIV-1 expression, IACS-9571 caused activation of HIV-1 luciferase expression in a dose-dependent manner, where treatment with 25 µM caused significant 3-fold induction in otherwise untreated cells (Fig. 1B). In parallel experiments we found that this compound produced minimal toxicity at concentrations where we observed significant reactivation (Fig. 1C). A similar effect of IACS-9571 was observed using the JLat10.6 cell line, which bears a full-length HIV-1 provirus where Nef has been replaced by GFP (Fig. S1).

We also examined the effect of IACS-9571 shortly following HIV-1 infection using a dual reporter Red-Green HIV (RGH) which enables detection of infected cells by expression of mCherry from an internal PGK promoter, and independent measurement of expression from the 5' LTR with a GFP reporter (Fig. 1D)¹¹. With this reporter virus, productively infected cells express both mCherry and GFP, whereas infected cells that produce immediate latent provirus only express mCherry (Fig. 1D). Treatment of RGH infected cells with a combination of PMA and ionomycin 4 days post-infection produced ~ 70% productive infections, a significant increase from the ~ 40% productive infections in DMSO (Ve) treated cells (Fig. 1E). Interestingly, we also observe an increase in the proportion of productively infected cells, albeit smaller, caused by IACS-9571 compared to the untreated control (Fig. 1E), indicating that this TRIM24 bromodomain inhibitor is capable of causing activation of latent provirus in a significant proportion of newly infected T cells.

Additionally, we examined the effect of IACS-9571 on establishment of latency or productive replication upon initial infection. Untreated Jurkat T cells or cells treated with 10 µM IACS-9571, were infected with the RGH reporter virus and the proportion of productively infected cells, indicated by expression of both GFP and mCherry was monitored for 10 days post-infection (Fig. 2A). Consistent with previous observations, we found that ~ 35% of infected untreated cells (Ve) developed productive infections at 4 days post infection, as indicated by expression of GFP; the proportion of productively infected cells decayed from 4–10 days as more cells established latency by epigenetic mechanisms (Fig. 2A)¹³. In contrast, Jurkat cells treated with IACS-9571 throughout the course of infection produced a significantly greater proportion of productively infected cells, such that ~ 50% of infected cells expressed GFP 4 days post-infection (Fig. 2A, IACS-9571). Throughout the course of treatment, negligible effects upon cell viability were observed (Fig. 2B). These observations indicate that the TRIM24 bromodomain inhibitor dissuades establishment of immediate latency in newly infected cells and forces productive expression of viral RNAs from the 5' LTR.

IACS-9571 produces synergistic effects with T cell signaling agonists. HIV-1 transcription is activated by multiple transcriptional activators under the control of immune cell signaling pathways stimulated by second messengers and protein kinases regulated by engagement of the T cell receptor and various cytokines, including TNF-α and IL2^15,8. These signaling pathways cause activation of multiple transcriptional activators bound to the LTR enhancer region, including NF-κB, AP1, GABP/ Ets, NFAT, and USF1/2-TFII-I (RBF-2)^28,5. To examine how IACS-9571 might influence responses to these various signaling mechanisms, we measured the effect of this compound on HIV-1 expression in combination with agonists of T cell signaling pathways. Jurkat mHIV-Luciferase cells bearing the integrated LTR-luciferase mini-virus reporter (Fig. 1A) were treated with 10 µM IACS-9571 and luciferase expression was measured over the next 24 hours. At this concentration, IACS-9571 on its own produces a modest, but significant ~ 2-fold induction of luciferase expression at 6 hours (Fig. 3A). However, we found this concentration of IACS-9571 produced a synergistic effect for activation of HIV-1 expression in combination with every T cell signaling agonist we examined. This includes PMA (Fig. 3B, 3D), which causes activation of multiple factors (NF-κB, AP1, GABP/ Ets); Ionomycin (Fig. 3C, 3D), which activates NFAT; TNF-α (Fig. 3E), which stimulates NF-κB and AP1; PEP005 (Fig. 3F), a latency reversing agent which acts through NF-κB; and JQ1, a BRD4 bromodomain inhibitor (Fig. 3G). In contrast, co-treatment of the reporter cells with a combination of IACS-9571 and the HDAC inhibitor SAHA did not produce a synergistic effect on LTR-luciferase expression (Fig. 3H). These observations are consistent with previous experiments demonstrating synergy between various latency reversing agents that function through independent mechanisms ⁷, and suggest that inhibition of the TRIM24 bromodomain likely does not cause reactivation of HIV-1 expression by acting as an upstream agonist for activators bound to the LTR enhancer region.

TRIM24 is necessary for activation of HIV-1 expression, including by IACS-9571. The TRIM24 bromodomain has similar structure to that of another protein designated BRPF1, and IACS-9571 was initially shown to bind both of these bromodomains with similar affinity²⁷. Consequently, it is possible that the effects we observe for IACS-9571 on the HIV-1 LTR may be mediated by a factor other than TRIM24, including possibly BRPF1²⁷. To examine this possibility, we compared the effect of IACS-9571 on reactivation of HIV-1 provirus in the mHIV-Luciferase Jurkat cell line bearing the HIV-1 Luciferase reporter provirus (Fig. 1A), and a derivative line bearing a CRISPR/ Cas9-mediated gene disruption of TRIM24 (Fig. 4, TRIM24 KO)²¹. As reported above, we observe dose-dependent induction of HIV-1 expression in WT cells treated with IACS-9571, but this effect is completely inhibited in cells bearing the TRIM24 knockout (Fig. 4A). A similar effect was observed in cells treated with both IACS-9571 and PMA (Fig. 4B). Here, we again observed a synergistic effect of this treatment on HIV-1 expression in WT mHIV-Luciferase cells, but reactivation is significantly inhibited in the TRIM24 knockout line, with only slight activation at the highest concentrations of IACS-9571. These results indicate that the effect of IACS-9571 on HIV-1 expression is largely dependent on the function of TRIM24.

PROTAC-induced degradation of TRIM24 inhibits HIV-1 expression. To examine the requirement of TRIM24 for induction of HIV-1 we used a Von Hippel-Lindau (VHL)-engaging functional degrader of TRIM24, designated dTRIM24²⁹. This chemical derivative is comprised of IACS-9571 conjugated to the VHL binding ligand VL-269 to produce a proteolysis-targeting chimeric compound (PROTAC), which promote degradation of target proteins by forcing interaction with the VHL ubiquitin ligase³⁰. Treatment of Jurkat T cells bearing a mini-dual HIV-1 reporter provirus¹³ (Fig. 5A) with dTRIM24 causes degradation of TRIM24 in Jurkat cells at concentrations between 0.5–5 mM after 24 hours, as determined by immunoblotting (Fig. 5B, lanes 2–5). As with previous observations, dTRIM24 mediated degradation is lost at higher concentrations (Fig. 5B, lane 6), an effect that is proposed to result from the molecule favoring binary interaction over ternary complex formation²⁹. Having verified dTRIM24 concentrations that produce its degradation, we measured induction of HIV-1 provirus treated cells by analyzing dsRed expression (Fig. 5A) 20 hours following stimulation with PMA. Consistent with our previous results indicating that TRIM24 is required for reactivation of latent HIV-1²¹, we found that cells treated with concentrations of dTRIM24 that reduce TRIM24 protein levels also displayed a corresponding decrease in expression of the 5' LTR dsRed reporter in these cells (Fig. 5C), but without significantly affecting cell viability at effective concentrations (Fig. 5D). These results demonstrate confirm that the TRIM24 bromodomain inhibitor IACS-9571 produces an opposite effect on HIV-1 transcription than does complete inhibition of TRIM24 protein function by dTRIM24 or knockout of the TRIM24 gene by CRISPR.

The C-terminal TRIM24 bromodomain is dispensable for activation of HIV-1 expression. Because the IACS-9571 TRIM24 bromodomain inhibitor produces the opposite effect as TRIM24 depletion, we examined whether the C-terminal bromodomain of TRIM24 was necessary for activation of HIV-1 expression. To examine this, we co-transfected HEK293T cells with vectors expressing WT TRIM24, or a series of TRIM24 mutants bearing ORF deletions and point mutations in the C-terminal PHD-bromodomain motifs (Fig. 6A, B) in combination with an HIV-1 LTR-luciferase reporter gene. Using this assay, we have previously demonstrated that the effect of TRIM24 for activation of HIV-1 expression does not require the viral transactivator TAT²¹. As with previous experiments, co-transfection of WT TRIM24 expression plasmid causes ~ 3-fold stimulation of the HIV-1 luciferase expression (Fig. 6B, TRIM24). Interestingly, this effect of TRIM24 does not require the C-terminal PHD-bromodomain region, as a deletion lacking the entire C-terminus (Fig. 6B, ΔC-Terminus) causes the same effect as WT TRIM24. Similarly, derivatives bearing amino acid substitutions in the C-terminal PHD-bromodomain motifs (F979A, N980A, C840W) that disrupt chromatin binding cause comparable levels of HIV-l luciferase expression as WT (Fig. 6B). In contrast, deletion of the complete N-terminus or the coiled-coil motif (Fig. 6C) prevented stimulation of HIV-1 luciferase activity by TRIM24 (Fig. 6D). A mutant with deletion of the BB2 motif was less effective for stimulation of HIV-1 expression (Fig. 6D), but we note that this protein is expressed at significantly lower levels than the other TRIM24 derivatives (Fig. 6C). These results indicate that the bromodomain motif is not required for the effect of TRIM24 for reactivation of HIV-1 transcription.

TRIM24 LTR occupancy is enhanced in response to IACS-9571 treatment. We have previously shown that TRIM24 is associated with the HIV-1 LTR at the RBE3 and RBE1 elements as mediated by direct interaction with the transcription factor TFII-I²¹. The TRIM24 C-terminal tandem bromodomain – plant homeodomain (PHD) is capable of binding histones with preference for H3K23ac and H3K4me0 marks, respectively²⁴. Consequently, because TRIM24 is presumed to be predominantly recruited to chromatin via interactions mediated by the C-terminal bromo/ PHD domains, we examined the effect of bromodomain inhibition on recruitment of TRIM24 to the HIV-1 LTR. To examine this, we expressed Flag tagged TRIM24 in Jurkat cells harboring an HIV-1 reporter virus (Fig. 7A, lanes 2 and 3). Using ChIP-qPCR, we observed significantly enhanced interaction of TRIM24 with the LTR in cells treated with IACS-9571 (Fig. 7B). This observation is consistent with our previous results indicating that TRIM24 is a limiting co-factor for activation of HIV-1 expression²¹, and suggests that inhibition of the TRIM24 bromodomain may inhibit global interaction of this factor with chromatin, thereby increasing the pool of TRIM24 available for recruitment by TFII-I bound to the HIV-1 LTR.

IACS-9571 stimulates HIV-1 transcriptional elongation. Our previous results indicate that recruitment of TRIM24 to the HIV-1 LTR by TFII-I causes enhanced elongation of transcription by RNA Polymerase II from the viral core promoter²¹. Consequently, we examined whether treatment of cells with IACS-9571, which causes enhanced association of TRIM24 with the HIV-1 LTR also stimulates transcriptional elongation. We found that treatment of Jurkat mHIV-Luciferase cells (Fig. 1A) with IACS-9571 did not cause enhanced recruitment of RNAPII to the LTR, rather we observe a slight decrease in PolII occupancy at the LTR in otherwise untreated cells (Fig. 8A, compare Ve vs IACS-9571). Initiation of eukaryotic transcription is associated with phosphorylation of RNAPII at the C-terminal domain (CTD) serine 5, a modification mediated by CDK7 of TFIIH³¹. As with total RNA Pol II occupancy, we observed slightly less pS5-modified RNAPII following IACS-9571 treatment as compared to untreated cells (Fig. 8B). Elongation of transcription from the LTR is stimulated by recruitment of pTEF-b, containing CDK9 which phosphorylates RNAPII CTD S2, among other factors, to promote transition from a paused to elongating transcription complex³². Interestingly, in contrast to RNAPII and CTD pS5, we found that treatment of mHIV-Luciferase cells with IACS-9571 cause elevated association of RNAPII pS2 with the LTR as compared to untreated cells (Fig. 8C). Additionally, IACS-9571 treatment caused significant enrichment of CDK9 (PTEF-b) at the HIV-1 core promoter (Fig. 8D, RBE1). These results are consistent with our previous observations indicating that recruitment of TRIM24 to the HIV-1 LTR causes enhanced recruitment of pTEF-b/ Cdk9, which promotes RNAPII CTD S2 phosphorylation and elongation of transcription²¹.

Results shown above (Fig. 3) indicate that IACS-9571 causes synergistic effects of HIV-1 provirus expression in combination with T cell signaling agonists. We note that treatment with PEP005, an agonist of the PKC pathway that is stimulated by the T cell receptor³³, cause significantly enhanced recruitment of RNAPII (Fig. 8A) and phosphorylation of CTD S5 (Fig. 8B) to the HIV-1 LTR, indicating that activation of factors regulated by T cell signaling have a significant effect on recruitment of RNA Pol II to the LTR promoter for promotion of transcriptional initiation. Co-treatment of cells with IACS-9571 and PEP005 causes corresponding elevated association of RNAPII, CTD pS5, CTD pS2, and CDK9 with the LTR (Fig. 8) which is consistent with the synergistic effect on HIV-1 reporter expression produced by the combination of these treatments.

Effect of IACS-9571 on HIV-1 provirus expression in CD4 + T-cells from individuals on ART. To determine whether IACS-9571 was capable of affecting expression of HIV-1 provirus in primary CD4⁺ lymphocytes, we examined the effect of treatment on CD4⁺ T-cells isolated from individuals with HIV-1 on antiretroviral therapy. We found that treatment with 10 µM IACS-9571 on its own did not cause expression of HIV-1 mRNA in any of the cell samples from 6 participants examined (Fig. 9, compare Ve and IACS-9571). Consistent with previous observations we found that 15 nM PEP005, a PKC agonist⁷, caused a significant increase in viral transcription in cells from two of the participants (Fig. 9A, 9E, BC003 and BC008), and a more modest effect on a third participant (Fig. 9D, BC006). Interestingly, with cells from all of the participant samples, co-treatment with IACS-9571 and PEP005 caused significant induction of HIV-1 mRNA (Fig. 9), at concentrations that do not affect cell viability (Fig. S3), a result that is consistent with the synergistic effects these agents have on induction of HIV-1 reporter expression in cell lines (Fig. 3).

IACS-9571 causes partial inhibition of T cell activation. An important consideration for development of latency reversing agents as potential therapies is that treatment should produce robust and broad induction of HIV-1 expression without simultaneously causing global T cell activation. To determine the potential effect of IACS-9571 on T cell activation, we examined expression of IL2 and CD69 mRNAs in cells from participants using Q-RT-PCR. Consistent with previous results³⁴, treatment of CD4⁺ cells from participants with HIV-1 on ART with the PKC agonist PEP005 caused a significant increase in IL2 mRNA (Fig. 10). In contrast, treatment with IACS-9571 on its own did not cause elevation of IL2 mRNA levels. Moreover, we observed that treatment with IACS-9571 in combination with PEP005 resulted in suppression of IL2 mRNA induction (Fig. 10). Similar results were obtained for expression of CD69, a cell surface marker associated with T cell activation (Fig. S4). Furthermore, we observe a comparable effect on IL2 and CD69 expression in Jurkat T cells treated with the combination of PMA and IACS-9571 (Fig. S5). These results indicate that IACS-9571 must affect expression of the IL2 and CD69 genes by a different mechanism than the HIV-1 LTR. Importantly as well, no previous compound with latency reversing activity was found to produce opposite effects for T cell activation and induction of HIV-1 expression⁷.

TRIM24 was initially identified as co-activator of transcription for various nuclear receptors³⁵. This factor has E3 ubiquitin ligase activity, conferred by the N-terminal RING motif, and interacts with chromatin via the C-terminal PHD-bromodomain through binding of histone H3K4me0/H3K23ac²³. Despite its discovery as a transcriptional co-activator ~ 25 years ago³⁵, a mechanism for its function in transcriptional regulation had not been identified. We recently discovered that TRIM24 is recruited to the HIV-1 LTR by interaction with TFII-I, which promotes elongation of transcription in stimulated T cells through enhanced recruitment P-TEF-b/ CDK9 and phosphorylation of RNAPII CTD S2²¹. Consequently, we were surprised that the TRIM24 bromodomain inhibitor IACS-9571 caused elevated expression of HIV-1 provirus in otherwise untreated Jurkat T cells. This effect was accompanied by enhanced association of TRIM24 with HIV-1 LTR promoter. Because TRIM24 seems to be a limiting factor for reactivation of HIV-1 transcription²¹, our observations suggest that IACS-9571 may inhibit global interaction of this factor with chromatin and consequently increases opportunity for recruitment to the LTR by interaction with TFII-I. These observations implicate TRIM24 as an important potential target for therapies to modulate expression of latent HIV-1 provirus in patients on antiretroviral therapy. IACS-9571 causes reactivation of HIV-1 provirus at similar concentrations, and as effectively, as most previously characterized latency reversing agents⁷. Conversely, we found that forced degradation of TRIM24 with dTRIM24^27,29, a proteolysis-targeting chimeric compound (PROTAC), inhibited HIV-1 provirus expression at concentrations where it caused reduction of TRIM24 protein levels. This latter observation, in combination with our previous results indicating that TRIM24 gene knockout inhibits HIV-1 reactivation²¹ suggests that full inhibition of TRIM24 function, or at least interaction with TFII-I on the LTR, represent potential latency promoting targets. Overall, these observations indicate that TRIM24 is an important potential target for therapeutic modulation of HIV-1 provirus expression.

TRIM24 contributes to both positive and negative effects on gene expression. In RNA-seq analysis of TRIM24 knockout cells we observed differential effects on nearly 2000 genes compared to WT, with approximate equal representation of up and down regulated effects on specific gene expression²¹. Details regarding mechanism for the repressive effect of TRIM24 for specific genes is limited, but was reported to involve inhibition of transcriptional activation by the retinoic acid receptor³⁶ and Smad4³⁷ by effects that appear to involve ubiquitylation of these factors. The observation that IACS-9571 reactivates HIV-1 provirus suggests that, in unstimulated cells, TRIM24 may inhibit one or more factors bound to the 5' LTR to suppress basal expression from the viral promoter. In this view, it is possible that TRIM24 function for repression or activation of HIV-1 expression is altered by T cell signaling mechanisms. TRIM24 is recruited to the LTR by interaction with TFII-I²¹, a protein that functions for both repression and activation of HIV-1 provirus expression^33,19,28. Consequently, it is possible that the divergent effects of factors bound to the conserved RBE1 and RBE3 elements on the LTR may be mediated by differentially regulated functions of TRIM24.

Alternatively, TRIM24 may not have a direct inhibitory effect on transcriptional activation of the HIV-1 LTR, but rather the latency reversing effect of IACS-9571 may be produced by inhibition of its interaction with H3K4me0/H3K23ac modified chromatin on cellular genes. This effect might provide higher levels of TRIM24 available for recruitment to the LTR for stimulation of transcriptional elongation. Consistent with this view we observe enhanced levels of TRIM24 associated with the LTR in cells treated with IACS-9571 (Fig. 7). Furthermore, we find that TRIM24 mutant proteins bearing deletion of the C-terminal region spanning the histone binding motifs, or point mutations within those motifs, do not affect the capability of this factor to stimulate HIV-1 transcription (Fig. 6). These observations incidentally suggest that the histone binding function of TRIM24 is not directly required for its effect on stimulating transcriptional elongation from the HIV-1 LTR. However, overall a more detailed understanding of TRIM24 function will be required to elucidate the mechanism for IACS-9571 as a latency promoting agent.

CD4⁺ T-helper 2 cells lacking TRIM24 display dampened inflammation characterized by reduced expression of many cytokines and chemokines³⁸. Here, we found that unlike most other previously described HIV-1 latency reversing agents, IACS-9571 similarly inhibits expression of genes associated with T cell activation (IL2 and CD69) in CD4⁺ cells from individuals with HIV-1 on ART, and in Jurkat T cells stimulated with PMA. An important consideration for development of latency reversing agents is their effectiveness for reactivation of HIV-1 provirus without causing global T cell activation⁷. Unchecked activation of T cells can produce a response known as cytokine storm, typified by excess production of proinflammatory cytokines which can cause acute respiratory distress syndrome. Consequently, effects of cytokine storm caused by hyperactivation of T cells contributes significantly to pathology of Covid-19 ⁹ and influenza⁴⁰ infections. Our observation that IACS-9571 inhibits expression of genes associated with T cell activation, but causes activation of HIV-1 expression illustrates a unique capability of this novel latency reversing agent. We note that the BET family bromodomain inhibitor JQ1 also acts as an LRA and causes down-regulation of T cell activation genes⁴¹.

Our results indicate that TRIM24 protein has opposing mechanistic effects for regulation of HIV-1 expression from genes regulating T cell response; these differential effects must be mediated by differential requirement for function of the C-terminal bromodomain. A more detailed understanding of the mechanistic significance of histone H3 K23 acetylation will be required to elucidate the precise effect of IACS-9571 on HIV-1 transcription. Nevertheless, considering the unique effects this compound has on HIV-1 provirus and T cell activation we suggest that IACS-9571, and its derivatives, may prove useful for strategies involving latency reversing agents to purge latently infected cells from individuals with HIV-1 on antiretroviral therapy. We found that, although IACS-9571 on its own does not reactivate provirus in cells from participants with HIV-1, it causes synergistic reactivation of viral expression in combination with PEP005 (Fig. 9). Consequently, we suggest this combination of treatment may prove useful for implementation of potential therapies involving reactivation of HIV-1 provirus expression. Accordingly, we note that this compound was previously proposed as a therapy for glioblastomas where TRIM24 is a contributing factor for malignancy⁴², and that PEP005 is already in clinical trials for treatment of skin cancers⁴³.

Cell and virus culture

Jurkat and HEK293T cells were maintained in culture conditions as previously described²⁰. VSV-G pseudotyped viruses were produced by co-transfection of HEK293T cells with viral molecular clone psPAX and pHEF-VSVg as previously described²⁰. Peripheral Blood Mononuclear Cells (PBMC) from participants with HIV-1 on ART were isolated from whole blood by density gradient centrifugation using Lymphoprep™ and SepMate™ tubes (StemCell Technologies), and cryopreserved⁴⁴. Upon thawing, PBMCs were cultured in RPMI 10% FCS. Samples from donor participants were collected with informed consent obtained from all subjects and/or their legal guardian, and handled using methods in accordance with guidelines and protocols approved by the University of British Columbia Clinical Research Ethics Board, certificate H16-02474.

Immunoblotting

Western blotting was performed as previously described⁴⁴. Antibodies were as follows: Tubulin, Abcam ab7291; Flag, Sigma Aldrich F3165; Myc, Santa Cruz sc-40; TRIM24, Proteintech 14208-1-AP; TFII-I, Abcam ab134133; Goat Anti-Rabbit-HRP, Abcam ab6721; Goat Anti-Mouse-HRP, Pierce 1858413.

Chromatin Immunoprecipitation

Jurkat mHIV-Luciferase cells were fixed with 1% formaldehyde (Sigma-Aldrich) for 10 min at room temperature (3x10⁷ cells/IP). 125 mM glycine was added for 5 min to quench cross-linking, and cells were subsequently washed with PBS on ice. Cells were lysed in NP-40 Lysis Buffer (0.5% NP-40, 10 mM Tris-HCl pH = 7.8, 3 mM MgCl₂, 1x PIC, 2.5 mM PMSF) for 15 min on ice. Following sedimentation, nuclei were resuspended in Sonication Buffer (10 mM Tris-HCl pH = 7.8, 10 mM EDTA, 0.5% SDS, 1x PIC, 2.5 mM PMSF) and sonicated using a Covaris S220 Focused-ultrasonicator to produce sheared DNA (2000 − 200 bp). The soluble chromatin fraction was collected and snap frozen in liquid nitrogen. Chromatin concentrations were normalized among samples and pre-cleared with Protein A/G agarose (Millipore, 100 µL/IP). The chromatin samples were split in two and diluted with IP buffer (10 mM Tris-HCl pH = 8.0, 1.0% triton X-100, 0.1% deoxycholate, 0.1% SDS, 90 mM NaCl, 2 mM EDTA, 1x PIC); samples were immunoprecipitated with the indicated specific antibody or control IgG. Antibodies for ChIP were: TRIM24, Proteintech 14208-1-AP; RNAPII, Abcam ab26721; RNAPII pS5, Abcam ab5408; RNAPII pS2, Abcam ab238146; CDK9, Abcam ab239364; Flag, Sigma Aldrich F3165; Mouse IgG, Santa Cruz sc-2025; Rabbit IgG, Abcam ab1722730. The chromatin/ antibody mixtures were incubated 1 hr at 4⁰C with rotation. Pre-washed Protein A/G agarose beads (40 µL/ IP) were then added and the samples were incubated overnight at 4⁰C with rotation. Bead complexes were washed 3x in Low Salt Wash Buffer (20 mM Tris-HCl pH = 8.0, 0.1% SDS, 1.0% Triton X-100, 2 mM EDTA, 150 mM NaCl, 1x PIC) and 1x with High Salt Wash Buffer (same but with 500 mM NaCl). Elution and crosslink reversal was performed by incubating 4 hrs at 65⁰C in elution buffer (100 mM NaHCO₃, 1% SDS) supplemented with RNase A. DNA was purified using the QIAQuick PCR purification kit (QIAGEN) and ChIP DNA was analyzed using the Quant Studio 3 Real-Time PCR system (Applied Biosystems). The percent input value of the IgG sample was subtracted from the specific antibody percent input value of the corresponding sample. Oligos used for ChIP-qPCR were: RBE3, Fwd 5’ AGCCGCCTAGCATTTCATC, Rev 5’ CAGCGGAAAGTCCCTTGTAG; RBE1, Fwd 5’ AGTGGCGAGCCCTCAGAT, Rev 5’ AGAGCTCCCAGGCTCAAATC; Gag, Fwd 5’ AGCAGCCATGCAAATGTTA, Rev 5’ AGAGAACCAAGGGGAAGTGA.

Luciferase reporter assays

Luciferase expression assays from transiently transfected cells were performed as previously described ²¹. Transfection of HEK293T cells were performed in 96-well plates seeded with 2x10⁴ cells per well one day prior to transfection. Cells were co-transfected with 10 ng of pGL3 LTR reporter plasmid and 100 ng expression vector; luciferase activity was measured 24 hours post-transfection. For Jurkat luciferase reporter assays, 96-well plates were seeded with 1x10⁵ cells in 100 µL media, and luciferase activity was measured after the indicated time of treatment. Measurements were performed using Superlight™ luciferase reporter Gene Assay Kit (BioAssay Systems) as per the manufacturer’s instructions, and activity was determined by a VictorTM X3 Multilabel Plate Reader.

Q- RT-PCR

Following the indicated treatment, RNA was extracted from cells using an RNeasy Kit (Qiagen) and subsequently analyzed with the Quant Studio 3 Real-Time PCR system (Applied Biosystems) using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher) as per the manufacturer’s instructions. Primers were as follows: IL2, Fwd 5’ AACTCACCAGGATGCTCACA, Rev 5’ GCACTTCCTCCAGAGGTTTGA; CD69, Fwd 5’ TCTTTGCATCCGGAGAGTGGA, Rev 5’ ATTACAGCACACAGGACAGGA; HIV-1 mRNA, Fwd 5’ CTTAGGCATCTCCTATGGCAGGA, Rev 5’ GGATCTGTCTCTGTCTCTCTCTCCACC

Statistical analyses

Details of statistical analysis are indicated in Figure Legends. Mean is shown with standard deviations. Unpaired sample t-tests were performed using GraphPad Prism 9.0.0, and statistical significance is indicated at *P < 0.05, **P < 0.01, ***P < 0.001, or ****P < 0.0001.

Data Availability

All data pertaining to the findings of this study are available within the article and its Supplementary Information, or are available from the corresponding author, I. Sadowski, ijs,[email protected].

Acknowledgments

We thank Andy Johnson and Justin Wong of the UBC Flow Cytometry Facility for performing FACS analysis as well as for assistance with flow cytometry. We thank the laboratory staff at the BC Centre for Excellence in HIV/AIDS for processing PBMCs from study participants. This research was supported by program project grant F16-01210, from the Canadian Institutes of Health Research (CIHR). PBMC collection from participants with HIV-1 was supported by CIHR project grant PJT-159625 (to ZLB). ZLB is supported by a Michael Smith Health Research BC Scholar Award.

Author Contributions

Brumme Z.L provided PBMCs from participants with HIV-1 on ART. Horvath R. M. performed all other experiments. Horvath R.M. and Sadowski I. wrote the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

1. Beyrer, C. A pandemic anniversary: 40 years of HIV/AIDS. The Lancet 397, 2142–2143 (2021).
Cohn, L. B., Chomont, N. & Deeks, S. G. The Biology of the HIV-1 Latent Reservoir and Implications for Cure Strategies. Cell Host & Microbe 27, 519–530 (2020).
Collora, J. A. & Ho, Y.-C. The loud minority: Transcriptionally active HIV-1-infected cells survive, proliferate, and persist. Cell 185, 227–229 (2022).
Deeks, S. G. et al. Research priorities for an HIV cure: International AIDS Society Global Scientific Strategy 2021. Nat Med 27, 2085–2098 (2021).
Sadowski, I. & Hashemi, F. B. Strategies to eradicate HIV from infected patients: elimination of latent provirus reservoirs. Cell. Mol. Life Sci. (2019) doi:10.1007/s00018-019-03156-8.
Kim, Y., Anderson, J. L. & Lewin, S. R. Getting the “Kill” into “Shock and Kill”: Strategies to Eliminate Latent HIV. Cell Host & Microbe 23, 14–26 (2018).
Hashemi, P. & Sadowski, I. Diversity of small molecule HIV‐1 latency reversing agents identified in low‐ and high‐throughput small molecule screens. Med Res Rev med.21638 (2019) doi:10.1002/med.21638.
Sadowski, I., Lourenco, P. & Malcolm, T. Factors Controlling Chromatin Organization and Nucleosome Positioning for Establishment and Maintenance of HIV Latency. CHR 6, 286–295 (2008).
Pereira, L. A. SURVEY AND SUMMARY A compilation of cellular transcription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Research 28, 663–668 (2000).
Mbonye, U. & Karn, J. The Molecular Basis for Human Immunodeficiency Virus Latency. Annu. Rev. Virol. 4, 261–285 (2017).
Dahabieh, M. S., Ooms, M., Simon, V. & Sadowski, I. A Doubly Fluorescent HIV-1 Reporter Shows that the Majority of Integrated HIV-1 Is Latent Shortly after Infection. Journal of Virology 87, 4716–4727 (2013).
Dahabieh, M. S. et al. Direct non-productive HIV-1 infection in a T-cell line is driven by cellular activation state and NFκB. Retrovirology 11, 17 (2014).
Hashemi, F. B. et al. HIV Provirus Stably Reproduces Parental Latent and Induced Transcription Phenotypes Regardless of the Chromosomal Integration Site. J. Virol. 90, 5302–5314 (2016).
Bernhard, W., Barreto, K., Raithatha, S. & Sadowski, I. An Upstream YY1 Binding Site on the HIV-1 LTR Contributes to Latent Infection. PLoS ONE 8, e77052 (2013).
Mbonye, U. & Karn, J. Transcriptional control of HIV latency: Cellular signaling pathways, epigenetics, happenstance and the hope for a cure. Virology 454–455, 328–339 (2014).
Stadelmayer, B. et al. Integrator complex regulates NELF-mediated RNA polymerase II pause/release and processivity at coding genes. Nat Commun 5, 5531 (2014).
Krasnopolsky, S., Novikov, A., Kuzmina, A. & Taube, R. CRISPRi-mediated depletion of Spt4 and Spt5 reveals a role for DSIF in the control of HIV latency. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1864, 194656 (2021).
Chou, S. et al. HIV-1 Tat recruits transcription elongation factors dispersed along a flexible AFF4 scaffold. Proceedings of the National Academy of Sciences 110, E123–E131 (2013).
Chen, J., Malcolm, T., Estable, M. C., Roeder, R. G. & Sadowski, I. TFII-I Regulates Induction of Chromosomally Integrated Human Immunodeficiency Virus Type 1 Long Terminal Repeat in Cooperation with USF. Journal of Virology 79, 4396–4406 (2005).
Dahabieh, M. S., Ooms, M., Malcolm, T., Simon, V. & Sadowski, I. Identification and functional analysis of a second RBF-2 binding site within the HIV-1 promoter. Virology 418, 57–66 (2011).
Horvath, R., Dahabieh, M., Malcolm, T. & Sadowski, I. TRIM24 controls induction of latent HIV-1 by stimulating transcriptional elongation. https://www.researchsquare.com/article/rs-1357296/v1 (2022) doi:10.21203/rs.3.rs-1357296/v1.
Khetchoumian, K. et al. Loss of Trim24 (Tif1α) gene function confers oncogenic activity to retinoic acid receptor alpha. Nat Genet 39, 1500–1506 (2007).
Tsai, W.-W. et al. TRIM24 links a non-canonical histone signature to breast cancer. Nature 468, 927–932 (2010).
Groner, A. C. et al. TRIM24 Is an Oncogenic Transcriptional Activator in Prostate Cancer. Cancer Cell 29, 846–858 (2016).
Lv, D. et al. TRIM24 is an oncogenic transcriptional co-activator of STAT3 in glioblastoma. Nat Commun 8, 1454 (2017).
Zhan, Y. et al. Development of novel cellular histone-binding and chromatin-displacement assays for bromodomain drug discovery. Epigenetics & Chromatin 8, 37 (2015).
Palmer, W. S. et al. Structure-Guided Design of IACS-9571, a Selective High-Affinity Dual TRIM24-BRPF1 Bromodomain Inhibitor. J. Med. Chem. 59, 1440–1454 (2016).
Malcolm, T., Chen, J., Chang, C. & Sadowski, I. Induction of chromosomally integrated HIV-1 LTR requires RBF-2 (USF/TFII-I) and RAS/MAPK signaling. Virus Genes 35, 215–223 (2007).
Gechijian, L. N. et al. Functional TRIM24 degrader via conjugation of ineffectual bromodomain and VHL ligands. Nat Chem Biol 14, 405–412 (2018).
Zhao, L., Zhao, J., Zhong, K., Tong, A. & Jia, D. Targeted protein degradation: mechanisms, strategies and application. Sig Transduct Target Ther 7, 113 (2022).
Mbonye, U. et al. Cyclin-dependent kinase 7 (CDK7)-mediated phosphorylation of the CDK9 activation loop promotes P-TEFb assembly with Tat and proviral HIV reactivation. J. Biol. Chem. 293, 10009–10025 (2018).
Mbonye, U. R. et al. Phosphorylation of CDK9 at Ser175 Enhances HIV Transcription and Is a Marker of Activated P-TEFb in CD4+ T Lymphocytes. PLoS Pathog 9, e1003338 (2013).
Sadowski, I. & Mitchell, D. A. TFII-I and USF (RBF-2) regulate Ras/MAPK-responsive HIV-1 transcription in T cells. European Journal of Cancer 41, 2528–2536 (2005).
Jiang, G. et al. Synergistic Reactivation of Latent HIV Expression by Ingenol-3-Angelate, PEP005, Targeted NF-kB Signaling in Combination with JQ1 Induced p-TEFb Activation. PLoS Pathog 11, e1005066 (2015).
Thénot, S., Henriquet, C., Rochefort, H. & Cavaillès, V. Differential Interaction of Nuclear Receptors with the Putative Human Transcriptional Coactivator hTIF1. J. Biol. Chem. 272, 12062–12068 (1997).
Tisserand, J. et al. Tripartite Motif 24 (Trim24/Tif1α) Tumor Suppressor Protein Is a Novel Negative Regulator of Interferon (IFN)/Signal Transducers and Activators of Transcription (STAT) Signaling Pathway Acting through Retinoic Acid Receptor α (Rarα) Inhibition. J. Biol. Chem. 286, 33369–33379 (2011).
Agricola, E., Randall, R. A., Gaarenstroom, T., Dupont, S. & Hill, C. S. Recruitment of TIF1γ to Chromatin via Its PHD Finger-Bromodomain Activates Its Ubiquitin Ligase and Transcriptional Repressor Activities. Molecular Cell 43, 85–96 (2011).
Perez-Lloret, J. et al. T-cell–intrinsic Tif1α/Trim24 regulates IL-1R expression on T _H 2 cells and T _H 2 cell-mediated airway allergy. Proc Natl Acad Sci USA 113, E568–E576 (2016).
Jiang, Y. et al. Cytokine storm in COVID-19: from viral infection to immune responses, diagnosis and therapy. Int. J. Biol. Sci. 18, 459–472 (2022).
Gu, Y. et al. The Mechanism behind Influenza Virus Cytokine Storm. Viruses 13, 1362 (2021).
Banerjee, C. et al. BET bromodomain inhibition as a novel strategy for reactivation of HIV-1. Journal of Leukocyte Biology 92, 1147–1154 (2012).
Han, M. & Sun, Y. Pharmacological targeting of Tripartite Motif Containing 24 for the treatment of glioblastoma. J Transl Med 19, 505 (2021).
Collins, A., Savas, J. & Doerfler, L. Nonsurgical Treatments for Nonmelanoma Skin Cancer. Dermatol Clin 37, 435–441 (2019).
Hashemi, P. et al. Compounds producing an effective combinatorial regimen for disruption of HIV‐1 latency. EMBO Mol Med. 10, 160–174 (2018).

No competing interests reported.

SupplementaryMaterial.pdf

Download PDF

Journal Publication

published 11 Jan, 2023

Read the published version in Scientific Reports →

Editorial decision: Major revision
17 Oct, 2022
Reviews received at journal
07 Oct, 2022
Reviewers agreed at journal
03 Oct, 2022
Reviewers invited by journal
03 Oct, 2022
Editor assigned by journal
28 Sep, 2022
Editor invited by journal
28 Sep, 2022
Submission checks completed at journal
28 Sep, 2022
First submitted to journal
20 Sep, 2022

You are reading this latest preprint version

Inhibition of the TRIM24 bromodomain reactivates latent HIV-1

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Materials And Methods

Cell and virus culture

Immunoblotting

Chromatin Immunoprecipitation

Luciferase reporter assays

Statistical analyses

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1