Synergistic inhibitory effect of honey and Lactobacillus plantarum on pathogenic bacteria and their promotion of healing in infected wounds

doi:10.21203/rs.3.rs-2088225/v2

Download PDF

Research Article

Synergistic inhibitory effect of honey and Lactobacillus plantarum on pathogenic bacteria and their promotion of healing in infected wounds

https://doi.org/10.21203/rs.3.rs-2088225/v2

This work is licensed under a CC BY 4.0 License

Version 2

posted

You are reading this latest preprint version

Prevention and control of infections have become a formidable challenge due to the increasing resistance of pathogens to antibiotics. Probiotics have been discovered to have positive effects on the host, and it is well-known that some Lactobacilli are effective in treating and preventing inflammatory and infectious diseases. In this study, we developed an antibacterial formulation consisting of honey and Lactobacillus plantarum (honey-L. plantarum). The optimal formulation of honey (10%) and L. plantarum (1×10⁹ CFU/mL) was used to investigate its antimicrobial effect and mechanism in vitro, and its healing effect on wound healing of whole skin infections in rats. Biofilm crystalline violet staining and fluorescent staining results indicated that the honey-L. plantarum formulation prevented the biofilm formation in Staphylococcus aureus (S. aureus) and Pseudomonas aeruginosa (P. aeruginosa) and increased the number of dead bacteria in the biofilms. Further mechanism studies revealed that the honey-L. plantarum formulation may inhibit biofilm formation by upregulating biofilm-related genes (icaA, icaR, sigB, sarA, and agrA) and downregulating quorum sensing (QS) associated genes (lasI, lasR, rhlI, rhlR, and pqsR). The growth curve implied that L. plantarum may have used honey to produce active antibacterial substances. Furthermore, the honey-L. plantarum formulation decreased the number of bacteria in the infected wounds of rats and accelerated the formation of new connective tissue to promote wound healing. Our study suggests that the honey-L. plantarum formulation provides a promising option for the treatment of pathogenic infections and wound healing.

Honey

Lactobacillus plantarum

Pathogenic bacteria

Antibacterial

Wound infection

Bacterial infectious diseases pose a major threat to human health as they cause a significant burden of morbidity and mortality worldwide. Among common infectious diseases, S. aureus and P. aeruginosa are the most common causative organisms detected in chronic wounds(Serra et al. 2015). Usually, S. aureus is located on the surface of the infection and P. aeruginosa is located deeper in the infection (Fazli et al. 2009). Because these bacteria have a high level of antibiotic resistance, treating wound infections can be difficult. Additionally, both bacteria produce biofilms, have high resistance to many antimicrobial medications (Khan and Ahmad 2012; Wolcott and Rhoads 2008), and are the leading causes of most chronic infections (Lewis 2001). Pharmacological treatment for chronic wound infections involves the systemic administration of antibiotics. Still, the development of drug resistance has made more and more antibiotics lose their effectiveness of anti-infection. Various coping strategies have been investigated, particularly drug designs based on synthetic analogs that can inhibit virulence factors. However, these studies have not yielded promising results due to toxicity and low bioavailability. There remains a need to develop alternative therapies to manage wound bacterial infections effectively.

Lactic acid bacteria, a group of bacteria that use carbohydrates to produce lactic acid, have been used for thousands of years to ferment and preserve food (Niaz et al. 2019). They naturally control the microbial composition of many foods because these lactic acid bacteria have antagonistic and inhibitory properties by competing for nutrients or producing active antimicrobial metabolites such as organic acids, hydrogen peroxide, acetylacetone, diacetyl, and bacteriocins(Furtado et al. 2019). Lactobacilli can reduce the risk of infectious diseases, fight secondary infections with antibiotics(King et al. 2014), and reduce antibiotic therapy's incidence and severity of diarrhea (Hempel et al. 2012). In addition, most lactobacilli are generally considered safe by the US Food and Drug Administration(Fusieger et al. 2020). L. plantarum is one of the typical representatives of lactic acid bacteria, and topical application of L. plantarum has been demonstrated to reduce or eliminate the pathogenic bacterial load, reduce necrotic tissue, accelerate the appearance of granulation tissue, reduce wound area, and promote wound healing(Peral et al. 2010). And topical administration of L. plantarum accelerated the healing of chronic diabetic foot ulcers and infected burn wounds by altering infection, angiogenesis, macrophage phenotype, and neutrophil response(Argañaraz Aybar et al. 2022; Moraffah et al. 2022). It was also found that L. plantarum supernatant has protective effects against bacterial infection, oxidative stress, and wound healing (Dubey et al. 2021; Ong et al. 2020). According to the studies mentioned above, probiotics and their metabolites may be able to treat bacteria that are resistant to antibiotics. To combat the significant worldwide danger posed by antimicrobial resistance, future research on creating combinations of probiotics and their metabolites are promising alternatives to antibiotics to treat drug-resistant bacteria.

For many years, honey has been used as a folk medicine to treat wound infections. Honey's healing and antimicrobial activity are partly attributed to its hygroscopic properties, high osmotic pressure, low pH, and hydrogen peroxide content (Alvarez-Suarez et al. 2014; El-Kased et al. 2017; Gulfraz et al. 2011). A Lactobacillus (LAB) symbiotic community of nine Lactobacillus species and four Bifidobacterium species had been discovered in honey bee crops. Interestingly, these Lactobacillus symbionts have a role in the honey formation and are abundant in fresh honey. In addition, it was shown that these symbionts create a variety of extracellular proteins, including enzymes, bacteriocins, and lysozyme, as well as anti-microbial compounds such as formic acid, hydrogen peroxide, and free fatty acids (Butler et al. 2013; Vasquez et al. 2012). Lactobacillus symbiosis is involved in honey production and plays a vital role in the antimicrobial action of honey by producing numerous antimicrobial metabolites and peptides.

Research has been done on the mechanisms of probiotic antibacterial action, although these studies have mostly looked at probiotic metabolites and their related active substances, like bacteriocins(Furtado et al. 2019). Probiotics can produce metabolites and potent antibacterial capabilities, but little study has been done on how they interact with other agents to impact how they inhibit pathogenic bacteria. Although previous studies have reported the combined antibacterial effect of L. plantarum and honey, these studies only focused on single pathogenic bacteria and did not explore the synergistic effect of honey and L. plantarum in more depth and comprehensively (Mežnarić et al. 2022). Therefore, in the present study, our main objective was to determine the inhibitory and antibacterial mechanisms of honey and L. plantarum against different species of pathogenic bacteria and their healing effect on infected wounds.

In this study, it was discovered that honey and L. plantarum had a synergistic inhibitory effect against S. aureus. Based on the inhibitory activity of S. aureus, we determined the optimal antibacterial formulation of honey and L. plantarum (honey-L. plantarum), and it was therefore selected for further detailed testing. It was found that honey-L. plantarum formulation showed good antibacterial activity against S. aureus, P. aeruginosa and Escherichia coli (E. coli). The biofilm crystalline violet staining and fluorescent staining indicated that the honey-L. plantarum formulation prevented the biofilm formation in Staphylococcus aureus (S. aureus) and Pseudomonas aeruginosa (P. aeruginosa) and increased the number of dead bacteria in the biofilms. In addition, the honey-L. plantarum formulation achieved promoting healing of the infected wounds in rats.

Bacterial strains

L. plantarum purchased from the China General Microbial Strain Collection Management Center (CGMCC 1.12974) was seeded in De Man, Rogosa, and Sharpe (MRS) broth and incubated for 24 h at 37°C in facultative anaerobic conditions. The bacterial culture was centrifuged at 10000 × g for 5 min at four °C, and the pellet was washed three times and re-suspended with PBS buffer at pH 7.2 before use. P. aeruginosa strain PAO1, S. aureus, and E. coli isolated from clinical specimens of Chongqing Sixth People's Hospital were selected as indicator strains and grown in Luria–Bertani (LB) broth overnight at 37°C with 200 rpm before use.

Optimal antibacterial formulation of honey and L. plantarum

A multilevel experimental design was used to optimize the honey-L. plantarum formulation. In brief, honey content (X₁) and L. plantarum concentration (X₂₎ were set as two independent variables and three levels of each variable according to the results of the preliminary pre-experiment (Table 1). When different ratios of honey and L. plantarum acted together with S. aureus (1×10⁸ CFU/mL) for 12 h, the viable count of S. aureus (Y) was set as the dependent variable. Experimental trials were performed under all nine possible combinations, with three replicate experiments done simultaneously for each combination. Additionally, a blank control (containing only S. aureus, without honey and L. plantarum) was set. The results were analyzed by SPSS statistics to select the best antibacterial formulation for honey and L. plantarum.

Table 1

3×3 factorial design levels and factors
Factors	Level 1	Level 2	Level 3
X1(Honey ratio, %, v/v)	10	20	30
X2 (L. plantarum, CFU/mL)	10⁷	10⁸	10⁹

In vitro antibacterial activity of honey-L. plantarum formulation

The vitro antibacterial activity of honey-L. plantarum formulation against S. aureus, P. aeruginosa and E. coli was evaluated. In brief, the honey-L. plantarum group (HL, pathogens + honey + L. plantarum), negative control (C, Pathogens), L. plantarum control (L, pathogens + L. plantarum), and honey control (H, pathogens + honey) were configured separately. Specifically, cells from overnight cultures were diluted in LB broth to achieve 1×10⁸ CFU/mL. Diluted cultures with honey-L. plantarum formulation selected from the previous step was added (1 mL/well) into 24-well microplates and incubated at 37°C. To obtain these viable culturable indicator cells, samples were collected at 6 h, 12 h, 18 h, and 24 h after incubation and diluted to a suitable concentration with PBS before being seeded on the LB agar plate. The CFU of bacteria on the LB agar plate was counted after being incubated for 24 h at 37°C.

Biofilm formation inhibition assay

The antibiofilm potential of honey-L. plantarum formulation was assayed using 24 well microtiter plates as described in a previous study with minor modifications(Vijayakumar et al. 2020). Briefly, honey-L. plantarum formulation was mixed with S. aureus (5×10⁵ CFU/mL) or P. aeruginosa (5×10⁵ CFU/mL) in LB broth containing 0.1% glucose (HL). In addition, PBS, L. plantarum and honey added with the bacterial culture were used as negative control (S/P), L. plantarum control (L) and honey control(H), respectively. Each bacterial solution was added to a 24-well microplate and incubated at 37°C for 24 h. After incubation, the wells were rinsed twice with PBS to remove planktonic and non-adhering cells. The surface-bound cells were stained with 1 ml of 0.1% crystal violet (CV) solution for 10 min, followed by washing with PBS and destaining with 30% glacial acetic acid. The biofilm biomass was quantified by measuring the intensity of dissolved CV using a spectrophotometer at OD 595 nm by the Enzyme Markers (Thermo Scientific).

Live/dead bacterial staining

The effects of honey-L. plantarum formulation on biofilms of S. aureus and P. aeruginosa were stained with the SYTO9/PI Live/Dead Bacterial Double Stain Kit (MK Bio, China). Biofilms were cultured on glass coverslips placed in a 24-well microplate with honey-L. plantarum formulation. After incubation at 37°C for 24 h, the biofilm specimens were gently washed twice with PBS to remove planktonic cells. The biofilm was stained for 15 min with the staining solution, which contained 3 µL of mixed staining solution (1.62 mM SYTO9 and 10 mM PI) in 1000 µL of 0.9% NaCl solution treated in the dark at room temperature for 15 min. Finally, the coverslips were gently fixed on the clean glass slides and observed under a fluorescence microscope (Olympus, Japan). Live bacteria were stained green and dead bacteria were stained red.

Quantitative Real‑Time PCR analysis

The overnight culture of S. aureus and P. aeruginosa were treated without (S/P) or with L. plantarum (L), honey (H) and honey-L. plantarum formulation (HL) at 37 ◦C for 24 h, and the cells were collected by washing three times with sterile PBS. Then, the total RNA was extracted using the Simply P Total RNA Extraction Kit (BioFIux, China) according to the manufacturer’s protocol. Then, RNAs were converted to cDNA using PrimeScript™ RT (Takara, Japan). The LightCycler® System (Thermo Scientific) was used to analyze the expression of biofilm-related genes for S. aureus (icaA, icaR, sigB, sarA, and agrA) and P. aeruginosa (lasI, lasR, rhlI, rhlR, and pqsR) for P. aeruginosa involved in QS mechanism and biofilm formation. PCR reaction was performed at a predefined ratio using PCR Master Mix (SYBR Green kit, Takara, Japan). The qRT-PCR primers were displayed in Table 2, and the rpoB (S. aureus) and GAPDH (P. aeruginosa) were internal reference genes, as described earlier (Shi et al. 2019; Wang et al. 2021). The relative expression levels were calculated by the relative quantitative (2^−ΔΔCt) method(Kot et al. 2018).

Table 2

Gene-specific primers used in this study
Gene	Forward primer	Reverse primer
rpoB	CAGCTGACGAAGAAGATAGCTATGT	ACTTCATCATCCATGAAACGACCAT
icaA	CTGGCGCAGTCAATACTATTTCGGGTGTCT	GACCTCCCAATGTTTCTGGAACCAACTCC
icaR	TGCTTTCAAATACCAACTTTCAAGA	ACGTTCAATTATCTAATACGCCTGA
sigB	AAGTGATTCGTAAGGACGTCT	TCGATAACTATAACCAAAGCCT
agrA	TGATAATCCTTATGAGGTGCTT	CACTGTGACTCGTAACGAAAA
sarA	CAAACAACCACAAGTTGTTAAAGC	TGTTTGCTTCAGTGATTCGTTT
lasI	CGATACCACTGGCCCCTACA	GGCTGAGTTCCCAGATGTGC
lasR	AGGAAGTGTTGCAGTGGTGC	GGAGGTCACACCGAACTTCC
rhlI	GTCTCGCCCTTGACCTTCTG	ATTCTGGTCCAGCCTGCAAT
rhlR	CGGGTGAAGGGAATCGTGTG	ACGGTTTGCGTAGCGAGATG
pqsR	CTGCTCACCGTATCGCAGAA	CGCCTGATCCCTTACATGCG
GAPDH	CACTCCAGCCGTTTCGAACT	CGGCTTGAACACCACCGTAT

Changes in the growth of L. plantarum in the formulation

In this part, changes in the growth of L. plantarum were evaluated to understand the antimicrobial mechanism of the formulation. The honey-L. plantarum group (HL) and L. plantarum group (L) from step “Inhibition of S. aureus, P. aeruginosa and E. coli by honey-L. plantarum formulation” were incubated for 24h. Then the bacterial solution was diluted with PBS. Next, the diluted solution was coated with MRS agar plates, and the number of L. plantarum was counted after incubation at 37°C for 24 h. On the other hand, 1×10⁹ CFU/mL L. plantarum (L) and 10% honey-L. plantarum (HL) was added to the LB broth medium, and the growth of L. plantarum in it was detected with a Bioscreen Automated Microbial Growth Analyzer (Bioscreen C, Oy Growth Curves AB, Helsinki, Finland).

Antibacterial effect of honey-L. plantarum culture supernatant

To further investigate the antibacterial effect of honey-L. plantarum formulation, we tested the growth inhibition of S. aureus and P. aeruginosa by the cell-free supernatant (CFS) of honey-L. plantarum cultures and the effect of honey-L. plantarum on the pH value of the medium. Firstly, 10% honey and 1×10⁷ CFU/mL L. plantarum were incubated in an MRS medium at 37°C for 24 h. Then the cultures were centrifuged (at 10000 ×g, for 5 min at 4°C) to extract the supernatant, and the pH of the medium was tested with a Mettler Toledo pH Mete. After filtering the supernatant through a 0.22-µm sterile membrane, it was (10% − 20%, v/v) added to LB containing 1×10⁷ CFU/mL of S. aureus or P. aeruginosa and mixed well (HL). Meanwhile, cultured in LB broth, S. aureus or P. aeruginosa were also set as negative controls (C). Finally, the effect of the supernatant on the growth curves of the two bacteria was incubated and measured at 37°C for 24 h with a Bioscreen Automated Microbial Growth Analyzer.

In vivo animal experiment

Wound infection model

Eight-week-old male Sprague-Dawley (SD) rats weighing 200 ± 20 g were bought from the Chongqing Medical University’s Animal Experiment Center. Rats were housed singly under standard conditions with food and water ad libitum. The experimental animal handling methods conformed to animal ethics standards and were approved by the Experimental Animal Ethics Committee of Chongqing Medical University.

Twelve adult male Sprague-Dawley rats were randomly divided into two groups, six in each group: the control group (S. a) and the treated group (HL). After one week of adaptation, the experiment followed previously reported methods with modifications(Haidari et al. 2021; Khezri et al. 2019). After being anesthetized with 10% chloral hydrate (300 mg/kg), the back of each rat was shaved, depilated, and washed with 75% ethanol (Liu et al. 2020a; Yan et al. Following that, a circular wound with a diameter of 10 mm was created on the back of each rat, which was subsequently infected with 30 µL S. aureus (1 × 10⁸ CFU / mL). Blank control (PBS) and honey-L. plantarum (HL) was applied to the wounds of the control group (SA) and the treated group (HL) of rats separately after an hour of drying. Afterward, the wounds were covered with commercially available transparent film dressings and secured with medical tape. On the 0, first, third, and fifth days, the formulation was changed once a day, and the wound healing was photographed. The rats were euthanized after five days.

Evaluation of the antibacterial effect of honey- L. plantarum formulation on the wounds

The rats were euthanized on the 1st and 5th days after treatment to assess the formulation's antibacterial effect. The skin tissue along the wound edge was collected and homogenized in 1 ml of PBS with a homogenizer. From that, the sample solution was diluted to the optimal concentration, and 100 µL of the diluted solution was placed on the Baird-Parker agar plate. The number of colonies on the Baird-Parker agar plates was counted after 24 h incubation at 37°C.

Histological analysis

For histological examination, excised wound skin tissue on days 1, 3 and 5 was fixed in 4% paraformaldehyde for at least 24 h, dehydrated in a graded series of ethanol, followed by xylene, and embedded in paraffin. Tissue sections were obtained from the center of the excised skin tissue and cut into 5 µm thick sections. Skin sections were stained with hematoxylin and eosin (H&E) to assess granulation tissue formation and wound maturity. Images were acquired using an inverted light microscope (Olympus, Japan).

Statistical analysis

All Data were analyzed and graphed using SPSS Statistics 25 (Armonk, NY, US) and Graph Pad Prism 7 software (GraphPad Software, Inc, La Jolla, CA, USA), with quantitative results expressed as mean ± standard error (SEM). Statistical comparisons were performed using a t-test and one-way ANOVA, followed by Tukey’s Multiple Comparison test as the post-hoc test. A significant difference is marked as * (p < 0.05), ** (p < 0.01), *** (p < 0.001) and **** (p < 0.0001).

Optimal antibacterial formulation of L. plantarum and honey to inhibit S. aureus

Previous experimental results suggest that there may be a synergistic antibacterial effect of L. plantarum and honey on S. aureus. To find the optimal antibacterial formulation of L. plantarum and honey, a two-factor, three-level analysis factor design experimental protocol was designed to determine the optimal concentration of L. plantarum and honey against S. aureus. As represented in Table 3, analysis of variance, the main effects (H and L) show the inhibition of S. aureus by different concentrations of honey and L. plantarum. In contrast, the interaction term (X₁₂) shows how the response changed when the concentrations of honey and L. plantarum were varied simultaneously. The result showed that there was an interaction between honey (H) and L. plantarum (L) (interaction term: H × L, p < 0.0001). Therefore, the antibacterial effect of honey and L. plantarum against pathogenic bacteria is mainly considered by the interaction between the two. Table 4 demonstrates that when the honey concentration in the formulation was 10% and the L. plantarum concentration was 1 × 10⁹ CFU/mL, S. aureus growth was the least (had the maximum inhibition rate), indicating that this formula has the best effect on suppressing the growth of S. aureus.

Table 3

ANOVA table for the studied honey(H) and *L. plantarum*(L)
Source of variation	Degrees of freedom	Sum of squares	Mean square	F-value	p-value
Model	8	48.052	6.007	5115.985	< 0.001
H (X₁)	2	32.202	16.101	13713.656	< 0.001
L (X₂)	2	5.095	2.548	2169.997	< 0.001
H×L (X₁₂)	4	10.755	2.689	2290.144	< 0.001
Residual	18	0.021	0.001
Cor Total	26	48.073

Table 4

Honey and *L. plantarum* formulations and their antimicrobial activity
Formulations	Honey (%)	L. plantarum (CFU/mL)	S. aureus (Log₁₀CFU/mL)	Inhibition (%)
F0	0	0	9.60 ± 0.04	-
F1	10	10⁷	9.39 ± 0.01	2.20 ± 0.09
F2	10	10⁸	8.54 ± 0.04	11.04 ± 0.37
F3	10	10⁹	4.32 ± 0.12	55.05 ± 1.23
F4	20	10⁷	9.08 ± 0.02	5.40 ± 0.16
F5	20	10⁸	8.64 ± 0.03	10.01 ± 0.32
F6	20	10⁹	6.70 ± 0.10	30.26 ± 0.1.06
F7	30	10⁷	9.16 ± 0.01	4.62 ± 0.13
F8	30	10⁸	8.81 ± 0.02	8.25 ± 0.25
F9	30	10⁹	7.95 ± 0.05	17.23 ± 0.50

Honey-L. plantarum formulation inhibited the growth of S. aureus, P. aeruginosa, and E. coli

Based on the most effective combination of L. plantarum and honey chosen by its antibacterial activity against S. aureus, we tested the formulation's ability to inhibit the growth of S. aureus, P. aeruginosa, and E. coli from understanding better the antibacterial activity of this formulation against pathogenic bacteria. The results are depicted in Fig. 1a, b and c, where the honey-L. plantarum formulation can be seen after 12 h of interaction significantly inhibited the growth of these three bacteria. And of these bacteria, honey alone inhibited only S. aureus, with no effect on P. aeruginosa and E. coli. This again suggests that honey and L. plantarum have a synergistic antibacterial effect. Moreover, this antibacterial effect became stronger when the honey-L. plantarum formulation acted on these pathogenic bacteria longer. When the duration of action reached 24 h, the growth inhibition of S. aureus, P. aeruginosa, and E. coli by honey-L. plantarum formulation could reach more than 80% (Fig. 1d).

Honey-L. plantarum formulation inhibited the biofilm formation of S. aureus and P. aeruginosa

To investigate whether the honey-L. plantarum formulation affects the biofilm formation of pathogenic bacteria, and we measured the biofilm expression of S. aureus and P. aeruginosa. As shown in Fig. 2, L. plantarum alone did not inhibit the biofilm formation of S. aureus. In contrast, honey and L. plantarum alone can inhibit the biofilm formation of P. aeruginosa, respectively. However, when honey and L. plantarum were combined, the inhibitory effect on biofilm formation was much better(p < 0.01). After the honey-L. plantarum formulation was added to the culture system for 24 h, the biofilm formation of S. aureus and P. aeruginosa were inhibited to 70% and 80%, respectively (Fig. 2c). It indicates that honey and L. plantarum have a synergistic inhibitory effect on bacterial biofilm formation, which consistent with the previous results that these two components synergistically inhibit the growth of these bacteria.

A fluorescence microscope was applied to visualize the live and dead cells of the biofilms of S. aureus and P. aeruginosa. As shown in Fig. 3, the living cells were labeled with STYO9 (green fluorescence), whereas dead cells were stained with propidium iodide (red fluorescence). In the absence of honey-L. plantarum formulation, the living cells appeared to be relatively intensive, and only a few dead cells could be observed in S. aureus and P. aeruginosa biofilms (C). Moreover, when L. plantarum treatment alone, the activity of biofilm cells did not change, which could be observed by the increase of living cells and the few dead cells (L). However, many dead cells appeared in the field of vision when the biofilms were treated with honey alone (H) and honey-L. plantarum formulation (HL).

Honey-L. plantarum formulation increased the transcription level of icaA, icaR, sigB, sarA and agrA and decreased the transcription level of lasI, lasR, rhlI, rhlR, and pqsR

To evaluate the effect of honey-L. plantarum formulation on S. aureus and P. aeruginosa at the molecular level, candidate genes expression analysis (involved in biofilm formation and virulence production) was performed by real-time PCR. In contrast to the controls of untreated (S) and L. plantarum treated (L), Fig. 4 shows that the honey-L. plantarum formulation treatment upregulated the expression level of biofilm regulation-related genes (icaA, icaR, sarA, agrA, and sigB) for S. aureus (p < 0.05). However, after honey treatment (H) and honey-L. plantarum formulation treatment (HL), relative expression of the five critical QS-regulated genes (lasI, lasR, rhlI, rhlR, and pqsR) for P. aeruginosa were down-regulated (Fig. 5).

The synergistic antibacterial activity of honey-L. plantarum formulation may depend on the honey promotion growth of L. plantarum

To evaluate whether the synergistic antibacterial activity of honey-L. plantarum originates from the fact that honey has a promotive effect on the growth activity of L. plantarum. Thus, we first tested if the honey can promote the growth of L. plantarum and assayed the changes in the number of viable L. plantarum bacteria in the above antibacterial activity test. It showed that (Fig. 6a) when there was no honey in the system (L) during the trial of the formulation's inhibitory effect against S. aureus, the viable count of L. plantarum reduced by roughly 2% from the original level (L0). In contrast, the number increased by about 2% when honey was added to the cultures (HL), which showed that adding honey stimulated the growth of L. plantarum during the incubation. Then, the growth curves of L. plantarum alone and with honey in LB were further evaluated to investigate the growth-promoting effect of honey on L. plantarum. The experimental results showed that L. plantarum did not grow in the LB broth alone but grew and multiplied when co-cultured with honey (Fig. 6b).

To find out if the metabolites of L. plantarum were antimicrobial. We also analyzed the honey-L. plantarum culture supernatant's ability to inhibit S. aureus and P. aeruginosa growth, and we assessed the acid generation of L. plantarum. The results showed that honey-L. plantarum culture supernatant has an apparent inhibitory effect on S. aureus and P. aeruginosa. By measuring the growth curves of the two bacteria, as shown in Fig. 6c, we found 10% of honey-L. plantarum culture supernatant could significantly inhibit the growth of S. aureus and P. aeruginosa, and when the supernatant content reached 20%, it could completely inhibit the growth of both bacteria. Furthermore, we discovered that L. plantarum thrived in MRS medium for 24 h with a significant pH reduction in the medium, even if the pH reduction in the medium did not change noticeably when honey was present from that of L. plantarum alone (Fig. 6d).

Honey-L. plantarum formulation promoted wound healing in rats with infections

Infection of the wound by pathogenic bacteria can worsen the wound and slow its healing. For the viable count in the tissue around the wound (Fig. 7a), after 5 days of continuous application of honey-L. plantarum formulation to the infected wound, the bacterial count in the honey-L. plantarum formulation group (HL) was about 0.7 log units less than that in the infected control group (SA). Moreover, the wound re-epithelialization and tissue granulation formation were assessed by H-E staining further to evaluate the wound healing effect of the honey-L. plantarum formulation. As shown in Fig. 7b, c, many inflammatory cells were visible in the tissues of both the control and the treated groups on day 1 after treatment. On the third day after treatment, a complete crust was formed on the wound surface in the treated group, with active growth of new connective tissue under the crust and less inflammatory exudation. In contrast, the control group's inflammatory exudate and inflammatory damage were broader and more profound. On the fifth day, the new connective tissue in the treated group was quite active, and the wound had significantly decreased, meaning the wound was essentially healed. Though the wounds were covered in the control group, it wasn’t easy to see the new connective tissue.

Probiotic-derived biologics, such as organic acids, antimicrobial peptides, extracellular polysaccharides, and biosurfactants, have antibacterial and antibiotic film potential against many pathogens, such as S. aureus, P. aeruginosa, and Salmonella enterica (Fredua-Agyeman and Gaisford 2019; Mariam et al. 2014; Squarzanti et al. 2022). Moreover, honey has antibacterial and anti-biofilm activity against S. aureus and P. aeruginosa (Alandejani et al. 2009; Danilova et al. 2019). So, this study tried to enlighten the synergistic effect of L. plantarum and honey on pathogenic bacteria and the healing impact on infected wounds. Honey is considered a potential prebiotic due to its richness in oligosaccharides, and it has been shown that honey oligosaccharides can promote the growth of Lactobacillus and Bifidobacterium. In the present study, L. plantarum alone affected the growth of S. aureus, P. aeruginosa, and E. coli. Still, the combination of honey and L. plantarum significantly hurt pathogenic bacteria's reproduction and biofilm formation.

Probiotics not only inhibit the activity of pathogenic bacteria and their adhesion to surfaces, but they also prevent the formation and survival of pathogenic biofilms, interfere with biofilm integrity, and eventually lead to biofilm eradication (Barzegari et al. 2020). It has been shown that L. plantarum can inhibit the formation of pathogenic bacterial biofilms on catheters when applied to catheters (Mekky et al. 2022). To verify the effects of honey-L. plantarum formulation in inhibiting biofilm formation, both absorbance measurements and microscopic observations were performed. The crystal violet staining results showed that honey-L. plantarum formulation inhibited S. aureus and P. aeruginosa biofilm formation, and mature biofilms were also destroyed (Fig. 2a, b). This was also confirmed in the fluorescence microscopic, where we found that honey-L. plantarum formulation effectively decreased the number of viable cells, increased the dead cell counts, and destroyed the dense and complete structure of the biofilm. Similarly, a recent study defined that metabolites of L. plantarum inhibited the Bacillus licheniformis biofilm development by reducing live/dead cell counts, metabolic activity, and EPS content of biofilm adhered on stainless steel and glass surfaces(Wang et al. 2019)

Biofilm formation is an important factor affecting bacteria drug resistance. Studies have found that the expression of icr, sarA, and agr genes can regulate the secretion of virulence factors and the formation of biofilms in S. aureus. The biofilm distribution of S. aureus is mainly controlled by the agr genes, which can enhance biofilm dispersion and inhibit biofilm formation when strongly expressed. In the present study, the biofilm formation of S. aureus was significantly reduced and biofilm-related genes (icrR, icrA, sarA and agrA) expression was upregulated after honey-L. plantarum formulation treatment. Noteworthy, our experiment showed an upregulation of transcription factor sigB gene expression (Fig. 4e), which is in contrast to the current findings, even though the majority of research indicates that downregulation of the sigB can limit biofilm formation(Wang et al. 2021). We speculate that the interaction of honey with L. plantarum may have increased the abnormal expression of this gene, and the exact mechanism needs to be further explored and studied.

Additionally, a mechanism that enables microbial communication is called quorum sensing (QS). The primary function of QS is the regulation of critical cellular functions like the production of virulence factors or the formation of biofilms (Paluch et al. 2020). There are many ways to inhibit the QS system, and the critical QS-related genes include lasI, lasR, rhlI, rhlR, and pqsR. In this study, we examined the relationship between the expression of QS-related genes and the formation of biofilms. The expression of lasI, lasR, rhlI, rhlR, and pqsR considerably decreased after treatment with honey-L. plantarum formulation was consistent with the earlier finding(Hnamte et al. 2019; Shi et al. 2019). Moreover, we discovered that although L. plantarum alone affected the expression of specific genes, including the up-regulated LasI gene (Fig. 5b) and down-regulated rhlR gene (Fig. 5c), the expression levels of these genes were all decreased when L. plantarum interacted with honey, which was in accordance with our expectations and crystalline violet staining experiments. Furthermore, there was no observable difference in gene expression levels between samples treated with honey alone (H) and those treated with honey-L. plantarum formulation (HL). This is likely because the interaction between L. plantarum and honey did not lead to the expected reduction in gene expression levels. After treatment with the honey-L. plantarum formulation, it's likely that the expression levels of these genes in P. aeruginosa biofilms decreased. Since this has crucial scientific significance for exploring the specific mechanisms by which honey-L. plantarum formulation inhibited the formation of biofilms, more experimental confirmation is required.

It was found that the primary mechanism of probiotic bacteria to inhibit pathogens through the production of some substances such as organic acids, hydrogen peroxide, low molecular weight antimicrobial substances, and bacteriocins (Pancheniak and Soccol 2005). L. plantarum had strong metabolic activity and significantly inhibited the growth of pathogenic bacteria during co-cultivation with Salmonella typhimurium. The mechanism of action may be related to the lowering of the pH value of the medium by L. plantarum(Fonseca et al. 2021). In this investigation, honey served as a good carbon source for the growth and reproduction of L. plantarum (Fig. 4a, b). The greater quantity of L. plantarum increases the possibility of co-aggregation, which allows bacteria to aggregate and produce essential metabolic products like organic acids, lowering the pH of the medium to more effectively exert its antibacterial effect (Fig. 4e).

Furthermore, probiotics have an active role in preventing and healing infected wounds (Argenta et al. 2016). They interfere with the wound healing process by affecting collagen synthesis, amplifying the expression of tight junction proteins, enhancing the migration of keratin-forming cells, and stimulating proliferation. On the other hand, honey cannot only treat bacterial infections but also work as a good wound dressing because of its antibacterial qualities brought on by the creation of hydrogen peroxide by the enzyme glucose oxidase in honey. Thus, we chose honey as one of the media in our antimicrobial formulation to assist L. plantarum in healing infected wounds. Our results confirmed the effective part of honey-L. plantarum in infected wounds in rats. Moreover, L. plantarum grew and multiplied in large numbers with the assistance of honey (Fig. 6b), which may reduce the risk of pathogen adhesion to wound cells or the replacement of pathogens.

Local wound infections can significantly affect healing because bacteria prolong the inflammation and interfere with epithelial formation, contraction, and collagen deposition(Robson 1997). During the inflammatory phase of wound healing, neutrophils and macrophages enter the wound site to release and secrete large amounts of enzymes and cytokines to remove and digest invading bacteria and cellular debris to prevent infection(Broughton et al. 2006). In the group treated with the honey-L. plantarum formulation, the number of bacteria in the wound tissue was significantly reduced. And in the pre-healing phase, inflammatory cells increased dramatically, indicating that the honey-L. plantarum formulation could regulate the number of inflammatory cells in the wound area and reduce the negative effect of wound infection on healing. Skin tissue repair aims to restore the barrier function of the skin, for which granulation tissue is required to replace the defect to form new connective tissue and epithelial wound closure is necessary to restore the physical barrier(Werner et al. 2007). In our histological results, scar remodeling at the neoplastic epithelium was achieved by significant accumulation and thickening of granulation tissue after epithelial wound closure, starting from an early phase dominated by inflammation. The healing process in the honey-L. plantarum formula treatment group followed the mentioned pattern. These results indicate that the honey-L. plantarum formulation effectively promoted wound healing in infected rats, confirming its positive role in treating infected wounds.

In conclusion, in our study, the honey-L. plantarum formulation was used to investigate its antibacterial effect and mechanism against pathogenic bacteria and applied to a rat wound infection model. The formulation exhibited effective antibacterial activity in vivo and in vitro, and qRT-PCR results suggested that the honey-L. plantarum formulation may inhibit biofilm formation by regulating some genes related to biofilm formation. Importantly, this formulation could not only control pathogenic bacterial infections but also promote wound healing, playing a potential role in treating clinically relevant bacterial infections. Therefore, this study will provide a new practical reference for the clinical treatment of pathogenic bacterial infections, promotion of wound healing, and changes in the management of pathogenic bacteria.

Acknowledgments We are grateful to researcher Qi Yin (Chongqing medical university, China) for providing Pseudomonas aeruginosa and Chongqing Sixth People's Hospital for providing Staphylococcus aureus and Escherichia coli.

Author Contributions All authors contributed to the study’s conception and design. Material preparation, data collection and analysis were performed by Mei Li, Yong Tang, Yongmei Su, Yan Jia, Qi Yin, Yingli Li, Danlin Cheng, Jieying Gao, Hong Xiao and Qunhua Bai. The first draft of the manuscript was written by Mei Li, Hong Xiao and Qunhua Bai, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding This work was founded by the Chongqing Yuzhong Nature Science Foundation (Grant Number 20190146), Scientific Research and Innovation Experiment Program for College Students of Chongqing Medical University (Grant Number SRIEP202120) and Chongqing Natural Science Foundation (Grant Number 2020ZY0236) of China.

Data Availability The data supporting this study's findings are available from the corresponding author upon reasonable request.

Ethics Approval The animal study protocol was approved by the Experimental Animal Ethics Committee of Chongqing Medical University, Chongqing, China.

Conflicts of Interest The authors declare no conflict of interest

Consent for Publication All authors consent to the publication of this article.

Alandejani T, Marsan J, Ferris W, Slinger R, Chan F (2009) Effectiveness of honey on Staphylococcus aureus and Pseudomonas aeruginosa biofilms. Otolaryngology--head and Neck Surgery : Official Journal of American Academy of Otolaryngology-Head and Neck Surgery 141:114-118. https://doi.org/10.1016/j.otohns.2009.01.005.
Alvarez-Suarez JM, Gasparrini M, Forbes-Hernández TY, Mazzoni L, Giampieri F (2014) The Composition and Biological Activity of Honey: A Focus on Manuka Honey. Foods (Basel, Switzerland) 3:420-432. https://doi.org/10.3390/foods3030420.
Argañaraz Aybar JN, Ortiz Mayor S, Olea L, Garcia JJ, Nisoria S, Kolling Y, Melian C, Rachid M, Torres Dimani R, Werenitzky C, Lorca C, Salva S, Gobbato N, Villena J, Valdez JC (2022) Topical Administration of Accelerates the Healing of Chronic Diabetic Foot Ulcers through Modifications of Infection, Angiogenesis, Macrophage Phenotype and Neutrophil Response. Microorganisms 10. https://doi.org/10.3390/microorganisms10030634.
Argenta A, Satish L, Gallo P, Liu F, Kathju SJPo (2016) Local application of probiotic bacteria prophylaxes against sepsis and death resulting from burn wound infection. PLoS One 11:e0165294. https://doi.org/10.1371/journal.pone.0165294.
Barzegari A, Kheyrolahzadeh K, Hosseiniyan Khatibi SM, Sharifi S, Memar MY, Zununi Vahed S (2020) The Battle of Probiotics and Their Derivatives Against Biofilms. Infection and Drug Resistance 13:659-672. https://doi.org/10.2147/IDR.S232982.
Broughton G, Janis JE, Attinger CE (2006) Wound healing: an overview. Plastic and Reconstructive Surgery 117:1e-1S. https://doi.org/10.1097/01.prs.0000222562.60260.f9.
Butler È, Alsterfjord M, Olofsson TC, Karlsson C, Malmström J, Vásquez AJBm (2013) Proteins of novel lactic acid bacteria from Apis mellifera mellifera: an insight into the production of known extra-cellular proteins during microbial stress. Bmc Microbiology 13:1-12. https://doi.org/10.1186/1471-2180-13-235.
Danilova ТA, Adzhieva AA, Danilina GA, Polyakov NB, Soloviev AI, Zhukhovitsky VG (2019) Antimicrobial Activity of Supernatant of Lactobacillus plantarum against Pathogenic Microorganisms. Bulletin of Experimental Biology and Medicine 167:751-754. https://doi.org/10.1007/s10517-019-04615-9.
Dubey AK, Podia M, Priyanka, Raut S, Singh S, Pinnaka AK, Khatri N (2021) Insight Into the Beneficial Role of Supernatant Against Bacterial Infections, Oxidative Stress, and Wound Healing in A549 Cells and BALB/c Mice. Frontiers In Pharmacology 12:728614. https://doi.org/10.3389/fphar.2021.728614.
El-Kased RF, Amer RI, Attia D, Elmazar MM (2017) Honey-based hydrogel: In vitro and comparative In vivo evaluation for burn wound healing. Scientific Reports 7:9692. https://doi.org/10.1038/s41598-017-08771-8.
Fazli M, Bjarnsholt T, Kirketerp-Møller K, Jørgensen B, Andersen AS, Krogfelt KA, Givskov M, Tolker-Nielsen T (2009) Nonrandom distribution of Pseudomonas aeruginosa and Staphylococcus aureus in chronic wounds. Journal of Clinical Microbiology 47:4084-4089. https://doi.org/10.1128/JCM.01395-09.
Fonseca HC, de Sousa Melo D, Ramos CL, Dias DR, Schwan RF (2021) Probiotic Properties of Lactobacilli and Their Ability to Inhibit the Adhesion of Enteropathogenic Bacteria to Caco-2 and HT-29 Cells. Probiotics and Antimicrobial Proteins 13:102-112. https://doi.org/10.1007/s12602-020-09659-2.
Fredua-Agyeman M, Gaisford S (2019) Assessing inhibitory activity of probiotic culture supernatants against Pseudomonas aeruginosa: a comparative methodology between agar diffusion, broth culture and microcalorimetry. World Journal of Microbiology & Biotechnology 35:49. https://doi.org/10.1007/s11274-019-2621-1.
Furtado DN, Favaro L, Nero LA, de Melo Franco BDG, Todorov SDJP, proteins a (2019) Nisin production by Enterococcus hirae DF105Mi isolated from Brazilian goat milk. 11:1391-1402. https://doi.org/10.1007/s12602-019-09553-6.
Fusieger A, Perin LM, Teixeira CG, de Carvalho AF, Nero LAJAvL (2020) The ability of Lactococcus lactis subsp. lactis bv. diacetylactis strains in producing nisin. 113:651-662. https://doi.org/10.1007/s10482-019-01373-6.
Gulfraz M, Iftikhar F, Imran M, Zeenat A, Asif S, Shah IJIjofs, technology (2011) Compositional analysis and antimicrobial activity of various honey types of Pakistan. 46:263-267. https://doi.org/10.1111/j.1365-2621.2010.02488.x.
Haidari H, Bright R, Strudwick XL, Garg S, Vasilev K, Cowin AJ, Kopecki Z (2021) Multifunctional ultrasmall AgNP hydrogel accelerates healing of S. aureus infected wounds. Acta Biomaterialia 128:420-434. https://doi.org/10.1016/j.actbio.2021.04.007.
Hempel S, Newberry SJ, Maher AR, Wang Z, Miles JNV, Shanman R, Johnsen B, Shekelle PG (2012) Probiotics for the prevention and treatment of antibiotic-associated diarrhea: a systematic review and meta-analysis. JAMA 307:1959-1969. https://doi.org/10.1001/jama.2012.3507.
Hnamte S, Parasuraman P, Ranganathan S, Ampasala DR, Reddy D, Kumavath RN, Suchiang K, Mohanty SK, Busi S (2019) Mosloflavone attenuates the quorum sensing controlled virulence phenotypes and biofilm formation in Pseudomonas aeruginosa PAO1: In vitro, in vivo and in silico approach. Microbial Pathogenesis 131:128-134. https://doi.org/10.1016/j.micpath.2019.04.005.
Khan MSA, Ahmad I (2012) Antibiofilm activity of certain phytocompounds and their synergy with fluconazole against Candida albicans biofilms. The Journal of Antimicrobial Chemotherapy 67:618-621. https://doi.org/10.1093/jac/dkr512.
Khezri K, Farahpour MR, Mounesi Rad S (2019) Accelerated infected wound healing by topical application of encapsulated Rosemary essential oil into nanostructured lipid carriers. Artificial Cells, Nanomedicine, and Biotechnology 47:980-988. https://doi.org/10.1080/21691401.2019.1582539.
King S, Glanville J, Sanders ME, Fitzgerald A, Varley D (2014) Effectiveness of probiotics on the duration of illness in healthy children and adults who develop common acute respiratory infectious conditions: a systematic review and meta-analysis. The British Journal of Nutrition 112:41-54. https://doi.org/10.1017/S0007114514000075.
Kot B, Sytykiewicz H, Sprawka I (2018) Expression of the Biofilm-Associated Genes in Methicillin-Resistant in Biofilm and Planktonic Conditions. International Journal of Molecular Sciences 19. https://doi.org/10.3390/ijms19113487.
Lewis K (2001) Riddle of biofilm resistance. Antimicrobial Agents and Chemotherapy 45:999-1007. https://doi.org/10.1128/AAC.45.4.999-1007.2001.
Mariam SH, Zegeye N, Tariku T, Andargie E, Endalafer N, Aseffa A (2014) Potential of cell-free supernatants from cultures of selected lactic acid bacteria and yeast obtained from local fermented foods as inhibitors of Listeria monocytogenes, Salmonella spp. and Staphylococcus aureus. BMC Research Notes 7:606. https://doi.org/10.1186/1756-0500-7-606.
Mekky AF, Hassanein WA, Reda FM, Elsayed HM (2022) Anti-biofilm potential of Y3 culture and its cell-free supernatant against multidrug-resistant uropathogen U12. Saudi Journal of Biological Sciences 29:2989-2997. https://doi.org/10.1016/j.sjbs.2022.01.014.
Mežnarić S, Brčić Karačonji I, Crnković G, Lesar A, Pavlešić T, Vučković D, Gobin I (2022) Combined Inhibitory Effect of Fir ( Mill.) Honeydew Honey and Probiotic Bacteria on the Growth of Serotype Typhimurium. Antibiotics (Basel, Switzerland) 11. https://doi.org/10.3390/antibiotics11020145.
Moraffah F, Kiani M, Abdollahi M, Yoosefi S, Vatanara A, Samadi N (2022) In Vitro-In Vivo Correlation for the Antibacterial Effect of Lactiplantibacillus plantarum as a Topical Healer for Infected Burn Wound. Probiotics and Antimicrobial Proteins 14:675-689. https://doi.org/10.1007/s12602-022-09934-4.
Niaz T, Shabbir S, Noor T, Imran MJL (2019) Antimicrobial and antibiofilm potential of bacteriocin loaded nano-vesicles functionalized with rhamnolipids against foodborne pathogens. 116:108583. https://doi.org/10.1016/j.lwt.2019.108583.
Ong JS, Taylor TD, Yong CC, Khoo BY, Sasidharan S, Choi SB, Ohno H, Liong MT (2020) Lactobacillus plantarum USM8613 Aids in Wound Healing and Suppresses Staphylococcus aureus Infection at Wound Sites. Probiotics and Antimicrobial Proteins 12:125-137. https://doi.org/10.1007/s12602-018-9505-9.
Paluch E, Rewak-Soroczyńska J, Jędrusik I, Mazurkiewicz E, Jermakow K (2020) Prevention of biofilm formation by quorum quenching. Applied Microbiology and Biotechnology 104:1871-1881. https://doi.org/10.1007/s00253-020-10349-w.
Pancheniak EdFR, Soccol CRJBdCdPdPdA (2005) Biochemical characterization and identification of probiotic Lactobacillus for swine. Bol.centro Pesqui.process.aliment 23:299-310. https://doi.org/10.5380/cep.v23i2.4485.
Peral MC, Rachid MM, Gobbato NM, Huaman Martinez MA, Valdez JC (2010) Interleukin-8 production by polymorphonuclear leukocytes from patients with chronic infected leg ulcers treated with Lactobacillus plantarum. Clinical Microbiology and Infection : the Official Publication of the European Society of Clinical Microbiology and Infectious Diseases 16:281-286. https://doi.org/10.1111/j.1469-0691.2009.02793.x.
Robson MC (1997) Wound infection. A failure of wound healing caused by an imbalance of bacteria. The Surgical Clinics of North America 77:637-650. https://doi.org/10.1016/s0039-6109(05)70572-7.
Serra R, Grande R, Butrico L, Rossi A, Settimio UF, Caroleo B, Amato B, Gallelli L, de Franciscis S (2015) Chronic wound infections: the role of Pseudomonas aeruginosa and Staphylococcus aureus. Expert Review of Anti-infective Therapy 13:605-613. https://doi.org/10.1586/14787210.2015.1023291.
Shi N, Gao Y, Yin D, Song Y, Kang J, Li X, Zhang Z, Feng X, Duan J (2019) The effect of the sub-minimal inhibitory concentration and the concentrations within resistant mutation window of ciprofloxacin on MIC, swimming motility and biofilm formation of Pseudomonas aeruginosa. Microbial Pathogenesis 137:103765. https://doi.org/10.1016/j.micpath.2019.103765.
Squarzanti DF, Zanetta P, Ormelli M, Manfredi M, Barberis E, Vanella VV, Amoruso A, Pane M, Azzimonti B (2022) An animal derivative-free medium enhances Lactobacillus johnsonii LJO02 supernatant selective efficacy against the methicillin (oxacillin)-resistant Staphylococcus aureus virulence through key-metabolites. Scientific Reports 12:8666. https://doi.org/10.1038/s41598-022-12718-z.
Vasquez A, Forsgren E, Fries I, Paxton RJ, Flaberg E, Szekely L, Olofsson TC (2012) Symbionts as major modulators of insect health: lactic acid bacteria and honeybees. PLoS One 7:e33188. https://doi.org/10.1371/journal.pone.0033188.
Vijayakumar K, Bharathidasan V, Manigandan V, Jeyapragash D (2020) Quebrachitol inhibits biofilm formation and virulence production against methicillin-resistant Staphylococcus aureus. Microbial Pathogenesis 149:104286. https://doi.org/10.1016/j.micpath.2020.104286.
Wang B, Wei P-W, Wan S, Yao Y, Song C-R, Song P-P, Xu G-B, Hu Z-Q, Zeng Z, Wang C, Liu H-M (2021) Ginkgo biloba exocarp extracts inhibit S. aureus and MRSA by disrupting biofilms and affecting gene expression. Journal of Ethnopharmacology 271:113895. https://doi.org/10.1016/j.jep.2021.113895.
Wang N, Yuan L, Sadiq FA, He GJFC (2019) Inhibitory effect of Lactobacillus plantarum metabolites against biofilm formation by Bacillus licheniformis isolated from milk powder products. 106:106721.
Werner S, Krieg T, Smola H (2007) Keratinocyte-fibroblast interactions in wound healing. The Journal of Investigative Dermatology 127:998-1008. https://doi.org/10.1038/sj.jid.5700786.
Wolcott RD, Rhoads DD (2008) A study of biofilm-based wound management in subjects with critical limb ischaemia. Journal of Wound Care 17. https://doi.org/10.12968/jowc.2008.17.4.28835.

No competing interests reported.

Download PDF

Version 2

posted

You are reading this latest preprint version

Synergistic inhibitory effect of honey and Lactobacillus plantarum on pathogenic bacteria and their promotion of healing in infected wounds

Status:

Version 2

Abstract

Figures

Introduction

Materials And Methods

Wound infection model

Histological analysis

Statistical analysis

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 2