DOI: https://doi.org/10.21203/rs.3.rs-2090446/v1
Background: There is a growing search for natural feed additives to alleviate the deleterious effects of coccidia infection in poultry production. This study aimed to investigate the effect of enzymatically treated yeast (ETY) on the growth performance, nutrient digestibility, and intestinal health of coccidia-challenged broiler chickens.
Methods: From d 1 to 14 post hatching, 480 broiler chickens were allocated to 3 corn-soybean meal-based experimental diets with increasing concentrations of ETY (0, 1, or 2 g/kg). The experiment was designed as a randomized complete block design with body weight (BW) used as a blocking factor. On d 14 post hatching, the birds were re-randomized within each of the 3 experimental diets. Each of the 3 diet groups was split into a challenge or no-challenge group. This resulted in a 3 × 2 factorial arrangement of treatments. The coccidia challenge was administered on d 15 by an oral gavage.
Results: Dietary ETY improved (P < 0.05) the G:F of birds on d 21 regardless of the challenge state and linearly increased (P < 0.01) the apparent ileal digestibility of dry matter (DM), nitrogen, and gross energy (GE). The coccidia challenge decreased (P < 0.01) BW gain, feed intake, and G:F of broiler chickens, and reduced (P < 0.01) the apparent total tract digestibility of DM, GE, and nitrogen. The coccidia challenge increased (P< 0.01) the mRNA gene expression of TNFα, IL-1β, IL-10, and IL-6 in the cecal mucosa. There was a tendency (P = 0.08) for ETY to linearly reduce IL-1β expression. Additionally, ETY supplementation increased (P < 0.05) the gene expression of OCLN. Serum catalase increased (P < 0.05) with dietary ETY in broiler chickens on d 21. Dietary ETY linearly increased (P < 0.05) the ileal villus height to crypt depth ratio, and ileal goblet cell density in broiler chickens. The ileal and excreta oocyst counts decreased (P < 0.01) with increasing supplementation of dietary ETY in coccidia-challenged broiler chickens on d 21.
Conclusions: Dietary ETY enhanced nutrient utilization and augmented intestinal development in broiler chickens. However, dietary ETY did not completely attenuate the adverse effects of a coccidia challenge in broiler chickens.
For several years, antibiotics have been used to improve growth performance and health in poultry [1, 2]. Due to increasing concerns about the overuse of antibiotics, there is a surge in the search for dietary alternatives that have comparable efficiency like antibiotics [3]. This search has led to the discovery and use of yeast products which have been found to confer beneficial effects on animals [4]. The enzymatic treatment of yeast releases yeast cell wall components; mannan-oligosaccharides, β-glucans, and intracellular components; dipeptides, minerals, and vitamins. These products of yeast cell lysis can be collectively classified as postbiotics [5–7].
Coccidiosis has a deleterious impact on poultry production all over the world. Yearly global losses attributable to coccidiosis are more than $ 12.4 billion [8]. The coccidiosis associated Eimeria species belong to the phylum Apicomplexa, and the different species in this phylum differ in their pathogenicity [9]. Coccidiosis causes a reduction in the weight of birds, attenuation of immunity, reduction in appetite, and death [10, 11]. Because of the high cost of developing coccidia vaccines and the increasing drug resistance in Eimeria species, there is a need to explore feed additives such as yeast cell extracts in combating this ubiquitous poultry disease [12].
The enzymatic treatment of yeast releases cell components which have bioactive properties and disparate mechanisms for exerting their positive effect in a host. Several studies have highlighted the salutary advantages of including yeast cell extracts in the diets of broiler chickens [13, 14]. These cell components have shown promising potential by improving the growth performance and gut health of broiler chickens [15, 16]. While other yeast products have been widely used in the diet of healthy birds, enzymatically treated yeast (ETY) has not been well studied in coccidia-challenged broiler chickens. Hence, this current study was designed to evaluate the effect of dietary enzymatically treated yeast on the growth performance, nutrient digestibility, and intestinal health of coccidia-challenged broiler chickens. We hypothesized that the dietary supplementation of ETY protects broiler chickens against a coccidia challenge.
A total of 480 male broiler chickens (Cobb 500) were used for this experiment with initial body weight (BW) of 49.9 \(\pm\) 3.95 g. The birds were individually weighed and tagged. The birds were housed in a battery brooder and had ad libitum access to feed and water during the experimental period. All experimental diets were formulated to meet or exceed the nutrient recommendation outlined in the nutrient specification for Cobb 500 birds. The diets were provided in mash form and consisted of a corn-soybean meal-based diet supplemented with ETY (LivaltaCell HY40; AB Agri Ltd., Peterborough, United Kingdom) at 0, 1, or 2 g/kg (Table 1). Diets were free from antibiotics or coccidiostats. Titanium dioxide was added to all diets at 5 g/kg as an indigestible marker.
|
Diet |
|||
|---|---|---|---|
|
ETY, g/kg |
|||
|
0 |
1 |
2 |
|
|
Ingredient, g/kg |
|||
|
Corn |
593.4 |
583.4 |
573.4 |
|
Soybean meal (48% CP) |
310.0 |
310.0 |
310.0 |
|
Soybean oil |
35.0 |
35.0 |
35.0 |
|
Ground limestone |
14.0 |
14.0 |
14.0 |
|
Monocalcium phosphate |
13.6 |
13.6 |
13.6 |
|
Salt |
4.0 |
4.0 |
4.0 |
|
DL-Methionine |
1.8 |
1.8 |
1.8 |
|
L-Lysine HCL |
0.2 |
0.2 |
0.2 |
|
L-Threonine |
0.1 |
0.1 |
0.1 |
|
Vitamin-mineral premix2 |
3.0 |
3.0 |
3.0 |
|
ETY Premix3 |
0.0 |
10.0 |
20.0 |
|
Titanium dioxide premix4 |
25.0 |
25.0 |
25.0 |
|
Total |
1000.0 |
1000.0 |
1000.0 |
|
Calculated nutrient |
|||
|
ME, MJ/kg |
13.3 |
13.3 |
13.3 |
|
CP, g/kg |
203.8 |
203.8 |
203.8 |
|
Analyzed nutrient |
|||
|
Gross energy, MJ/kg |
16.8 |
16.8 |
16.9 |
|
CP, g/kg |
202.2 |
197.6 |
201.6 |
| 1Abbreviations: ETY Enzymatically treated yeast, ME Metabolizable energy, CP Crude protein | |||
| 2Provided the following quantities per kg of complete diet: vitamin A, 5,484 IU; vitamin D3, 2,643 ICU; vitamin E, 11 IU; menadione sodium bisulfite,4.38 mg; riboflavin, 5.49 mg; D-pantothenic acid, 11 mg; niacin, 44.1 mg; choline chloride, 771 mg; vitamin B12, 13.2 µg; biotin, 55.2 µg; thiamine mononitrate, 2.2 mg; folic acid, 990 µg; pyridoxine hydrochloride, 3.3 mg; I, 1.11 mg; Mn, 66.06 mg; Cu, 4.44 mg; Fe, 44.1 mg; Zn, 44.1 mg; Se, 300 µg | |||
| 31 g ETY added to 9 g of corn to make 10 g ETY premix. 10 g/kg of ETY premix delivered 1 g/kg of ETY; 20 g/kg of ETY premix delivered 2 g/kg of ETY | |||
| 4Prepared as 5 g TiO2 plus 20 g corn | |||
From d 1 to 14 post hatching, the birds were assigned to 3 diets in a randomized complete block design. Body weight was used as a blocking factor. Each diet consisted of 16 replicate cages and 10 birds per cage for a total of 160 birds per diet. On d 14 post hatching, chickens were individually weighed, and leftover feed was weighed to estimate feed intake (FI). All birds within each of the 0, 1 or 2 ETY g/kg diets were combined and re-randomized (Fig. 1). With this re-randomization, the number of birds was reduced to 8 birds per cage and each of the 3 diet groups was split into a challenge or no-challenge group resulting in 6 experimental treatments. On d 15 post hatching, the birds in the challenge group were orally gavaged with 1 mL solution containing 25,000, 25,000, and 125,000 oocysts of E. maxima, E. tenella, and E. acervulina, respectively. The birds in the no-challenge group were orally gavaged with 1 mL of 1% phosphate buffered saline (PBS) (VWR International). The BW ratio before the challenge was maintained across all treatments during reallotment. This resulted in a 3 × 2 factorial arrangement of treatments with 3 experimental diets (0, 1 or 2 ETY g/kg) and 2 coccidia challenge (CC) states (challenged or no-challenge) comprising 8 replicate cages and 8 birds per cage. Birds in the challenge group were separated from the birds in the no-challenge group with a demarcation to prevent cross-contamination of litter with Eimeria.
Individual BW of birds was recorded at d 7, 14, and 21 post hatching to calculate the BW gain, FI, and gain to feed ratio (G:F). Excreta samples were collected on d 14 and 21 from pans lined with paper and placed under each cage. Excreta samples were stored at − 20˚C until further analysis for eventual determination of the apparent total tract utilization (ATTU) of nutrients. Fresh excreta samples were also collected from coccidia-challenged birds into labeled 15 mL tubes (VWR International) on d 21 for oocyst counting. Excreta samples were mixed with a wooden spatula and stored at 4˚C. Birds were euthanized on d 21 by CO2 asphyxiation. Six out of the eight birds per cage were dissected to collect ileal digesta. The distal two-thirds of the dissected ileum was flushed with distilled water into pre-labeled plastic containers. The samples were stored at − 20˚C for the determination of the apparent ileal digestibility (AID) of nutrients. Portions of the flushed ileal digesta from coccidia-challenged chickens were separated into labeled 15 mL tubes for oocyst counting. Samples were mixed and stored at 4˚C.
Jejunal digesta were also collected by flushing with water into clean, pre-labeled plastic containers for crude mucin analysis, and samples were stored at − 20˚C. Jejunal and ileal tissues were collected from the second-heaviest bird in each cage. The excised intestinal segments were flushed with ice-cold 1% PBS, stapled to cut-out cardboard, and placed in 10% buffered formalin (VWR International) for 48 h. Subsequently, the tissue sections were transferred to 50 mL tubes containing 70% ethanol and stored at 4˚C until the samples were processed. Cecal segments were excised from the second-heaviest bird in each cage, and the contents were flushed with cold PBS. They were then cut longitudinally in half to expose the lumen. Mucosa was scraped using glass slides, subsequently placed in 1.5 mL of Trizol reagent (Invitrogen, Grand Island, NY), and rapidly frozen in liquid nitrogen at − 80°C for PCR analysis.
Furthermore, blood samples were collected from the right-wing vein of the heaviest bird per cage into non-heparinized tubes. The collected blood samples were centrifuged at 3,000 x g for 15 min at 4˚C after clotting. Serum was aspirated and stored appropriately at − 80˚C until further analyses. For lesion scoring, the entire length of the intestinal tissue sections from the heaviest bird per cage was set aside on clean laboratory cutting boards (Fisher Scientific, USA).
Purdue Histology and Phenotyping Laboratory processed and stained the jejunal and ileal tissue sections with alcian blue and periodic acid-Schiff reagent. Villus height and crypt depth were measured using a microscope with an electronic camera (National Optical and Scientific Instruments, Inc., Schertz, TX) and an ImageJ macro (ImageJ open-source software version 1.8). Villus height and crypt depth were measured from 5 villi per bird, and only intact and unbroken villi were considered. Villus height was defined as the distance from the tip of the villus to the crypt mouth, whereas crypt depth was defined as the distance from the base of the villus to the submucosa. Villus height to crypt depth (VH:CD) ratio was also calculated. Goblet cells (GC) were counted from the same 5 villi per bird, and the average was calculated. Goblet cell density was defined as the GC count per bird divided by the average villus height.
The length of the tissue sections collected from each bird in the challenge group was evaluated for Eimeria lesions. The intestinal tissue regions were scored using the methodology described by Johnson and Reid [17], where 0 was considered as normal, and 1, 2, 3, or 4 signified increasing severity of coccidia infection.
Approximately 2 g of excreta or ileal digesta samples were added to 28 mL of magnesium sulfate (MgSO4) solution, which served as the flotation solution. The MgSO4 solution was prepared by adding 125 g of MgSO4 salt to 500 mL double distilled water. The sample in the flotation solution was homogenized using a wooden spatula and allowed to sit for 5 min. The mixture was then sieved twice using a fine-mesh kitchen sieve. Disposable plastic droppers (Fisher Scientific, USA) were used to carefully fill the chambers of a McMaster slide (Jorgensen Laboratories, Loveland, CO). The slide was set on a flat table for 5 min to permit oocysts to float to the surface. Afterwards, the oocysts were counted under a microscope with an electronic camera. The results obtained were multiplied by a factor of 50 and expressed as the number of oocysts per gram of excreta/ileal digesta.
Total RNA was extracted from the mucosa stored in the Trizol reagent following the manufacturer's protocol. The RNA concentrations were determined using the NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA), and the RNA integrity was verified using 1% agarose gel electrophoresis. Subsequently, 2 mg of total RNA from each sample was reverse transcribed into cDNA using the MMLV reverse transcription reagent (Promega, Madison, WI). The cDNA was then diluted 1:10 with nuclease-free water (Ambion, Austin, TX) and stored at − 80°C, pending further analyses [18].
Real-time PCR of Interleukin 1β (IL-1β), Interleukin 6 (IL-6), Interleukin 10 (IL-10), Claudin 1 (CLDN1), Occludin (OCLN), and Tumor necrosis factor alpha (TNFα) genes was conducted using the Bio-Rad CFX thermocycler (Bio-Rad, Temecula, CA) with the SYBR real-time PCR mix (Biotool, Houston, TX) in a total reaction volume of 20 µl. The PCR reactions were incubated for 3 min at 95°C, following which samples were subjected to 40 cycles of an amplification protocol as follows: 95°C for 10 s, primer-specific annealing temperature for 30 s, and 95°C for 10 s. A melt curve analysis was performed for each gene after the PCR run. The annealing temperatures and primer sequences used are listed in Table 2. Samples were analyzed in duplicates, and the acceptable coefficient of variation was set at ≤ 5%. Relative gene expression was calculated using the 2 − ΔΔCt method [19], with normalization against the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
|
Target Gene |
Primer Sequence (5’ to 3’) |
Annealing Temperature (˚C) |
GenBank accession number |
References |
|---|---|---|---|---|
|
IL-1β |
F: GCATCAAGGGCTACAAGCTC |
57.7 |
NM_204524 |
(Adedokun et al., 2012) |
|
R: CAGGCGGTAGAAGATGAAGC |
||||
|
IL-6 |
F: GAACGTCGAGTCTCTGTGCTAC |
61.8 |
NM_204628 |
Current study |
|
R: CACCATCTGCCGGATCGT |
||||
|
IL-10 |
F: GGACTATTTTCAATCCAGGGACG |
53.4 |
NM_001004414.2 |
(Daneshmand et al., 2022) |
|
R: GGGCAGGACCTCATCTGTGTAG |
||||
|
CLDN1 |
F: CAGACTCTAGGTTTTGCCTT |
52.0 |
NM_001013611.2 |
(Goo et al., 2019) |
|
R: AATCTTTCCAGTGGCGATAC |
||||
|
OCLN |
F: TCGTGCTGTGCATCGCCATC |
53.4 |
NM_205128.1 |
(Goo et al., 2019) |
|
R: CGCTGGTTCACCCCTCCGTA |
||||
|
TNFα |
F: AGATGGGAAGGGAATGAACC |
55.7 |
AY765397 |
(Adedokun et al., 2012) |
|
R: ACTGGGCGGTCATAGAACAG |
||||
|
GAPDH |
F: ATGACCACTGTCCATGCCATCA |
59.0 |
NM_204305.1 |
(Adedokun et al., 2012) |
|
R: AGGGATGACTTTCCCTACAGCCTT |
||||
| 1Abbreviations: F Forward primer, R Reverse primer, IL Interleukin, CLDN1 Claudin 1, OCLN Occludin, TNFα Tumor necrosis factor alpha, GAPDH Glyceraldehyde-3-phosphate dehydrogenase | ||||
The activities of serum glutathione peroxidase (GPX), superoxide dismutase (SOD), and catalase were measured following the accompanying protocol in each ELISA kit. The samples were diluted appropriately to lower the concentrations of serum enzymes to a range detectable by the respective ELISA kits.
The crude mucin in the samples was analyzed following the method described by Horn et al. [20] with some modifications. The collected jejunal digesta samples were first lyophilized for 96 h (Unitop 600L, Virtis, Gardiner, NY) and ground using a coffee grinder. Subsequently, 3 g of the lyophilized jejunal digesta was transferred to an open-ended, round-bottom 45 mL ultracentrifuge tube. Afterward, 20 mL of cold NaCl solution (0.15 M NaCl, 0.02 NaN3, kept at 4°C) was added to the sample, and the content was homogenized for 1 min (T25 Basic, IKA Corp., Staufen, Germany). The resulting mixture was centrifuged at 12,000 × g at 4°C for 20 min, and the supernatant was carefully dispensed into a pre-weighed 50 mL plastic centrifuge tube (Greiner Bio-One, USA). Mucin proteins were extracted by adding 15 mL of cold (4°C) absolute ethanol to the supernatant. The mixture was kept at − 20°C overnight. Afterward, the mixture was centrifuged at 1,400 × g for 10 min at 4°C, and the mucin pellet at the base of the tube was retained. The mucin pellet was washed with a mix of cold (4°C) 15 mL absolute ethanol and 20 mL NaCl solution and kept overnight at − 20°C. After the mixture was retrieved from the freezer, it was centrifuged at 1,400 × g for 10 min at 4°C, and the resulting pellet was retained. The pellet was then rewashed twice with chilled absolute ethanol until the supernatant was clear. Subsequently, the samples were placed on ice in a fume hood to evaporate the leftover ethanol completely. Water was removed by suction from the mucin pellet, and the pellet was weighed to obtain the crude mucin yield.
The experimental diets and dry excreta samples were ground using a centrifugal grinder (ZM 200; Retsch GmbH, Haan, Germany), and the dried ileal digesta samples were ground using a coffee grinder. The ground samples were then dried at 105°C in a forced-air drying oven (Precision Scientific Co., Chicago, IL; method 934.01; [21]) until a constant weight was observed for dry matter (DM) determination. Gross energy (GE) in the samples was analyzed using an isoperibol bomb calorimeter (Parr 6200; Parr Instrument Co., Moline, IL), and nitrogen (N) using the combustion method (TruMac® N; LECO Corp., St. Joseph, MI; method 990.03; [22]). The concentration of titanium was measured with a microplate reader at an absorbance of 410 nm following the technique outlined by Myers et al. [23].
Using the index method, the ATTU and AID (%) of nutrients were calculated using the outlined equation [24]:
ATTU/AID, % = 100 – [(TiI/TiO) × (DO/DI) × 100]
where TiI and TiO are the concentrations of titanium (g/kg DM) in diets, and excreta/ileal digesta samples, respectively; DI and DO are the concentration of nutrients (g/kg DM) in diets and excreta/ileal digesta samples, respectively.
The AID of energy and the apparent metabolizable energy (AME; kcal/kg DM) of the diet were computed as a product of the coefficient and GE concentrations (kcal/kg) in the diet. Using a factor of 8.22 kcal/g N, the nitrogen corrected AME (AMEn) was computed by correcting for zero N retention following the method outlined by Zhang and Adeola [25].
AMEn (kcal/kg) = [AME – (8.22 × Nrt)]
where Nrt = N retention in g/kg of DM intake. The Nrt was calculated as outlined below:
Nrt (g/kg DM) = NI – [NO × (TiI/TiO)]
where NI and NO are the N concentrations (g/kg DM) in the diet and excreta, respectively.
Pre-coccidia challenge growth performance and nutrient digestibility data were analyzed using the MIXED procedure of SAS (SAS Inst. Inc., Cary, NC). Diet was considered the fixed effect and the block as a random effect. Post-coccidia challenge data were analyzed using the MIXED procedure of SAS as a 3 × 2 factorial: three levels of ETY (0, 1, or 2 g/kg) with two coccidia challenge states (challenge or no-challenge) for main effects and interactions. The treatment was considered as the fixed effect and the block as a random effect. Appropriate orthogonal polynomial contrast coefficients were generated for the linear and quadratic contrasts and the data were analyzed for the linear effect of ETY and the quadratic effect of ETY. The growth performance data from d 14 to 21 were analyzed using the MIXED procedure as an ANCOVA to adjust for the difference in BW on d 14. Oocyst count data and lesion scoring data were analyzed separately for the effect of ETY on challenged birds because there were no detectable oocysts or lesions in the non-challenged birds. Outliers, defined as values outside of ± 1.5 × interquartile range, were identified and removed. Statistical significance and tendency were declared at P ˂ 0.05 and 0.05 ≤ P ˂ 0.10, respectively. Cage was considered as the experimental unit.
Pre-coccidia challenge growth performance and nutrient digestibility of broiler chickens fed increasing levels of dietary ETY from d 1 to 14 post hatching are shown in Table 3. There was a linear increase (P < 0.05) in G:F from d 1 to 14 as ETY supplementation increased in the diets of broiler chickens. There was no effect of ETY supplementation on the ATTU of DM, GE, N, or the AME from d 1 to 14. Due to the absence of significant interaction between ETY and coccidia challenge, main effects are presented. The main effects of ETY and coccidia challenge on the growth performance and nutrient digestibility of broiler chickens from d 14 to 21 post hatching are summarized in Table 4. Six observations in the nutrient digestibility data for the challenge group were identified as outliers and designated as missing observations. Supplementation with ETY linearly increased (P < 0.05) the G:F of broiler chickens irrespective of the challenge state. Coccidia challenge (CC) decreased (P < 0.01) the BW of broiler chickens on d 21. The CC also decreased (P < 0.05) BW gain, FI, and G:F. Dietary ETY linearly increased (P < 0.01) the AID of DM, N, and GE as well as the ileal digestible energy (IDE) in broiler chickens regardless of the challenge state. However, there was no ETY effect on the ATTU of DM, N, the AME, or AMEn. Challenging birds with Eimeria spp. decreased (P < 0.01) the AID of DM, N, GE, and the IDE. The ATTU of DM and GE in broiler chickens, as well as the AME and AMEn of diets also reduced (P < 0.01) with the CC.
|
Item |
ETY, g/kg |
SEM2 |
P-value |
|||
|---|---|---|---|---|---|---|
|
0 |
1 |
2 |
L |
Q |
||
|
Growth performance |
||||||
|
BW, g |
||||||
|
d 1 |
49.9 |
49.9 |
49.9 |
1.47 |
- |
- |
|
d 7 |
144.5 |
145.1 |
146.1 |
3.46 |
0.440 |
0.902 |
|
d 14 |
367.4 |
362.1 |
375.0 |
8.64 |
0.377 |
0.220 |
|
d 1 to 7 |
||||||
|
BW gain, g/bird |
94.6 |
95.2 |
96.2 |
2.18 |
0.439 |
0.905 |
|
Feed intake, g/bird |
136.2 |
133.4 |
136.4 |
4.44 |
0.966 |
0.382 |
|
G:F, g/kg |
699.4 |
718.6 |
708.7 |
16.41 |
0.691 |
0.472 |
|
d 7 to 14 |
||||||
|
BW gain, g/bird |
223.0 |
217.0 |
228.9 |
5.98 |
0.409 |
0.155 |
|
Feed intake, g/bird |
340.2 |
326.8 |
328.4 |
8.73 |
0.285 |
0.432 |
|
G:F, g/kg |
657.7 |
663.5 |
699.0 |
10.75 |
0.006 |
0.231 |
|
d 1 to 14 |
||||||
|
BW gain, g/bird |
317.5 |
312.2 |
325.1 |
7.68 |
0.377 |
0.220 |
|
Feed intake, g/bird |
476.4 |
460.2 |
464.7 |
11.77 |
0.331 |
0.319 |
|
G:F, g/kg |
668.5 |
678.0 |
700.8 |
9.24 |
0.017 |
0.553 |
|
Nutrient digestibility |
||||||
|
ATTU of DM, % |
70.3 |
70.0 |
70.3 |
0.36 |
0.926 |
0.462 |
|
ATTU of GE, % |
73.3 |
73.0 |
68.2 |
2.66 |
0.184 |
0.479 |
|
ATTU of N, % |
57.8 |
57.1 |
58.5 |
0.66 |
0.388 |
0.167 |
|
AME, kcal/kg DM |
2932.1 |
2934.1 |
2949.6 |
16.74 |
0.462 |
0.745 |
| Abbreviations: ETY Enzymatically treated yeast, L Linear effect of ETY, Q Quadratic effect of ETY, BW Body weight, G:F Gain to feed ratio, ATTU Apparent total tract utilization, DM Dry matter, GE Gross energy, N Nitrogen, AME Apparent metabolizable energy | ||||||
| 1Data are means of 16 replicate cages, 10 birds per cage were used from d 1 to 14 post hatching | ||||||
| 2SEM Standard error of mean | ||||||
|
Item |
ETY, g/kg |
CS |
SD3 |
P-value |
||||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Challenge |
ETY |
|||||||||
|
0 |
1 |
2 |
No-challenge |
Challenge |
L |
Q |
|
|
|
|
|
Growth performance2 |
||||||||||
|
BW, g |
||||||||||
|
d 14 |
392.3 |
392.3 |
392.3 |
392.3 |
392.3 |
- |
- |
- |
- |
|
|
d 21 |
732.0 |
727.2 |
736.5 |
799.2 |
664.6 |
29.34 |
< 0.001 |
0.665 |
0.436 |
|
|
BW gain, g/bird |
339.7 |
334.9 |
344.2 |
406.9 |
272.3 |
29.34 |
< 0.001 |
0.665 |
0.436 |
|
|
Feed intake, g/bird |
524.7 |
467.4 |
482.5 |
523.3 |
459.8 |
69.27 |
0.012 |
0.095 |
0.099 |
|
|
G:F, g/kg |
659.3 |
708.2 |
707.7 |
781.9 |
601.5 |
66.61 |
< 0.001 |
0.025 |
0.178 |
|
|
No. of replicates |
16 |
16 |
16 |
24 |
24 |
|||||
|
Nutrient digestibility |
||||||||||
|
AID of DM, % |
55.6 |
58.0 |
61.3 |
65.6 |
50.9 |
4.99 |
< 0.001 |
0.003 |
0.694 |
|
|
AID of GE, % |
55.2 |
57.8 |
62.2 |
68.1 |
48.6 |
5.52 |
< 0.001 |
0.001 |
0.428 |
|
|
AID of N, % |
65.6 |
67.1 |
70.0 |
77.3 |
57.8 |
4.71 |
< 0.001 |
0.003 |
0.444 |
|
|
IDE, kcal/kg DM |
2220.0 |
2323.0 |
2506.3 |
2742.2 |
1957.3 |
222.03 |
< 0.001 |
0.001 |
0.399 |
|
|
ATTU of DM, % |
63.0 |
62.3 |
63.1 |
73.8 |
51.8 |
2.44 |
< 0.001 |
0.943 |
0.271 |
|
|
ATTU of GE, % |
63.1 |
62.5 |
63.4 |
76.8 |
49.2 |
2.33 |
< 0.001 |
0.648 |
0.272 |
|
|
ATTU of N, % |
55.7 |
54.4 |
55.1 |
67.0 |
43.2 |
3.31 |
< 0.001 |
0.550 |
0.354 |
|
|
AME, kcal/kg DM |
2535.4 |
2512.8 |
2557.5 |
3089.6 |
1980.9 |
93.88 |
< 0.001 |
0.486 |
0.223 |
|
|
AMEn, kcal/kg DM |
2387.3 |
2371.4 |
2419.8 |
2913.2 |
1872.5 |
86.44 |
< 0.001 |
0.279 |
0.214 |
|
|
No. of replicates |
15 |
14 |
13 |
24 |
18 |
|||||
| 1Abbreviations: ETY Enzymatically treated yeast, CS Challenge state, L Linear effect of ETY, Q Quadratic effect of ETY, BW Body weight, G:F Gain to feed ratio, AID Apparent ileal digestibility, IDE Ileal digestible energy, ATTU Apparent total tract utilization, DM Dry matter, GE Gross energy, N Nitrogen, AME Apparent metabolizable energy, AMEn Nitrogen corrected apparent metabolizable energy | ||||||||||
| 2Analysis of covariance was used to adjust for the difference in BW on d 14 | ||||||||||
| 3SD Standard deviation of main effect of ETY | ||||||||||
The main effects of ETY and coccidia challenge on the relative expression of genes in the cecal mucosa, serum antioxidant markers and jejunal mucin yield in broiler chickens on d 21 are summarized in Table 5. One outlier was removed from the challenge group in the gene expression data. In the serum and mucin data, 4 observations from each of the no-challenge and challenge groups were removed as outliers and due to hemolysis of blood samples. There was a tendency (P = 0.08) for ETY to reduce IL-1β gene expression in broiler chickens. However, there was no main effect of ETY on the gene expression of TNFα, IL-10, and IL-6. Dietary supplementation of ETY linearly increased (P < 0.05) the relative gene expression of OCLN in the cecal mucosa of broiler chickens but not CLDN1. The CC increased (P < 0.05) the mRNA gene expression of TNFα, IL-1β, IL-10, and IL-6. Dietary supplementation with ETY linearly increased (P < 0.05) serum catalase in broiler chickens regardless of the challenge state. There were quadratic responses (P < 0.05) in the serum catalase and GPX concentrations in broiler chickens fed increasing levels of ETY in the diet on d 21. However, dietary ETY supplementation did not affect the serum SOD concentration. The CC decreased (P < 0.05) serum catalase and increased (P < 0.01) the jejunal mucin yield in broiler chickens but there was no ETY effect.
|
Item |
ETY, g/kg |
CS |
SD2 |
P-value |
||||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Challenge |
ETY |
|||||||||
|
0 |
1 |
2 |
No-challenge |
Challenge |
L |
Q |
|
|
|
|
|
Relative gene expression |
||||||||||
|
TNFα |
0.91 |
0.93 |
0.85 |
0.75 |
1.04 |
0.188 |
< 0.001 |
0.385 |
0.361 |
|
|
CLDN1 |
0.85 |
0.89 |
0.88 |
0.85 |
0.90 |
0.496 |
0.739 |
0.919 |
0.824 |
|
|
IL-1β |
0.90 |
0.77 |
0.68 |
0.61 |
0.95 |
0.364 |
0.002 |
0.084 |
0.855 |
|
|
OCLN |
0.68 |
1.10 |
1.15 |
0.97 |
0.98 |
0.797 |
0.919 |
0.045 |
0.333 |
|
|
IL-10 |
0.59 |
0.82 |
0.70 |
0.32 |
1.09 |
0.730 |
0.001 |
0.705 |
0.410 |
|
|
IL-6 |
0.91 |
0.58 |
0.55 |
0.33 |
1.03 |
0.877 |
0.005 |
0.220 |
0.546 |
|
|
No. of replicates |
16 |
16 |
15 |
24 |
23 |
|||||
|
Serum antioxidants and mucin yield |
||||||||||
|
Catalase, U/mL |
2.88 |
9.95 |
7.88 |
8.85 |
4.96 |
6.744 |
0.049 |
0.044 |
0.029 |
|
|
SOD, U/mL |
629.27 |
574.94 |
529.44 |
661.03 |
494.73 |
366.514 |
0.075 |
0.314 |
0.977 |
|
|
GPX, U/mL |
12.12 |
12.35 |
12.15 |
12.22 |
12.19 |
0.199 |
0.505 |
0.589 |
0.002 |
|
|
Mucin, mg/g jejunal digesta |
383.63 |
348.96 |
362.93 |
309.36 |
420.99 |
77.002 |
< 0.001 |
0.438 |
0.295 |
|
|
No. of replicates |
13 |
13 |
14 |
20 |
20 |
|||||
| 1Abbreviations: ETY Enzymatically treated yeast, CS Challenge state, L Linear effect of ETY, Q Quadratic effect of ETY, TNFα Tumor Necrosis factor α, CLDN1 Claudin 1, IL Interleukin, OCLN Occludin, SOD Superoxide dismutase, GPX Glutathione peroxidase | ||||||||||
| 2SD Standard deviation of main effect of ETY | ||||||||||
The main effects of ETY and coccidia challenge on the intestinal morphology, the goblet cell count and density of broiler chickens fed ETY supplemented diets on d 21 are summarized in Table 6. One outlier was removed from the challenge group in the intestinal morphology data. Supplementation with dietary ETY linearly increased (P < 0.05) the ileal VH:CD ratio, GC count, and density in broiler chickens regardless of the challenge state. Coccidia challenge increased (P < 0.01) ileal and jejunal crypt depths in broiler chickens on d 21. Moreover, the CC decreased (P < 0.01) ileal and jejunal VH:CD ratios and the jejunal villus height in broiler chickens.
|
Item |
ETY, g/kg |
CS |
SD2 |
P-value |
||||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Challenge |
ETY |
|||||||||
|
0 |
1 |
2 |
No-challenge |
Challenge |
L |
Q |
|
|
|
|
|
Ileum |
||||||||||
|
Villi height, µm |
529.9 |
564.9 |
608.3 |
539.4 |
596.0 |
143.53 |
0.180 |
0.131 |
0.930 |
|
|
Crypt depth, µm |
208.0 |
157.4 |
196.2 |
144.9 |
229.5 |
52.55 |
< 0.001 |
0.536 |
0.009 |
|
|
VH:CD ratio |
2.9 |
3.6 |
3.5 |
3.8 |
2.8 |
0.76 |
< 0.001 |
0.042 |
0.083 |
|
|
GC count (cells/villi) |
90.1 |
116.9 |
122.5 |
112.1 |
107.5 |
24.75 |
0.478 |
< 0.001 |
0.142 |
|
|
GC density (cells/µm of VH) |
0.8 |
1.0 |
1.1 |
1.0 |
0.9 |
0.27 |
0.101 |
0.030 |
0.255 |
|
|
Jejunum |
||||||||||
|
Villi height, µm |
643.6 |
640.3 |
640.7 |
710.1 |
573.0 |
111.19 |
< 0.001 |
0.974 |
0.954 |
|
|
Crypt depth, µm |
266.0 |
275.7 |
285.6 |
180.3 |
371.2 |
66.01 |
< 0.001 |
0.400 |
0.984 |
|
|
VH:CD ratio |
3.0 |
3.0 |
2.8 |
4.2 |
1.7 |
0.76 |
< 0.001 |
0.476 |
0.633 |
|
|
GC count (cells/villi) |
75.4 |
79.3 |
78.9 |
73.2 |
82.6 |
22.82 |
0.194 |
0.576 |
0.731 |
|
|
GC density (cells/µm of VH) |
0.6 |
0.6 |
0.6 |
0.5 |
0.7 |
0.20 |
0.012 |
0.771 |
0.859 |
|
|
No. of replicates |
16 |
15 |
16 |
24 |
23 |
|||||
| 1Abbreviations: ETY Enzymatically treated yeast, CS Challenge state, L Linear effect of ETY, Q Quadratic effect of ETY, VH:CD ratio Villus height to crypt depth ratio, GC Goblet cell, VH Villus height | ||||||||||
| 2SD Standard deviation of main effect of ETY | ||||||||||
The log-transformed ileal, and intestinal lesion scoring in coccidia-challenged broiler chickens fed ETY supplemented diets at d 21 are shown in Table 7. Lesions were scored and oocysts were counted only in birds challenged with Eimeria spp., as they were not detectable in unchallenged birds. The oocysts in the excreta and ileal digesta of coccidia-challenged broiler chickens showed a quadratic response (P < 0.05) with increasing supplementation of ETY in the diets on d 21. However, supplementation with dietary ETY did not affect the Eimeria lesion scores in coccidia-challenged broiler chickens.
|
Item |
ETY, g/kg |
SEM2 |
P-value |
|||
|---|---|---|---|---|---|---|
|
0 |
1 |
2 |
L |
Q |
||
|
Oocyst count |
||||||
|
Oocysts in excreta |
5.4 |
5.2 |
5.2 |
0.04 |
0.006 |
0.014 |
|
Oocysts in ileal digesta |
5.6 |
5.3 |
5.2 |
0.04 |
< 0.001 |
0.026 |
|
Lesion scoring |
||||||
|
Lesion score E. tenella |
2.6 |
2.0 |
2.1 |
0.28 |
0.213 |
0.279 |
|
Lesion score E. acervulina |
1.3 |
0.6 |
0.9 |
0.31 |
0.404 |
0.264 |
|
Lesion score E. maxima |
2.3 |
1.4 |
1.6 |
0.37 |
0.253 |
0.236 |
| Abbreviations: ETY Enzymatically treated yeast, L Linear effect of ETY, Q Quadratic effect of ETY, E. Eimeria | ||||||
| 1Data are means of 8 replicate cages | ||||||
| 2SEM Standard error of mean | ||||||
The current study investigated the effects of dietary supplementation of enzymatically treated yeast in broiler chickens subjected to a coccidia challenge. The challenge model used in the current study caused a moderate form of coccidiosis as only two birds died during the post-challenge period. The G:F was significantly improved by dietary supplementation of ETY in broiler chickens before the coccidia challenge. Dietary yeast cell wall components have been reported to stimulate growth performance and improve feed efficiency in broiler chickens by promoting intestinal development [13, 26].
Several studies have shown that the most pronounced effects of coccidiosis in broiler chickens are growth retardation, reduced nutrient utilization, and diminished growth efficiency [18, 27]. In the current study, the CC reduced BW gain, FI, and G:F in broiler chickens. Conversely, dietary supplementation of ETY improved the G:F of broiler chickens regardless of the challenge state. This improvement is likely due to the improved ileal digestibility of nutrients observed, specifically energy, N and DM digestibility. However, ETY did not completely mitigate the effect of the CC on growth performance.
The CC reduced the AID of DM, N, and energy, which corroborates studies that reported a CC-induced decline in nutrient utilization in broiler chickens [27, 28]. The reduced nutrient utilization due to the CC may be responsible for the reduction in growth performance observed in coccidia-challenged birds [27]. Dietary ETY could be efficacious in stimulating nutrient utilization in broiler chickens regardless of their challenge state; we observed improvement in the ileal digestibility of DM, N, and energy in broiler chickens fed ETY diets. The IDE also increased with higher levels of ETY in the diet. These results are linked to the ability of ETY to promote a healthy intestinal environment [29, 30]. In the same vein, yeast cell wall products have been reported to significantly improve pancreatic activity and the release of trypsin in chickens, which may be responsible for the improved AID of N observed in this experiment [31]. However, the absence of an ETY effect on the ATTU of N in broiler chickens may be due to the hindgut protein fermentation, which may confound excreta N digestibility coefficients [32, 33].
Cytokines are essential for basic processes in the body, including immunity, inflammation, and metabolism. Their function in inflammation qualifies them as a gauge for measuring cellular immunity during active infection [34]. A cascade of events after a pathogenic invasion can increase IL-6, TNFα, IL-10, and IL-1β levels, as seen in the current study [35, 36]. Considering that increased levels of IL-1β is associated with impaired intestinal integrity and leaky gut syndrome [37], a tendency for dietary ETY to reduce cecal IL-1β expression irrespective of the challenge state could be why ETY-fed birds had better intestinal morphology. This is also supported by the increased OCLN expression in the ceca of broiler chickens, which suggests improved intestinal integrity [38]. However, ETY did not affect CLDN1 expression.
The coccidia parasite substantially damages the intestinal tract of birds by producing sporozoites that infiltrate the intestinal walls [39]. Pathogenic interference of the intestinal tight junctions can increase gut permeability and reduce nutrient absorption due to loss of cell polarity [40]. In the current study, the 6-day CC did not affect the gene expression of OCLN and CLDN1 of broiler chickens in the current study. However, several studies have reported contrasting results. Hansen et al. [41] saw a CC-induced reduction in OCLN at 7 days post infection and a CC-induced reduction in junctional adhesion molecule 3 (JAM3) at 10 days post infection. On the other hand, Teng et al. [42] reported a CC-induced upregulation in CLDN1 and JAM2 at 6 days post infection. Hence, there is a need for further research on the effect of coccidiosis and the duration of coccidia infection on tight junction proteins.
The production of antioxidant enzymes such as catalase and SOD in the blood is needed to remove excess reactive oxygen species (ROS) in the body [43]. In the current study, ETY mitigated oxidative stress and ROS production in broiler chickens, and this is hinged on the increased serum catalase regardless of the challenge state. This increase is attributable to the β-glucan and mannan components of ETY, which have been reported to actively scavenge ROS and modulate cytokine-induced oxidative stress [44–46]. Again, this reduction in oxidative damage is valid given the improved feed efficiency observed as dietary ETY increased in diet of birds. Moreover, this association is plausible because lower oxidative stress in chickens is correlated with improved growth performance [47]. On another note, the CC reduced serum catalase, evidently demonstrating a possible CC-induced oxidative stress in broiler chickens. Several studies have also demonstrated the negative effect of a mixed Eimeria infection on serum antioxidants [48, 49]. Abdelhady et al. [50] reported a coccidia-induced reduction in the serum SOD and glutathione peroxidase in broiler chickens.
The intestinal morphology and health of animals can be assessed by the villus height, crypt depth, and VH:CD ratio [51, 52]. An increase in ileal VH:CD ratio in ETY-fed broiler chickens indicates a lower epithelial turnover rate, which is suggestive of a contributory role in a healthy gut. On the other hand, the deeper crypts and reduced VH:CD ratio in the intestine of birds due to the CC may lead to inefficient nutrient uptake due to a faster tissue turnover rate [52, 53]. The exact approach by which ETY increased intestinal GC count and density in broiler chickens is unclear. However, this increase may be related to the immune-modulatory actions of the mannan component of ETY [54, 55]. Mucins prevent the entry of antigens into the blood, and they contain active IgA, which initiates pathogen binding [56]. During an infection such as coccidiosis, intestinal mucin secretion may be upregulated due to exocytosis of mucin granules from goblet cells [57]. It is noteworthy that increased jejunal mucin yield corresponds to the CC-induced increase in jejunal mucin-secreting goblet cell density in the current study. Further studies are needed to investigate the effect of ETY on the intestinal GC count and density in coccidia-challenged broiler chickens.
To our knowledge, there are no data on the effect of yeast cell extracts on ileal digesta oocyst count in broiler chickens subjected to a CC. Nevertheless, there is a possibility that yeast-derived mannans can activate C-type lectins, which interact with surface polysaccharides of different parasites, thereby inhibiting parasitic maturation [58–61]. Hence, an observed reduction in oocysts in the ileal digesta and excreta of coccidia-challenged birds indicates an ETY-derived opposition to oocyst multiplication. Further studies may be needed to evaluate the mechanism of an ETY-induced reduction in oocyst count and how that may influence intestinal health and development.
Our results showed that dietary enzymatically treated yeast significantly improved the feed efficiency, nutrient digestibility, intestinal health, and antioxidation status of broiler chickens regardless of their challenge state. Hence, dietary enzymatically treated yeast at 2 g/kg may be favorable for growth promotion and maintaining gut health in broiler chickens. However, dietary ETY supplementation did not completely alleviate the adverse effects of a coccidia challenge in broiler chickens. Therefore, further studies are required in Eimeria-challenged broiler chickens fed diets supplemented with enzymatically treated yeast.
AID: Apparent ileal digestibility; AME: Apparent metabolizable energy; ATTU: Apparent total tract utilization; BW: Body weight; CC: Coccidia challenge; DM: Dry matter; ETY: Enzymatically treated yeast; FI: Feed intake; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; GE: Gross energy; G:F: Gain to feed ratio; GC: Goblet cells; IL-1β: Interleukin 1β; IL-6: Interleukin 6; IL 10: Interleukin 10; IDE: Ileal digestible energy; JAM: Junctional adhesion molecule; ROS: Reactive oxygen species; TNFα: Tumor necrosis factor alpha; VH:CD: Villus height to crypt depth.
Acknowledgments
The authors acknowledge Patricia A. Jaynes (Purdue University, West Lafayette, IN) for her technical assistance in this study.
Authors’ contributions
Conceptualization: EOA, OA and HS. Experimental work: EOA. Experimental supervision: OA. Data analysis and interpretation: EOA and OA. Funding: HS. Original draft writing: EOA. Revision of original draft: OA and HS. All authors read and approved the final version of the manuscript.
Funding
The research was funded by Livalta, Peterborough, UK.
Availability of data and materials
All data from this study are available from the corresponding author upon reasonable request.
Declarations
Ethics approval and consent to participate
All protocols of animal experiments were reviewed and approved by the Purdue University Animal Care and Use Committee (West Lafayette, IN).
Consent for publication
Not applicable.
Competing interests
HS is an employee of Livalta, Peterborough, UK; other authors declare that there are no conflicts of interest in the current study.
Author details
1Department of Animal Sciences, Purdue University, West Lafayette, IN 47907, USA. 2Livalta, Peterborough, Cambridgeshire, PE2 6FL, UK.