Particles Generated from Degrading Magnesium Implants Induce Bone Resorption

doi:10.21203/rs.3.rs-2093365/v1

Download PDF

Research Article

Particles Generated from Degrading Magnesium Implants Induce Bone Resorption

https://doi.org/10.21203/rs.3.rs-2093365/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Magnesium (Mg) is regarded as “revolutionary orthopedic material” due to its excellent properties. In the frontier of clinical translation of biodegradable Mg, most researchers have found cavities between bone tissue and Mg-based implants which limit the use of Mg. These cavities were regarded to be formed due to H₂ gas generated from the rapid degradation of Mg. However, this explanation still lacks direct evidence. In this study, we come up with a new hypothesis aim to explain the cavities formation around the Mg-based implants.

Methods

The slightly soluble degradation particles (DPs) of high purity magnesium (HP-Mg) were prepared by electrochemical method. The effects of DPs on osteoclasts formation, polarization, and osteoclast bone resorption in vitro and in vivo were investigated.

Results

The results revealed that DPs could induce osteoclast formation. The DPs promoted the activation of both NF-κB and MAPK signaling pathways and the expression of osteoclast-specific genes and proteins were upregulated. At the same time, DPs also could accelerate calvarial bone resorption of mice.

Conclusions

These results confirmed that the presence of DPs could induce bone resorption both in vitro and in vivo, discovering a new explanation for cavities around Mg-based implants. This discovery inspires new solutions to solve the cavity problem.

Magnesium

Bone implant

Cavity

Degradation particles

Osteoclast

Magnesium (Mg)-based biometallic implants have boosted clinical translation due to their biodegradability and biocompatibility to support tissue regeneration in orthopedics[1]. Mg is entitled “revolutionary orthopedic material” due to its similar elastic modulus to the bone, the ability to promote bone formation[2, 3] and stimulate fibrocartilage formation[4]. Nevertheless, clinical implantation of Mg confronts challenges arising from the appearance of cavities between Mg implants and bone tissues. Early studies reported these cavities formed around the Mg alloy screw and viewed them as ‘gas bubbles’[5]. Similar phenomena were found in other Mg implants, regardless of the size of implants or the animal species used[6] (Fig. 1). Such as W4 (96 wt.% magnesium, 4 wt.% yttrium) screws, producing hydrogen gas at a relatively rapid rate, yielding a consecutive bone defect (gas cavities) in the vicinity of the screw after six, twelve weeks and one year[7]. The existence of hydrogen bubbles has side effects[8]. And the presence of cavities will undoubtedly impede the clinical translation of Mg, limiting their practical use in clinical trials. To reduce the cavities caused by the rapid degradation of Mg, numerous studies have attempted to coat Mg with anticorrosive layers or refine the microstructure/grain size to control the degradation rate of Mg[9–12]. Nevertheless, no strong evidence could confirm the cavities are hydrogen bubbles[13]. As hydrogen is a highly tissue-permeable gas which easy to escape, it remains dubious if the hydrogen gas is the main reason for observed cavities[13].

In addition to hydrogen gas, the direct degradation product of Mg after reacting with water is Mg(OH)₂. The presence of anionic salts in body fluids, such as phosphate, carbonate and organic compounds can convert Mg(OH)₂ into slight soluble particles. The slight soluble particles around the Mg implants have been detected by the X-ray radiation (Fig. 2). Cytocompatibility tests on these insoluble particles suggest that they are generally non-toxic[17] and can be recognized and phagocytosed by macrophages[18]. However, the slight soluble degradation particles from Mg are potential proinflammatory cues that may trigger inflammatory responses. Jin et al. proposed that the insoluble particles generated from Mg may activate the production of reactive oxygen species (ROS) and the release of proinflammatory cytokines among macrophages[17]. Maradze et al. discovered that the Mg corrosion granules could interfere with the differentiation of bone marrow stem cells (BMSCs) and possibly delay bone healing[19]. However, it remains ambiguous if the slight soluble particles from degrading Mg implants could cause bone resorption, and the underlying mechanism needs to be elucidated. Unfortunately, until now, no research has explored the effects of slight soluble degradation particles (DPs) produced by high purity magnesium (HP-Mg) degradation on osteoclasts.

To further explore the relationship between DPs and osteoclasts, we investigate the potential roles of DPs on the RANKL-induced differentiation of osteoclasts in vitro as well as in vivo. This work proves that DPs-activated signaling of osteoclasts initiates bone resorption paradigm. Accordingly, activation of osteoclasts may be one of the reasons for the enlargement of the cavity around Mg implants, which inspires new solutions to solve the cavity problem.

2.1 Materials preparation

The HP-Mg sheets (12*10*1 mm, purity of 99.98%) were supplied by Suzhou Medical Technology Co. Ltd., China. All sheets were ground with SiC paper up to 800 grits, then followed by ultrasonic cleaning in anhydrous ethanol for 10 min. The sheet was placed in an electrode holder and 1 cm² of the surface was exposed to 125 ml of alpha minimum essential media (α-MEM, Corning, USA) to reach the open circuit potential (OCP). The potential was scanned from 50 mV below the OCP with a rate of 1 mV/s to a potential 1 V higher than OCP for 4 h at room temperature as described before[17]. The slight soluble degradation products were collected carefully by filtering the medium. The products were crushed mechanically and sterilized wait for use and named DPs. The surface morphology of DPs was observed using the scanning electron microscopy (SEM, RISE-MAGNA, CZ) and the chemical composition of the DPs were characterized by energy-dispersive X-ray spectroscopy (EDS), equipped with SEM. The composition of crystals was determined by X-ray diffraction (XRD, D8 ADVANCE Da Vinci, Germany). The sizes or diameters of DPs were measured by laser particle size analyzer (Microtrac S3500, USA). The DPs were analyzed using inductively coupled plasma–optical emission spectrometry (ICP-OES, Perkin Elmer Avio 500, USA) to detect the elemental concentrations of Mg.

2.2 In vitro cell experiment

2.2.1 Cell culture

Primary bone marrow macrophages (BMMs) were obtained from femurs and tibias of 6-week-old C57/BL6 mice. Briefly, after sacrificing, the specimens were incubated in 75% ethanol for 10 min and then rinsed with phosphate buffered saline (PBS, Corning, USA). Then all of the bone marrow was flushed from mouse femurs and tibias and then resuspended in complete α-MEM containing 10% fetal bovine serum (Gibco, USA), 1% penicillin-streptomycin solution (Gibco, USA) and 30 ng/ml macrophage colony-stimulating factor (M-CSF, PeproTech, USA). Cells were cultured in 5% CO₂ incubator at 37 ℃ for 6 days. The medium were changed every other day to remove non-adherent cells. At 80% confluence, the cells were washed with PBS three times and then trypsinized to harvest BMMs for the following experiments. For DPs treatment, DPs were dispersed in complete medium and mixed fully before use.

2.2.2 Cell viability assay

To assess the cytotoxicity of DPs, BMMs were seeded in 96-well plates at a density of 1×10⁴cells per well. After incubating with 1.25, 2.5, 5 μg/ml of DPs for 12 h, 24 h and 48 h, the medium was replaced with fresh culture medium containing 10% (v/v) CCK-8 solution (Dojindo Laboratories, Japan) and further incubated at 37 ℃ for 2 h. The absorbance was measured at 450 nm using a microplate reader measurement (BioTek, USA).

2.2.3 Tartrate-resistant acid phosphatase (TRAP) staining assay

BMMs were seeded in 96-well culture plates (1×10⁴cells per well) and incubated with complete α-MEM medium containing M-CSF for 24 h. The cells were pretreated with 1.25, 2.5, 5 μg/ml of DPs for another 24 h. Then the culture medium was replaced with fresh culture medium containing 30 ng/ml M-CSF and 50 ng/ml receptor activator of nuclear factor kappa-Β ligand (RANKL, R&D, USA), and the medium was replaced every other day. After 5 days culture, the cells were fixed using 4% paraformaldehyde solution at 37 ℃ for 20 min. Cells were stained using an acid phosphatase kit (Sigma-Aldrich, USA) according to the mantnfufacture’s procedures. After staining, images were obtained using an inverted microscope (CEWEI, LWD300-38LFT, China). The total area of TRAP-positive (contained three or more nuclei) regions and the total number of osteoclasts were quantified on five randomly selected fields of view for each sample. And the data was analyzed by the ImageJ software.

2.2.4 F-actin ring immunofluorescence assay

BMMs were cultured as 2.2.3 described. After 5 days cultured, the cells were fixed using 4% paraformaldehyde solution for 20 min at room temperature and permeabilized for 5 min with 0.1% (v/v) Triton X-100. After washing cells with PBS three times, the cells were stained with phalloidin-iFluor 488 reagent (Abcam, UK) for 30 min and subsequently stained with 4ʹ,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) for 10 min. Finally, the F-actin ring was observed and captured images using a laser scanning confocal microscope (Leica, TCS SP8 STED 3X, Germany).

2.2.5 Bone resorption assay

The bovine bone slices were immersed in 75% alcohol to sterilize and then soaked in culture medium in a 96-well culture plate for 24 h to remove residual alcohol. BMMs were seeded on bone slices in 96-well plates (1×10⁴cells per well) with three replicates and stimulated with or without 1.25 μg/ml DPs, and the medium was replaced every other day. After 10 days cultured, the cells on the bone slices were removed using 0.25% EDTA-Trypsin, and the bone slices were dehydrated by gradient dehydration and then coated with gold for observation under SEM.

2.2.6 Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

BMMs were seeded in a 6-well plate at a density of 5×10⁵ per well and pretreated with 1.25 μg/ml DPs for 24 h. Then the cells were stimulated with M-CSF (30 ng/ml) and RANKL (50 ng/ml) for 0.5, 2, 3 and 4 days respectively. Total RNA of BMMs was isolated using EZNA™ Total RNA kit II (Omega Bio-Tec, USA) according to the manufacturers’ instructions, and cDNA was synthesized from 1 μg of total RNA using reverse transcriptase (Yeasen Biotechnology, China). Real-time PCR was performed using the SYBR Green Master Mix (Yeasen Biotechnology, China) and a CFX Connect Real-Time System (Bio-Rad, USA). The system was programmed with the following PCR conditions: pre-denaturation at 95 ℃ for 5 min, then 40 cycles of denaturation at 95 ℃ for 10 s, annealing at 55 ℃ for 20 s and amplification at 72 ℃ for 20 s. All reactions were run in triplicate and were normalized to express the level of GAPDH (Cat# B661304, Sangon Biotech, China). The primers we used for analysis are listed in Table 1.

Table 1 Primer Sequences used for RT-qPCR

Gene	Forward Primer Sequence (5’-3’)	Reverse Primer Sequence (5’-3’)
C-Fos	TCTCTAGTGCCAACTTTATCCC	GAGATAGCTGCTCTACTTTGCC
NFATc1	GAGAATCGAGATCACCTCCTAC	TTGCAGCTAGGAAGTACGTCTT
TRAP	CAAGAACTTGCGACCATTGTTA	ATCCATAGTGAAACCGCAAGTA
CTSK	GCTTGGCATCTTTCCAGTTTTA	CAACACTGCATGGTTCACATTA

Abbreviation: NFATc1, nuclear factor of activated T cells c1; CTSK, cathepsin K

2.2.7 Western blotting

BMMs were seeded in a 6-well plate at a density of 5×10⁵ per well and pretreated with 1.25 μg/ml DPs for 24 h. Subsequently cultured in the presence or absence of 50 ng/ml RANKL for the indicated time (3 days or 30, 15, 30 min). Later, cells were lysed in cell lysis buffer with the supplementation of proteinase and phosphatase inhibitors after washing with PBS for 3 times. Fractions were centrifuged at 12,000 ×g for 20 min. BCA protein assay kit was used to determine the total protein concentration. An equal amount of protein (20 μg) was separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride membrane (Millipore, USA). The membrane was blocked in 5% skim milk, incubated in primary antibodies: c-Fos (Cell Signaling Technology, 2250, USA, 1:1000), Nfatc1 (Santa Cruz Biotechnology, sc7294, USA, 1:1000), p-Nfatc1 (Affinity Biosciences, AF8012, USA, 1:1000), p-ERK (Cell Signaling Technology, 4370, USA, 1:1000), ERK (Cell Signaling Technology, 4695, USA, 1:1000), p-JNK (Cell Signaling Technology, 4668, USA, 1:1000), JNK (Cell Signaling Technology, 9252, USA, 1:1000), p-P38 (Cell Signaling Technology, 4092, USA, 1:1000), P38 (Cell Signaling Technology, 9212, USA, 1:1000), p-IKKα/β (Cell Signaling Technology, 2697, USA, 1:1000), IKKα (Cell Signaling Technology, 2682, USA, 1:1000), p-IKBα (Cell Signaling Technology, 2859, USA, 1:1000), IKBα (Cell Signaling Technology, 4812, USA, 1:1000), p-P65 (Cell Signaling Technology, 3033, USA, 1:1000), P65 (Cell Signaling Technology, 8242, USA, 1:1000), β-Actin (Cell Signaling Technology, 4970, USA, 1:1000), Anti-rabbit IgG (Cell Signaling Technology, 7074, USA, 1:1000).

2.3 In vivo experiment

2.3.1 Experiment of murine calvaria

The animal experiments were approved by the Animal Care and Experiment Committee of Shanghai Jiao Tong University School of Medicine (Shanghai, China; Animal Ethics Approval #2020061). Twenty-four 6-week-old C57BL/6 male mice were randomly assigned to four groups in equal numbers: (a) Normal control group (sham, with PBS injection), (b) Lipopolysaccharide (LPS) group (25 mg/kg body weight and PBS injection)[20], (c) DPs group (20 mg DPs suspended in PBS were injected to each mouse), (d) DPs + LPS group (both DPs and LPS injection, the injection concentration was same with b and c group). In the sham group, the incision was closed without any further procedure. Mice in other groups were uniformly injected as described above on the surface of the bilateral parietal bones along the sagittal suture. Two weeks after surgery, mice were sacrificed and harvest the calvariae were for further investigation.

2.3.2 Micro-CT analysis

The micro-architectural properties of calvariae were analyzed using the high-revolution micro-CT scanner (Skyscan, Belgium). The procedure was set at a thickness of 9 μm with a voltage of 50 kV, a current of 500 μA, and regular increments of 0.7° in the 180 rotational steps. After reconstruction, a square region of interest (ROI) around the midline suture was chosen for further qualitative and quantitative analysis, with the bone mineral density (BMD), bone volume against tissue volume (BV/TV), the number of pores and total porosity (%).

2.3.3 Histological staining

Calvaria samples were collected and fixed in 4% paraformaldehyde, decalcified in 10% Ethylene Diamine Tetraacetic Acid (EDTA) for 4 weeks, and then embedded in paraffin. The paraffin embedded tissue samples were cut in 7 μm thickness for hematoxylin and eosin (H&E) and TRAP staining. The images were obtained using high quality light microscopy.

2.4 Statistical analysis

All values are presented as mean ± standard deviation (SD). A one-way analysis of variance (ANOVA) with Student–Newman–Keuls test was used for multiple comparisons. P-value below 0.05 was considered statically significant.

3.1 The characters of DPs

The morphology and size of DPs were investigated by SEM and laser-based particle size analyzer, respectively. Fig. 3(a-b) showed the DPs are polydisperse in sizes and shapes. More than 60% of DPs were smaller than 5 μm in diameters, which can be recognized and phagocytosed by macrophages[21]. X-ray diffraction (XRD) test indicated that DPs were composed of insoluble inorganic salts, such as Mg₃(PO₄)₂, MgCO₃, Mg(OH)₂, Ca₃(PO₄)₂ and CaCO₃, as shown in Fig. 3(c)[22]. The weight fraction of Mg in DPs was 10±0.0698% detected by ICP-OES. Due to the limited solubility of these particles, the concentration of free Mg²⁺in the cell-culture medium almost remains unchanged as the concentration of DPs increases from 1.25 to 5 μg/ml as shown in Fig.3(d). The maximum concentration of free Mg²⁺in 5 μg/ml DPs was 0.8205 mM, which was only 2.6% higher than the control group (0 μg/ml). The value of pH was also monitored, there is no change in pH value between these groups.

3.2 Effect of DPs on cell cytotoxicity

CCK-8 assay was used for testing the cell viability and proliferation of BMMs in different concentrations of DPs. No obvious cytotoxic effect on cell viability was shown in Fig. 4(d) after 2 days. Based on these results, both these three concentrations of DPs have no cytotoxicity on BMMs.

3.3 Effect of DPs on osteoclastogenesis

The effects of DPs on osteoclast formation were measured with the TRAP staining assay. As shown in Fig. 4(a), the control group formed numerous TRAP-positive multinucleated osteoclasts. By contrast, the formation of osteoclasts was promoted after DPs treatment. The percent of osteoclast area [Fig. 4(e)] and the number of osteoclasts [Fig. 4(f)] treated by DPs were increased in a dose-dependent manner. There were significant differences between the control group and DPs treated groups. Under RANKL stimulation, BMMs differentiate into mature osteoclasts. The actin ring is critical for osteoclastic function. Effects of DPs at different concentrations on the formation of actin rings were acc·essed. As shown in Fig. 4(b), DPs increased the average area of actin rings from 1.0-fold (control) to 1.5-fold (1.25 μg/ml), 1.8-fold (2.5 μg/ml) and 3.3-fold (5 μg/ml). At the same time, the average number of nuclei per osteoclast increased from 23.5±0.8 (control) to 29.5±3.5 (1.25 μg/ml), 46.2±5.9 (2.5 μg/ml) and 61.6±1.7 (5 μg/ml). In a word, these results indicate that DPs promote maturation of osteoclasts formation. To further investigate the effects of DPs on bone resorptive activity of osteoclasts, bovine bone slices were used to evaluate bone resorption capacity. Fig. 4(c) showed bone resorption after being treated with or without DPs (1.25 μg/ml). Resorption analysis showed that the percentage of resorption area per field of DPs group was 69.87±2.14%. In comparison, the control group was 0.53±0.05% (RANKL-) and 22.82±8.50% (RANKL+). These results further confirmed that DPs promote the resorptive activity of osteoclasts.

3.4 Expression levels of osteoclast-specific genes

Bone resorption and osteoclast formation stimulated by RANKL are often related to the upregulation of specific marker genes required for these processes. To understand if DPs accelerate RANKL-induced osteoclast differentiation, we stimulated the cells with both DPs and RANKL, and the expression of osteoclast genes relative to GAPDH in BMMs after 12 h, 2 d, 3 d and 4 d were analyzed by the qPCR assay (Figure. 5 a-d). The transcription factor c-Fos, a component of activator protein-1, which is essential for osteoclast differentiation, was upregulated. The expression level of NFATc1, the major transcriptional factor was upregulated as well. The expression of bone resorption genes TRAP and CTSK were also significantly promoted. The promoting effect of DPs was very stable, with a significant effect from 12 h to 4 d.

3.5 DPs promote the activation of osteoclast-specific signaling pathways

To further declare the mechanisms of how DPs promote osteoclastogenesis, we tested the activation of the osteoclastogenesis-related signaling pathways, including RANKL-induced NF-κB and mitogen-activated protein kinase (MAPK) by western blotting. BMMs were pretreated with 1.25 μg/ml for 24 h and then determined the expression of IKKβ, IKBα, and P65 of the NF-κB signaling pathway and ERK, JNK, and P38 of MAPK signaling pathway after stimulating pretreated BMMs with or without RANKL for 15 and 30 min [Fig. 5(g, h)]. The results indicated that phosphorylation of IKKβ, IKBα, and P65 relative to total IKKβ, IKBα, and P65 as well as the phosphorylation of ERK, JNK, and P38 relative to total ERK, JNK, and P38 increased with the addition of DPs. These results were consistent with the former characterization of osteoclast formation, suggesting that the NF-κB and MAPK were both engaged in the DPs promoting osteoclast activation.

And then, to examine the influence of DPs on the expression downstream of NF-κB signaling, we treated BMMs with RANKL and with or without DPs for 3 days. As shown in Fig. 5(e-f), the NFATc1 and c-Fos were dramatically promoted by DPs treatment. Collectively, these findings suggest that DPs expert a promoting effect on both NF-κB and MAPK activation.

3.6 DPs promoted calvarial bone resorption in vivo

Murine calvarial model was used to investigate whether DPs could cause bone loss in vivo. The group injected with PBS was recognized as sham group. And the group injected with LPS alone was recognized as the positive control group. The micro-CT results in Fig. 6 showed little difference in bone mineral density, percentage of total porosity, pores, and bone/tissue volume between LPS and DPs groups. When comparing DPs group with the sham group, the BMD was reduced from 1.051±0.192 g/cc to 0.563±0.018 g/cc, the percentage of total porosity was increased from 14.423±1.412% to 28.886±4.737%, the pores were increased from 101±33.116 to 183±62.764, the value of BV/TV was reduced from 87.886±3.880 to 70.239±5.637. These results demonstrate that DPs could cause bone loss as LPS did, and osteolysis would be exacerbated while injecting LPS and DPs simultaneously. In all, these findings demonstrate DPs could accelerate bone loss in an LPS independent way in vivo.

Histological and histomorphometric analyses of calvarial bone sections were conducted to further compare the level of osteolysis with and without DPs treatment. The injection of DPs resulted in multiple osteoclasts along the eroded bone surface, as revealed by staining for the osteoclast marker enzyme TRAP (Fig. 7b; black arrowheads). Consistent with the micro-CT quantitation, histomorphometric analysis demonstrated that DPs + LPS group significantly induce bone erosion. In addition, the number of osteoclasts was increased with the addition of DPs. These results further proved that DPs accelerate bone resorption.

The phenomenon of cavities around Mg-based implants had been widely reported by many groups. For clinical application studies, cavities were seen by early X-rays among hallux valgus corrective surgery and fractures cases. These cavities were thought to be caused by hydrogen accumulation and were harmless[16,23,24]. For animal studies, gas cavities were observed around Mg-based screw at 1 month[5,25]. Besides, degradation products were detected in the cavities and tissue with histological sections[26]. Macrophages could resorb Mg corrosion products in vacuoles[7]. It is considered large amount of Mg corrosion products were eliminated not only by scavenger cells, but also by transport through the cortical bone[15]. Osteoclasts around the cavities are also worthy of attention[15,25,27,28]. We assume the cavities may come from these three ways: i) Mechanical damage caused during surgery, ii) Mg ions overactivated bone remodeling, and bone remodeling include bone formation and bone resorption, iii) degradation products activating osteoclasts. It was proved the continued exposure of Mg²⁺ could not only lead to the over-activation of NF-κB signaling in macrophages and increase number of osteoclastic-like cells, but also decelerate bone maturation through the suppression of hydroxyapatite precipitation, especially in the remodeling phase[29]. In this study, we focus on the direct effect of degradation particles on osteoclast which inspired by wear debris.

Wear debris worn from implant materials, such as titanium (Ti) particles, is considered one of the most important factors contributing to inflammatory osteolysis[30]. Ti particles initiate the recruitment of macrophages and lymphocytes, then stimulate these cells to secrete several pro-inflammatory cytokines that are associated with osteoclast formation and maturation. Except for Ti particles, other implants wear debris during osteolysis have been studied with cobalt (Co), chromium (Cr), polymeric implants [polymethymethacrylate (PMMA)] and ceramic implant [alumina (Al₂O₃), zirconia (ZrO₂)] [31–33]. However, all the mentioned above are inert metal grinding chips. While Mg, as a kind of degradable material, products slight soluble degradation particles during degradation. As we all know, the contact between the fresh surface and an electrolyte-containing aqueous medium leads to higher initial corrosion rates when an HP-Mg sample is immersed in a physiological medium. The net reactions show that Mg(OH)₂ is the first production in the degradation process and readily precipitates because of its low solubility of 12 mg/L in water. The presence of inorganic salts in physiological conditions complicates the degradation of Mg-based metals[22,34]. The process includes the release of slight soluble degradation particles as below.

Mg＋H₂O → Mg(OH)₂↓＋H₂↑

Mg(OH)₂＋Cl^-→MgCl₂＋OH^-

OH^-＋HCO₃^-→CO₃^2-＋H₂O

Mg²⁺＋CO₃^2-→MgCO₃↓

H₂PO₄^-/HPO₄^2-＋OH^-→PO₄^3-＋H₂O

Mg²⁺＋PO₄^3-→Mg₃(PO₄)₂↓

Ca²⁺＋CO₃^2-→CaCO₃↓

Ca²⁺＋PO₄^3-→Ca₃(PO₄)₂↓

In situ observation demonstrates that these slight soluble degradation particles can be phagocytosed by macrophages[18]. XRD patterns show that the main components of DPs are consistent with the above as α-MEM including CaCl₂, KCl, KH₂PO_4,NaCl, Na₂HPO₄ and other inorganic salts. So, DPs could be regarded as the slight soluble degradation particles of biomedical Mg produced in vivo. When considering phagocytose, it has been reported that the ingestion of small particles by cell occurs by endocytosis or pinocytosis for nano-meter-sized particles (less than 150 nm). Larger particles (more than 150 nm to 10 μm) can be phagocytosed by macrophages[35]. At the same time, DPs affect the content of Mg ions and pH value of the culture medium. Accordingly, the effect of Mg ions and pH value on osteoclasts should be discussed. An appropriate concentration of Mg ions has the function of promoting osteogenesis and inhibiting osteoclast, which is well known[36]. Researchers obtained Mg leach liquor (MLL) by immersing pure Mg in culture medium. And they demonstrated that MLL suppresses osteoclast formation, polarization, and osteoclast bone resorption in vitro[37]. However, in our study, suppose DPs could be completely dissolved, 5 μg/ml DPs have the highest Mg²⁺ concentration at 0.8205 mM, which was only 2.6% higher than the control group. It indicated that the concentration of Mg ions affected by DPs is small enough to be ignored. At the same time, it is well known that bone resorption is very sensitive to pH value. Acidosis has negative impact on the skeleton. The stimulatory effect of osteoclast on bone resorption is near-maximal at pH 7.0, whereas above pH 7.4, resorption is switched off [38]. While there is no change in pH between groups in this study. Therefore, the effects of Mg²⁺ concentration and pH value on bone resorption can be ignored in this study.

No studies have discussed the relationship between these HP-Mg degradable particles and bone resorption. We mimicked the DPs by electrochemistry. Firstly, the cytotoxic effects of DPs on BMMs and BMMs viability were not impaired in the presence of both these three concentrations of DPs we used after two days of culture. The results of the osteoclasts formation assay and F-actin rings formation assay indicated that DPs facilitated more osteoclast formation. Considering DPs is a kind of debris, and the MAPK and NF-κB signaling pathways are classical signaling pathways in the activation of osteoclasts. Under RANKL stimulation, TNF receptor-associated factor 6 (Traf6) is activated and then activates the downstream protein kinase TAK1, which subsequently phosphorylates ERK and IKKα. Phosphorylated ERK and IKKα further activate the MAPK and NF-κB signaling pathways and finally activate the essential transcription factor Nfatc1 for osteoclastogenesis. Our data showed that pretreatment with DPs enhanced RANKL-induced phosphorylation of ERK, JNK, and P38. Similar trends were also observed in NF-κB activation. These results demonstrated that DPs activate the MAPK and NF-κB signaling pathways. NF-κB is a master regulator of immune response, and one of the major signaling pathways activated during aseptic loosening. NF-κB activation contributes to osteoclast differentiation and maturation via RANK/RANKL signaling, which increases bone destruction and reduces bone formation[39]. MAPK is another intracellular signal-transducing molecule that regulates wear debris-induced inflammatory osteolysis. We also measured the osteoclast-specific genes, including c-Fos, NFATc1, TRAP and CTSK, which showed an increasing trend in the expression of these genes with DPs condition. Furthermore, we used the classic mouse skull model to further confirm the effect of DPs in promoting osteolysis in vivo.

To sum up, DPs have the potential of bone resorption. Here we come up with a conjecture shown in Fig. 8, that the cavities around implants may be related with osteoclasts. (i) Mg contact with body fluid and blood, and begin to degrade. DPs are produced in physiological environment. (ii) Macrophages phagocytose DPs and release pro-inflammatory factors. (iii) Macrophages differentiate into osteoclasts, the existence of proinflammatory factors can directly facilitate this process. (iv) Bone resorption occurs and cavities appear. Part (iii) had preliminary proved by other researchers[40]. Some pro-inflammatory cytokines were upregulated after macrophages phagocytose DPs according to RNA-seq results. DPs were able to induce a slight inflammatory response in macrophages by inducing ROS production at the same time[17]. Though Roth et al. regard DPs are not able to trigger an inflammatory response in human primary macrophages, the sizes of DPs are too big to phagocytose for macrophages in their study[41]. However, these DPs mentioned above were both prepared by Mg alloys, the relationship between DPs produced by high purity Mg and macrophages still need to be explored.

In conclusion, we showed DPs generated from degrading HP-Mg implants could effectively promote osteoclast differentiation as well as osteoclastic function in vitro and bone resorption in vivo. It could be one of the reasons for enlargement of the cavities around Mg-based implants. This discovery inspires new solutions to solve the cavity problem. In addition to controlling the degradation rate, anti-osteoclast drug coatings are also worth considering during surface modification of Mg.

BMMs: Bone marrow-derived macrophages

CTSK: Cathepsin K

DPs：Degradation particles

ERK: Extracellular-signal-regulated kinase

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

HP-Mg: High purity magnesium

ICP-OES: Inductively coupled plasma emission spectroscopy

JNK: c-Jun N-terminal kinase

LPS: Lipopolysaccharide

MAPK: Mitogen-activated protein kinase

M-CSF: Macrophage colony-stimulating factor

Mg: Magnesium

Micro-CT: Micro-computer tomography

NFATc1: Nuclear factor of activated T cells c1

NF-κB: Nuclear factor-kappa-light-chain enhancer of activated B cells

RT-qPCR: Real-time quantitative PCR

SEM: Scanning electron microscope

TRAP: Tartrate-resistant acid phosphatase

XRD: X-ray diffraction

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and material

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Funding

Not applicable.

Authors' contributions

This manuscript was mainly designed and written by SY. YK and LJ contributed to the animal experiments. YH and WWH revised the manuscript. YJL, ZR, PHZ and KXB searched references and collected information. PZX, DXP and HP contributed to the analysis and interpretation of data. SY and ZXN contributed to the project supervision. All authors approved the final manuscript.

Acknowledgements

This work was financially supported by the Natural Science Foundation of China (No.82160436 and No. 51801127), the Science and Technology Commission of Shanghai Municipality (No.19441905600), the “Science and Technology Innovation 2025” Major Special Project of Ningbo (No.2019B10064) and the Shanghai Jiao Tong University Interdisciplinary (Biomedical Engineering) Research Fund (No.ZH2018ZDA09).

Sun Y, Wu H, Wang W, Zan R, Peng H, Zhang S, et al. Translational status of biomedical Mg devices in China. Bioact Mater. 2019;4:358–65.
Zhang Y, Xu J, Ruan YC, Yu MK, O’Laughlin M, Wise H, et al. Implant-derived magnesium induces local neuronal production of CGRP to improve bone-fracture healing in rats. Nat Med. 2016;22:1160–9.
Han P, Cheng P, Zhang S, Zhao C, Ni J, Zhang Y, et al. In vitro and in vivo studies on the degradation of high-purity Mg (99.99wt.%) screw with femoral intracondylar fractured rabbit model. Biomaterials. 2015;64:57–69.
Cheng P, Han P, Zhao C, Zhang S, Wu H, Ni J, et al. High-purity magnesium interference screws promote fibrocartilaginous entheses regeneration in the anterior cruciate ligament reconstruction rabbit model via accumulation of BMP-2 and VEGF. Biomaterials. 2016;81:14–26.
Kong X, Wang L, Li G, Qu X, Niu J, Tang T, et al. Mg-based bone implants show promising osteoinductivity and controllable degradation: A long-term study in a goat femoral condyle fracture model. Mater Sci Eng C. 2018;86:42–7.
Yu Y, Lu H, Sun J. Long-term in vivo evolution of high-purity Mg screw degradation — Local and systemic effects of Mg degradation products. Acta Biomater. 2018;71:215–24.
Thormann U, Alt V, Heimann L, Gasquere C, Heiss C, Szalay G, et al. The Biocompatibility of Degradable Magnesium Interference Screws: An Experimental Study with Sheep. BioMed Res Int. 2015;2015:1–15.
Song G. Control of biodegradation of biocompatable magnesium alloys. Corros Sci. 2007;49:1696–701.
Lou J, Sun Y, Chen Y, Zan R, Peng H, Yang S, et al. Effects of MgF2 coating on the biodegradation and biological properties of magnesium. Surf Coat Technol. 2021;422:127552.
Wang W, Wu H, Sun Y, Yan J, Zhang L, Zhang S, et al. Local intragranular misorientation accelerates corrosion in biodegradable Mg. Acta Biomater. 2020;101:575–85.
Wang W, Wu H, Zan R, Sun Y, Blawert C, Zhang S, et al. Microstructure controls the corrosion behavior of a lean biodegradable Mg–2Zn alloy. Acta Biomater [Internet]. 2020 [cited 2020 Mar 14]; Available from: http://www.sciencedirect.com/science/article/pii/S1742706120301288
Wang W, Blawert C, Zan R, Sun Y, Peng H, Ni J, et al. A novel lean alloy of biodegradable Mg–2Zn with nanograins. Bioact Mater. 2021;6:4333–41.
Kuhlmann J, Bartsch I, Willbold E, Schuchardt S, Holz O, Hort N, et al. Fast escape of hydrogen from gas cavities around corroding magnesium implants. Acta Biomater. 2013;9:8714–21.
Shen D, Qi H, Lin W, Zhang W, Bian D, Shi X, et al. PDLLA-Zn-nitrided Fe bioresorbable scaffold with 53-μm-thick metallic struts and tunable multistage biodegradation function. Sci Adv. 2021;7:eabf0614.
Dziuba D, Meyer-Lindenberg A, Seitz JM, Waizy H, Angrisani N, Reifenrath J. Long-term in vivo degradation behaviour and biocompatibility of the magnesium alloy ZEK100 for use as a biodegradable bone implant. Acta Biomater. 2013;9:8548–60.
Lee J-W, Han H-S, Han K-J, Park J, Jeon H, Ok M-R, et al. Long-term clinical study and multiscale analysis of in vivo biodegradation mechanism of Mg alloy. Proc Natl Acad Sci. 2016;113:716–21.
Jin L, Chen C, Jia G, Li Y, Zhang J, Huang H, et al. The bioeffects of degradable products derived from a biodegradable Mg-based alloy in macrophages via heterophagy. Acta Biomater. 2020;
Zhang J, Hiromoto S, Yamazaki T, Huang H, Jia G, Li H, et al. Macrophage phagocytosis of biomedical Mg alloy degradation products prepared by electrochemical method. Mater Sci Eng C. 2017;75:1178–83.
Maradze D, Musson D, Zheng Y, Cornish J, Lewis M, Liu Y. High Magnesium Corrosion Rate has an Effect on Osteoclast and Mesenchymal Stem Cell Role During Bone Remodelling. Sci Rep. 2018;8:10003.
Yip KHM, Zheng MH, Feng HT, Steer JH, Joyce DA, Xu J. Sesquiterpene Lactone Parthenolide Blocks Lipopolysaccharide-Induced Osteolysis Through the Suppression of NF-κB Activity. J Bone Miner Res. 2004;19:1905–16.
Li C, Guo C, Fitzpatrick V, Ibrahim A, Zwierstra MJ, Hanna P, et al. Design of biodegradable, implantable devices towards clinical translation. Nat Rev Mater. 2020;5:61–81.
Wang J-L, Xu J-K, Hopkins C, Chow DH-K, Qin L. Biodegradable Magnesium-Based Implants in Orthopedics—A General Review and Perspectives. Adv Sci. 2020;1902443.
Choo JT, Lai SHS, Tang CQY, Thevendran G. Magnesium-based bioabsorbable screw fixation for hallux valgus surgery – A suitable alternative to metallic implants. Foot Ankle Surg. 2019;25:727–32.
Zhao D, Witte F, Lu F, Wang J, Li J, Qin L. Current status on clinical applications of magnesium-based orthopaedic implants: A review from clinical translational perspective. Biomaterials. 2017;112:287–302.
Berglund IS, Jacobs BY, Allen KD, Kim SE, Pozzi A, Allen JB, et al. Peri-implant tissue response and biodegradation performance of a Mg–1.0Ca–0.5Sr alloy in rat tibia. Mater Sci Eng C. 2016;62:79–85.
Diekmann J, Bauer S, Weizbauer A, Willbold E, Windhagen H, Helmecke P, et al. Examination of a biodegradable magnesium screw for the reconstruction of the anterior cruciate ligament: A pilot in vivo study in rabbits. Mater Sci Eng C. 2016;59:1100–9.
Kim BJ, Piao Y, Wufuer M, Son W-C, Choi TH. Biocompatibility and Efficiency of Biodegradable Magnesium-Based Plates and Screws in the Facial Fracture Model of Beagles. J Oral Maxillofac Surg. 2018;76:1055.e1-1055.e9.
Bondarenko A, Angrisani N, Meyer-Lindenberg A, Seitz JM, Waizy H, Reifenrath J. Magnesium-based bone implants: Immunohistochemical analysis of peri-implant osteogenesis by evaluation of osteopontin and osteocalcin expression: Magnesium-Based Bone Implants. J Biomed Mater Res A. 2014;102:1449–57.
Qiao W, Wong KHM, Shen J, Wang W, Wu J, Li J, et al. TRPM7 kinase-mediated immunomodulation in macrophage plays a central role in magnesium ion-induced bone regeneration. Nat Commun. 2021;12:2885.
Christiansen RJ, Münch HJ, Bonefeld CM, Thyssen JP, Sloth JJ, Geisler C, et al. Cytokine Profile in Patients with Aseptic Loosening of Total Hip Replacements and Its Relation to Metal Release and Metal Allergy. J Clin Med. Multidisciplinary Digital Publishing Institute; 2019;8:1259.
Zhang L, Haddouti E-M, Welle K, Burger C, Wirtz DC, Schildberg FA, et al. The Effects of Biomaterial Implant Wear Debris on Osteoblasts. Front Cell Dev Biol. 2020;8:352.
Klinder A, Seyfarth A, Hansmann D, Bader R, Jonitz-Heincke A. Inflammatory Response of Human Peripheral Blood Mononuclear Cells and Osteoblasts Incubated With Metallic and Ceramic Submicron Particles. Front Immunol. 2018;9:831.
Gibon E, Amanatullah DF, Loi F, Pajarinen J, Nabeshima A, Yao Z, et al. The biological response to orthopaedic implants for joint replacement: Part I: Metals: BIOCOMPATIBILITY OF ORTHOPAEDIC IMPLANTS. J Biomed Mater Res B Appl Biomater. 2017;105:2162–73.
Gonzalez J, Hou RQ, Nidadavolu EPS, Willumeit-Römer R, Feyerabend F. Magnesium degradation under physiological conditions – Best practice. Bioact Mater. 2018;3:174–85.
Hallab NJ, Jacobs JJ. Biologic Effects of Implant Debris. Bull NYU Hosp Jt Dis. 2009;67:182–8.
Zhao Z, Li G, Ruan H, Chen K, Cai Z, Lu G, et al. Capturing Magnesium Ions via Microfluidic Hydrogel Microspheres for Promoting Cancellous Bone Regeneration. ACS Nano. 2021;acsnano.1c02147.
Zhai Z, Qu X, Li H, Yang K, Wan P, Tan L, et al. The effect of metallic magnesium degradation products on osteoclast-induced osteolysis and attenuation of NF-κB and NFATc1 signaling. Biomaterials. 2014;35:6299–310.
Arnett TR. Extracellular pH Regulates Bone Cell Function. J Nutr. 2008;138:415S-418S.
Lin T, Tamaki Y, Pajarinen J, Waters HA, Woo DK, Yao Z, et al. Chronic inflammation in biomaterial-induced periprosthetic osteolysis: NF-κB as a therapeutic target. Acta Biomater. 2014;10:1–10.
Guo C, Li J, She C, Shao X, Teng B, Feng J, et al. Bioeffects of micron-size magnesium particles on inflammatory cells and bone turnover in vivo and in vitro: Bioeffects of Mg Particles on Inflammatory Cells and Bone Turnover. J Biomed Mater Res B Appl Biomater. 2016;104:923–31.
Roth I, Schumacher S, Basler T, Baumert K, Seitz J-M, Evertz F, et al. Magnesium corrosion particles do not interfere with the immune function of primary human and murine macrophages. Prog Biomater. 2015;4:21–30.

Download PDF

Version 1

posted

You are reading this latest preprint version

Particles Generated from Degrading Magnesium Implants Induce Bone Resorption

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

5. Conclusion

Abbreviations

Declarations

References

Status:

Version 1