CDCA5 is a potent therapeutic target of clear cell renal cell carcinoma

doi:10.21203/rs.3.rs-2101665/v1

Download PDF

Research Article

CDCA5 is a potent therapeutic target of clear cell renal cell carcinoma

https://doi.org/10.21203/rs.3.rs-2101665/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Clear cell renal cell carcinoma (ccRCC) is the most common type of kidney cancer in adult, and patients with advanced ccRCC are facing limited treatment options. Cell division cycle associated 5 (CDCA5), a key regulator for segregating sister chromatids in cell cycle, has been increasingly reported for a potential therapeutic target in multiple human cancers. However, the functional roles of CDCA5 in ccRCC remain uncertain. Here we identified that CDCA5 expression was frequently upregulated in ccRCC tumors and significantly associated with poor prognosis of ccRCC patients. To investigate the role of CDCA5 in ccRCC progression, loss function cell models were established. Knockdown of CDCA5 remarkably suppressed ccRCC cell proliferation and migration ability, and also induced cell apoptosis in vitro. In addition, the significance of CDCA5 in ccRCC was further demonstrated in a mouse xenograft model. Silencing of CDCA5 drastically inhibited in vivo tumorigenicity of ccRCC cells. Mechanically, we identified CDCA5 may cooperate with EEF1A1 to promote the tumorigenic phenotype of ccRCC. Overall, our results revealed the significant functional role of CDCA5 in ccRCC progression, which may pave a way for the development of new treatment strategies for ccRCC treatment.

CACD5

EEF1A1

kidney cancer

clear cell renal cell carcinoma

Clear cell renal cell carcinoma (ccRCC), which deprived from the renal tubular epithelial cells, is the most common type of kidney cancer worldwide[1]. Although surgery can cure most of the localized disease, many patients with metastatic disease are facing limited management options, due to ccRCC inherently resistant to conventional chemotherapy and radiation treatment[2]. In recent two decades, a variety of new therapies have emerged for the treatment of advanced ccRCC, including immune therapies and/or targeted therapies (receptor tyrosine kinase (RTK) or mammalian rapamycin (mTOR))[3]. However, all these therapeutic methods can provide patients with limited long-term benefits, for the reason of acquired drug resistance and severe side effects[4]. Hence, investigations that aim to figure out the exact development mechanisms of ccRCC and try to find new potential antitumor targets are in desperate need for patients with advanced ccRCC.

It is recognized that the inactivation of the von Hippel–Lindau (VHL) tumor suppressor caused by somatic mutations or abnormal epigenetic modifications is the key driving molecular event mediating the occurrence and development of 90% of all ccRCC[5]. Loss-function of VHL leads to the accumulation of hypoxia-inducible factors (HIFs) and its downstream activated hypoxic gene expression is thought to be a major driving force in ccRCC development[6]. However, lots of following studies have found that VHL inactivation alone is not enough to induce cancer progression, indicating additional abnormal molecular events inevitably participate in the genesis and development of ccRCC[7]. To identify the potential molecules involved in carcinogenic pathways, we analyzed the ccRCC mRNA expression data from TCGA (The Cancer Genome Atlas) database, and found that cell division cycle associated 5, (CDCA5) was overexpressed in tumor tissues and may play an important role in ccRCC progression.

CDCA5, also known as Sororin, is a key regulator for segregating sister chromatids in S and G2/M phases of the cell cycle[8]. CDCA5 protein could maintain the cohesion of sister chromatids and ensure accurate chromosome separation during mitosis[9]. CDCA5 can also promote cell proliferation and participate in apoptosis by regulating the function of cell cycle related proteins and transcription factors[10]. As reported, upregulated CDCA5 expression level was found in many types of cancers, including bladder cancer, lung cancer, liver cancer, colorectal cancer, indicating CDCA5 may participate in the development of these diseases[11–14]. However, the functional role of CDCA5 in ccRCC progression remains unclear. In this study, we reported CDCA5 expression was overexpressed in ccRCC samples and patients with higher CDCA5 expression suffered poorer prognosis. Knockdown of CDCA5 inhibits the progression and tumorigenesis ability of ccRCC cells in vitro and in vivo. Mechanically, we identified CDCA5 can cooperate with EEF1A1 to promote the tumorigenic phenotype of ccRCC. Our findings revealed the functional role of CDCA5 in ccRCC progression, indicating CDCA5 and its associated pathway may be a promising therapeutic target for ccRCC treatment.

Primary ccRCC patients and tissue samples

A total of 533 ccRCC patient cohort with ClinicalMatrix and RNA sequencing data (HiSeqV2) were obtained from TCGA data portal. Patients with available prognosis data were selected when analyzing the relationship between CDCA5 expression and ccRCC progression. Besides, 20 paired tumorous and normal pericarcinomatous tissues were conserved in liquid nitrogen, which are collected from different pathological grade (WHO/ISUP 2016 grading system) of ccRCC patients undergoing nephrectomy at the Renji Hospital of Shanghai Jiaotong University. RT-qPCR, Western blot and immunohistochemistry (IHC) staining experiments were successively performed with these tissues. All patients provided written consent, and this study was approved by the Ethics and Research Committees of Renji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China.

Western Blot Analysis

Tissues or tumor cells were lysed with 2% sodium dodecyl sulfate (SDS) and the protein concentration were then measured with BCA protein assay kit. Next, proteins were separated by SDS-PAGE gel and transferred to a nitrocellulose membrane. After blocking, the membrane was incubated with different primary antibodies and secondary antibody (with washing between steps). Finally, the target protein bands were visualized via chemiluminescence system. Primary antibodies CDCA5 (ab192237) and eEF1A1 (ab157455) were obtained from Abcam; β-actin (sc-69879) and GAPDH (sc-32233) were obtained from Santa Cruz. Secondary antibody Rabbit IgG (#7074) and Mouse IgG (#7076) were bought from Cell Signaling Technology.

Immunohistochemistry

Immunohistochemistry was performed on tissue samples according to the standard streptavidin-peroxidase method. Briefly, after fixing, embedding, deparaffinizing, rehydrating and blocking, specimens were incubated with the anti-CDCA5 primary antibody (1:100 dilution) at 4°C overnight. After washing and incubating with biotinylated secondary antibody, the results were finally recorded with a Nikon Eclipse Ti microscope.

Rna Extraction And Rt-pcr

Trizol reagent was used to isolate total RNA from tumor samples and cells, and RNA was converted into cDNA with the cDNA synthesis kit according to the manufacturer’s protocol. Gene mRNA expression level was measured by RT-PCR on an ABI ViiA™ 7 System (Thermo Fisher, Waltham, MA, USA). GAPDH was used as the relative control for analyzing gene expression fold change. Primers used in this study were as follows: for gene CDCA5, forward 5′- CCATCTCCTACTAAGCCTCTGC − 3′ and reverse 5′- GCCACGATCCTCTTTAAGACGAT − 3′; For gene GAPDH, forward 5′- TGACTTCAACAGCGACACCCA − 3′ and reverse 5′- CACCCTGTTGCTGTAGCCAAA − 3′.

Lentiviral Vectors Construction And Transfection

Lentiviral particles were constructed according to the conventional protocol. Briefly, CDCA5 shRNA sequences or scrambled shRNA sequence were integrated into the GV358 backbone plasmid, which was obtained from GENE (Shanghai Genechem Co.,Ltd.). Then, the shRNA plasmid, Helper1.0 plasmid and Helper2.0 plasmid were co-transfected 293T cells. Supernatant of treated 293T cells was collected and filtered at 48-72h after transfection. Besides, the plasmids using Ubi-3FLAG(sigma)-MCS-SV40-puromycin to construct overexpression EEF1A1 lentiviral vectors. Tumor cells were infected with lentiviral particles in the presence of 10 µg/mL Polybrene regent. After treating media with puromycin for 2 weeks, ccRCC cells were collected for subsequent experiments.

Cell Culture And Cell Survival Assay

RCC cell lines 786-O and ACHN were obtained from the ATCC (American Type Culture Collection). 786-O cells were cultured in 1640 media with 10% fetal bovine serum (FBS, Gibco, Australia), and ACHN cells were cultured in MEM media with 10% FBS. All cells were maintained at 37°C with 5% CO2. After treatment, cell survival was determined by MTT assay according to the standard protocol at different time points.

Flow Cytometric Analysis

Cell apoptosis analysis after CDCA5 knockdown was performed by using annexin V and propidium iodide double supravital stain. Briefly, after treatment, cells were collected, fixed, stained and analyzed by flow cytometry. Results were analyzed by using ModFit software according to the manufacturer’s instructions.

Cell Migration Analysis

To investigate the effect of CDCA5 on ccRCC metastasis, cell wound healing and cell transwell migration test were also performed. For cell wound healing assay, cells after treatment were plated in 6-well plates with over 90% confluence, and a sterile 100µL pipette tip was used to scrape across cells. At special time points, cells that migrated into the wounded area were measured by a microscope. For cell transwell migration assay, the special transwell plates were used according the conventional protocol. Briefly, appropriate number of cells were collected and added to the transwell plate, and cells were cultured for 24h. Then, cells were fixed, stained and dried, and five view fields cells number were counted for each samples with a microscope. The mean value was used as the migratory cell number.

Tumor Models

Animal study were approved by the Experimental Animal Ethics Committee of Shanghai Jiao Tong University (Shanghai, China). 4 to 6-week-old female nude mice (BALB/cnu/nu) were used for establishing the ccRCC tumor xenograft models. After infecting with lentiviral particles, around 5×10⁶ ACHN cells were collected and subcutaneously injected into the flank region of mice. When the tumors reached approximately 200 mm³, tumor volumes (V = length×width²/2) and body weights were measured twice a week using a caliper and an iron-balance. At the end of experiments, all the mice were sacrificed and the tumors were harvested, photographed, weighed, and saved in liquid nitrogen.

Lc-ms/ms Analysis

Liquid chromatography–tandem mass spectrometry (LC-MS/MS) analysis was performed to screened out the potential interacting proteins of CDCA5. Firstly, ACHN cells were overexpressed with FLAG-CDCA5, and then cell lysates were collected in lysis buffer on ice. After centrifugation, the supernatants were incubated with an anti-Flag or anti-IgG antibody. Secondly, protein FLAG-beads were added to the supernatants, and proteins were eluted and subjected to SDS-PAGE electrophoresis. After protein digestion and peptide selection, LC-MS analysis was performed with the PD/MASCOT software. Finally, we conducted PPI (protein protein interaction) network analysis to select the potential interacting proteins. Besides, coimmunoprecipitation (Co-IP) experiments were performed to confirm our findings.

Statistical analysis

CDCA5 expression level in different groups were compared by using the student’s t test, and the Kaplan-Meier method with log-rank test was plotted to analyze the overall survival curves. All experiments were performed for over three times, and data were presented as mean ± SD. Significant differences between values obtained from different groups were determined using the two-tailed student’s t-test analysis. All statistical analyses were performed using Graphpad Prism 7.0, and P < 0.05 was considered statistically significant.

Upregulated CDCA5 expression correlates with the progression of ccRCC patients

In order to identify the potential therapeutic targeted genes for ccRCC treatment, we analyzed the data of renal clear cell carcinoma (KIRC) from TCGA database. A gene list which is highly expressed in tumor tissues and the upregulated expression is related to the poor prognosis of ccRCC patients were selected for further investigation. Based on literature research, we noticed that one of the key gene, CDCA5, has been well implicated in the progression of various types of cancers, while its role in ccRCC remains unclear. In TCGA database, we found CDCA5 expression level was upregulated in ccRCC tumor tissues, and correlated with the progression and prognosis of ccRCC patients (Fig. 1A-D).

Furthermore, RT-qPCR experiments were performed with 10 pairs of ccRCC tumor tissues and paired normal tissues, as well as ccRCC cell lines (Caki-1, 786-O, ACHN) and the normal kidney cell line 293T. The results showed that CDCA5 expression level was increased in 7 of 10 (70%) tumor tissues, and upregulated in all ccRCC tumor cell lines, compared to normal tissues and kidney cell line (Figure S1A-B). The enhanced expression of CDCA5 was also confirmed by WB experiments with another 10 pairs of ccRCC tissues (Fig. 1E-F). Besides, IHC analysis was performed in different grade tumor tissues (n = 12) to further investigate its clinical relevance in ccRCC. Results consistently revealed that CDCA5 expression level was positively related to ccRCC progression, and CDCA5 expression level was significantly upregulated with increased pathological grade (Fig. 1G). These findings together suggest that CDCA5 expression is upregulated in ccRCC, and significantly associated with ccRCC progression.

Knockdown of CDCA5 inhibits proliferation and migration ability of ccRCC cells in vitro

To further investigate the functional role of CDCA5 in ccRCC progression, CDCA5-specific shRNAs was designed to knockdown CDCA5 in 786-O and ACHN cells. RT-PCR and WB experiments results indicated that ccRCC cell infected with CDCA5-specific shRNAs presented a significantly decreased mRNA and protein expression level of CDCA5 (Fig. 2A-B). Cell proliferation ability was further evaluated after CDCA5 knockdown, and the results demonstrated knockdown of CDCA5 significantly attenuated cell proliferation of ccRCC cells (Fig. 2C-E). Moreover, annexin V and propidium iodide staining was also performed to evaluated cell apoptosis. Results indicated knockdown of CDCA5 could induce apoptosis of 786-O and ACHN cells (Figure S2A-B). We next determined to confirm our findings by exploring the Caspase3/7 activity, and we found that the Caspase3/7 activity was significant increased after CDCA5 knockdown (Figure S2C).

Furthermore, cell wound healing and migration ability of ccRCC cells were also evaluated to investigate the effect of CDCA5 on tumor metastasis. We found that CDCA5 knockdown inhibited both cell wound healing and migration ability of 786-O and ACHN cells (Fig. 2F-I). Taken together, our data suggested that CDCA5 plays a critical role in the proliferation and migration ability of ccRCC cells in vitro.

CDCA5 Knockdown markedly inhibited ccRCC tumor growth in vivo.

After exploring the tumorigenic role of CDCA5 in ccRCC in vitro, the oncogenic function of CDCA5 in ccRCC in vivo was also evaluted by ACHN cell subcutaneously xenograft models (CDX). CDCA5 knockdown (KD) and normal control (NC) ccRCC cells were injected into nude mice, and tumor growth was monitored twice on week. We found that CDCA5 KD group showed a significantly reduced tumor size, compared to the NC group, as shown by the bioluminescence and tumor size after harvested (Fig. 3A-D and Figure S3A-B). Our in vivo data consistently confirmed our findings in vitro, which strengthened the oncogenic function of CDCA5 in ccRCC progression.

Cdca5 Cooperated With Eef1a1 To Promote The Tumorigenic Phenotype

To further investigate the molecular mechanism that might be involved in mediating the tumorigenic role of CDCA5 in ccRCC, we overexpressed FLAG-CDCA5 in ACHN cell line (Fig. 4A). Firstly, LC-MS/MS experiment was performed to identify the potential interacting proteins of CDCA5 in ccRCC progression, and further PPI analysis results indicated 5 proteins, including EEF1A1, NME1, SSBP1, XRCC6, MAP2K1, may be the candidates interacting proteins of CDCA5 (Fig. 4B-C). Then, endogenous EEF1A1 was immunoprecipitated with an anti-FLAG antibody from cell lysates of ACHN cells, indicating that CDCA5 may cooperated with EEF1A1 to play its oncogenic role in ccRCC progression (Fig. 4D). We also examined the expression of EEF1A1 following CDCA5 knockdown in both 786-O and ACHN cells and found that knockdown of CDCA5 did not impact the expression of EEF1A1, indicating EEF1A1 is not the downstream target of CDCA5 in ccRCC (Fig. 4E).

Furthermore, the rescue experiments were subsequently performed to investigate whether EEF1A1 is the functional interacting protein of CDCA5. The results showed that overexpressed expression of EEF1A1 rescued the suppression of the proliferation and migration of ccRCC cells caused by CDCA5 knockdown (Fig. 5A-E). Taken together, these data strongly suggest that CDCA5 cooperates with EEF1A1 to promote the tumorigenic phenotype in ccRCC.

Currently, the mechanism underlying the tumorigenesis of ccRCC remains elusive, and management for ccRCC patients with metastatic disease limited to tyrosine kinase inhibitor (TKI) therapies and immune checkpoint inhibitors therapies[15]. TKI therapies show an amazing antitumor effect, which has been approved as the first-line therapy for advanced ccRCC patients[16]. Besides, immune checkpoint inhibitors, including PD-1/PDL-1 and CTLA-4 antibodies, have also emerged as the promising therapeutic options for ccRCC patients[17]. However, none of these therapies have an efficient sustained therapeutic effect, mainly due to the acquired drug resistance, tumor heterogeneity and severe side effects[18]. Therefore, exploring new therapeutic target is in urgent need for advanced ccRCC treatment. In this study, data-mining across TCGA database and tumor tissues detection found that CDCA5 expression is upregulated in ccRCC, and patients with high CDCA5 expression may have an aggressive disease progression, indicating CDCA5 may be a promising therapeutic target for RCC clinical therapy.

Cell cycle disruption is a common biological hallmark of cancers, and it can result in diminished apoptosis, unrestricted proliferation, and metastasis in tumor cells[19, 20]. Aberrant functions of many cell cycle-associated genes are identified in cancer development, which may be potential therapeutic targets for cancer treatment[21, 22]. CDCA5 is a member of cell cycle-associated genes, whose major function is to assist the sister chromatid binding and accurate segregation in order to preserve genomic integrity. Functionally, CDCA5 can stable bind the chromatids during S and G2/M cell cycle phases, and also participate in maintaining the stability of DNA strands[8]. Additionally, a growing body of studies have reported that CDCA5 plays a crucial role in the progression of several types of cancers. However, whether CDCA5 participates in the tumorigenesis and evolution of ccRCC is yet to be elucidated. Herein, we reported CDCA5 is essential for the proliferation and migration ability of ccRCC cells. Moreover, silencing of CDCA5 significantly induced tumor cell apoptosis, and the activity of Caspase3/7 were significant increased. Therefore, our findings demonstrated that targeting CDCA5 may be a novel therapeutic method for ccRCC treatment.

Although CDCA5 is gradually recognized as an oncogene in many malignancies, the exact mechanism of CDCA5 promotes the progression of cancers is still blurred. Chen H et al reported that CDCA5 could enhance tumor cell proliferation and inhibit cell apoptosis by activating the AKT pathway in hepatocellular carcinoma[23]. Ji J and his colleagues found that MAPK/ERK pathway might be the downstream signal pathway of CDCA5 in prostate cancer[24]. Moreover, CDCA5 cooperates with other key factor to play its functional roles has been identified in cancers. CDCA5 is demonstrated to co-expressed with cyclin-dependent kinase 1 (CDK1) enhances tumor cell proliferation, migration, and invasion abilities in gastric cancer[25]. Similar with this finding, by using a combinatory approach of LC-MS/MS analysis and Co-IP confirmation, we showed CDCA5 may cooperated with EEF1A1 to play its oncogenic role in ccRCC progression. Our results indicate that the oncogenic function of CDCA5 may have inter-tumor heterogeneity among cancers, and our findings provided new clues on the genesis of ccRCC.

Protein synthesis in eukaryotic cell mainly involves three steps: initiation, elongation and termination, and a series of regulators participate in the precise regulation of each step[26]. Among these, EEF1A1 belongs to a member of eukaryotic elongation factor family that regulates the peptide elongation during mRNA translation[27]. Aside from its canonical function in peptide elongation, EEF1A1 has also been implicated in many biological cellular processes, especially in the progression of cancers. Li and his colleagues revealed that EEF1A1 binding with PAK4 to promote the development of gastric cancer[28]. EEF1A1 can also regulate the cell apoptosis and cell cycle process in tumor cells[29]. In the present study, we discovered EEF1A1 is the interacting protein of CDCA5, and expression of exogenous EEF1A1 could rescue the suppression of the proliferation and migration ability of ccRCC cells caused by CDCA5 knockdown. Therefore, the signaling downstream of CDCA5 and EEF1A1 in ccRCC requires further investigation.

In summary, we demonstrated CDCA5 function as a tumor-promoting factor in ccRCC. Mechanically, CDCA5 facilitates the tumorigenic phenotype of ccRCC via coordinating with EEF1A1. These results indicated that CDCA5 may be a promising therapeutic target for ccRCC treatment.

Ethics approval and consent to participate: Our study and animal studies were approved by the institutional review board of Renji Hospital affiliated to Shanghai Jiaotong University School of Medicine, and the requirement for informed consent was waived.

Consent publication: Not applicable

Availability of data and materials: The datasets used and analysed during the current study available from the corresponding author on reasonable request.

Competing interests: The authors declare that they have no competing interests.

Funding: Not applicable

Authors’ contributions: XW analyzed and interpreted the data and was a major contributor in writing the manuscript. JL, QL performed the experiments and analyzed the data. JZ and WK performed the histological examination of the specimens. YH, WX as the operating surgeons collected the specimens. FY, JH designed this study. All authors read and approved the final manuscript.

Acknowledgements: Not applicable.

Siegel, R.L. and K.D. Miller, Cancer statistics, 2022. 2022. 72(1): p. 7–33.
Capitanio, U. and F. Montorsi, Renal cancer. Lancet, 2016. 387(10021): p. 894–906.
Kasherman, L. and D.H.W. Siu, Angiogenesis Inhibitors and Immunomodulation in Renal Cell Cancers: The Past, Present, and Future. 2022. 14(6).
Ballesteros, P., J. Chamorro, and M.S. Román-Gil, Molecular Mechanisms of Resistance to Immunotherapy and Antiangiogenic Treatments in Clear Cell Renal Cell Carcinoma. 2021. 13(23).
Shulman, M., R. Shi, and Q. Zhang, Von Hippel-Lindau tumor suppressor pathways & corresponding therapeutics in kidney cancer. J Genet Genomics, 2021. 48(7): p. 552–559.
Kim, H., et al., Loss of Von Hippel-Lindau (VHL) Tumor Suppressor Gene Function: VHL-HIF Pathway and Advances in Treatments for Metastatic Renal Cell Carcinoma (RCC). 2021. 22(18).
Jonasch, E., C.L. Walker, and W.K. Rathmell, Clear cell renal cell carcinoma ontogeny and mechanisms of lethality. 2021. 17(4): p. 245–261.
Zhang, N. and D. Pati, Sororin is a master regulator of sister chromatid cohesion and separation. Cell Cycle, 2012. 11(11): p. 2073-83.
Jordan, P.W., et al., Sororin is enriched at the central region of synapsed meiotic chromosomes. 2017. 25(2): p. 115–128.
Chong, Y. and L. Xue, Downregulation of CDCA5 Can Inhibit Cell Proliferation, Migration, and Invasion, and Induce Apoptosis of Prostate Cancer Cells. Crit Rev Eukaryot Gene Expr, 2021. 31(1): p. 29–40.
Fu, G., et al., CDCA5 functions as a tumor promoter in bladder cancer by dysregulating mitochondria-mediated apoptosis, cell cycle regulation and PI3k/AKT/mTOR pathway activation. J Cancer, 2020. 11(9): p. 2408–2420.
Shen, W., et al., Silencing oncogene cell division cycle associated 5 induces apoptosis and G1 phase arrest of non-small cell lung cancer cells via p53-p21 signaling pathway. 2022. 36(5): p. e24396.
Hou, S., et al., Higher expression of cell division cycle-associated protein 5 predicts poorer survival outcomes in hepatocellular carcinoma. Aging (Albany NY), 2020. 12(14): p. 14542–14555.
Shen, A., et al., Cell division cycle associated 5 promotes colorectal cancer progression by activating the ERK signaling pathway. Oncogenesis, 2019. 8(3): p. 19.
Serzan, M.T. and M.B. Atkins, Current and emerging therapies for first line treatment of metastatic clear cell renal cell carcinoma. J Cancer Metastasis Treat, 2021. 7.
Bosma, N.A., et al., Efficacy and Safety of First-line Systemic Therapy for Metastatic Renal Cell Carcinoma: A Systematic Review and Network Meta-analysis. Eur Urol Open Sci, 2022. 37: p. 14–26.
Kim, M.C., et al., Updates on Immunotherapy and Immune Landscape in Renal Clear Cell Carcinoma. 2021. 13(22).
McKay, R.R., D. Bossé, and T.K. Choueiri, Evolving Systemic Treatment Landscape for Patients With Advanced Renal Cell Carcinoma. J Clin Oncol, 2018: p. Jco2018790253.
Boeynaems, S., P. Tompa, and L. Van Den Bosch, Phasing in on the cell cycle. Cell Div, 2018. 13: p. 1.
López-Lázaro, M., The stem cell division theory of cancer. Crit Rev Oncol Hematol, 2018. 123: p. 95–113.
Yoshida, K. and A. Yokoi, Aberrant Activation of Cell-Cycle-Related Kinases and the Potential Therapeutic Impact of PLK1 or CHEK1 Inhibition in Uterine Leiomyosarcoma. 2022. 28(10): p. 2147–2159.
Yang, Y., S. Zhang, and L. Guo, Characterization of Cell Cycle-Related Competing Endogenous RNAs Using Robust Rank Aggregation as Prognostic Biomarker in Lung Adenocarcinoma. Clin Cancer Res, 2022. 12: p. 807367.
Chen, H., et al., CDCA5, Transcribed by E2F1, Promotes Oncogenesis by Enhancing Cell Proliferation and Inhibiting Apoptosis via the AKT Pathway in Hepatocellular Carcinoma. J Cancer, 2019. 10(8): p. 1846–1854.
Ji, J., et al., CDCA5 promotes the progression of prostate cancer by affecting the ERK signalling pathway. Oncol Rep, 2021. 45(3): p. 921–932.
Huang, Z., et al., Cyclin-Dependent Kinase 1 (CDK1) is Co-Expressed with CDCA5: Their Functions in Gastric Cancer Cell Line MGC-803. Med Sci Monit, 2020. 26: p. e923664.
Sasikumar, A.N., W.B. Perez, and T.G. Kinzy, The many roles of the eukaryotic elongation factor 1 complex. Wiley Interdiscip Rev RNA, 2012. 3(4): p. 543 − 55.
Li, D., et al., The unexpected roles of eukaryotic translation elongation factors in RNA virus replication and pathogenesis. Microbiol Mol Biol Rev, 2013. 77(2): p. 253 − 66.
Li, X., J. Li, and F. Li, P21 activated kinase 4 binds translation elongation factor eEF1A1 to promote gastric cancer cell migration and invasion. Oncol Rep, 2017. 37(5): p. 2857–2864.
Chen, S.L., et al., eEF1A1 Overexpression Enhances Tumor Progression and Indicates Poor Prognosis in Hepatocellular Carcinoma. Transl Oncol, 2018. 11(1): p. 125–131.

No competing interests reported.

originalblotdata.pptx
SFig1.png
Figure S1. (A) RT-qPCR experiments were performed to evaluate CDCA5 mRNA level in 10 pairs of ccRCC tumor tissues and normal tissues. (B) CDCA5 mRNA levels were determined in ccRCC cells (Caki-1, 786-O, ACHN) and nomal kidney cells (293-T). ***P < 0.001.
SFig2.png
Figure S2. (A-C) Annexin V and propidium iodide staining was performed to evaluated cell apoptosis of CDCA5 silenced ccRCC cells. **P < 0.01 and ***P < 0.001.
SFig3.png
Figure S3. (A) Tumor weights were expressed as mean ± SD in different groups, N=6 for each group. (B) Body weight of mice in NC and KD group was shown after cells were transplanted into nude mice. ***P < 0.001.

Download PDF

Version 1

posted

You are reading this latest preprint version

CDCA5 is a potent therapeutic target of clear cell renal cell carcinoma

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Primary ccRCC patients and tissue samples

Western Blot Analysis

Immunohistochemistry

Rna Extraction And Rt-pcr

Lentiviral Vectors Construction And Transfection

Cell Culture And Cell Survival Assay

Flow Cytometric Analysis

Cell Migration Analysis

Tumor Models

Lc-ms/ms Analysis

Statistical analysis

Results

Upregulated CDCA5 expression correlates with the progression of ccRCC patients

Cdca5 Cooperated With Eef1a1 To Promote The Tumorigenic Phenotype

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1