Animals
Mice were generated according to the breeding scheme used in (20). In brief, C57BL/6N.16p11.2 Del/+ females were bred with sighted C3H/HeH (C3B) males (50) (16p11.2+/+) to obtain F1 C57BL/6N x C3B.16p11.2 Del/+ (hereafter Del/+) and F1 C57BL/6N x C3B.16p11.2 +/+ (hereafter WT) mice. The cohort included 24 males (12 WT and 12 Del/+) and 32 females (16 WT and 16 Del/+). Animals were grouped in cages of four animals at weaning (quartets: 2 WT and 2 Del/+), therefore leading to 6 cages of males and 8 cages of females. In addition, for paired social encounters, we added two pairs of Del/+ females of the same age and housed in similar conditions. All mice were housed under 21–23°C with 12h/12h light/dark cycle (lights on at 7:00 AM). Hemp squares, food and water were available ad libitum. All mice were weighted at 11 weeks.
Individual identification
Mice were identified through finger cuts realised between 2 and 7 post-natal days. Genotyping was conducted on these finger biopsies according to the protocol described in (20). In brief, DNA was extracted in NaCl. PCR reaction used the primers Del70 F (CCTGTGTGTATTCTCAGCCTCAGGATG) and primer Del71 R (GGACACACAGGAGAGCTATCCAGGTC) with the following cycles: one cycle of 4 min at 95°C, 35 cycles of 30°C at 94°C + 30 s at 62°C + 1 min at 72°C, one cycle of 7 min at 72°C.
At least two weeks before starting the recordings, we inserted a Radio Frequency IDentification (RFID) tag (APT12 PIT tags; Biomark, Inc., Boise, The United States of America) under the skin of each individual under gas anaesthesia (Isoflurane) with local analgesia (Lidor 20 mg/ml, with 40 ul/10 g mouse). RFID tags were located in the lower part of the left flank. Mice were allowed to recover for one week. They were manipulated three days before starting the behavioural experiments to get them used to the experimenters and to being held within a cup. Mice were habituated to the experimental room and the setup since they underwent the novel object recognition test (data not presented) in the same room and setup at least one week before the quartet recordings. They underwent the dyadic encounters at least one week after the quartet recordings, and were therefore also familiar with the experimental room.
Behavioural monitoring in quartets
We monitored the individual and social behaviours of each quartet of mice over three days and nights in the Live Mouse Tracker system (LMT, plugin 931; (34)). This system tracks individually mice living in a group over several days and nights and extracts automatically the number, total duration and mean duration of more than thirty behavioural events describing the posture of the mouse, the types of social contacts, the dynamic social approach and escapes and complex social groupings (see (34)). In this system, the four mice (10–14 weeks of age) of each housing cage were left undisturbed for 71 hours in a large transparent Plexiglas cage (50 x 50 x 40 cm), with fresh bedding, a house (width: 100 mm, depth: 75 mm, height: 40 mm) in red Plexiglas, 6 dental cotton rolls as well as food and water ad libitum. Light/dark cycle and temperature conditions were similar to those of the housing room (12/12h light/dark, lights on at 07:00 AM, 75–90 lux when the lights were on). Each recording session started between 03:00 and 04:00 PM. At the end of the session, mice were placed back in their home cage and the LMT setup was cleaned with soap water and dried with paper towels. Altogether, we recorded the six cages of males and the eight cages of females, keeping the animals with their familiar cage mates. For each individual, we extracted the total distance travelled. We also automatically recorded the following behavioural events (based on the original publication of LMT (34); the type of quantification extracted is indicated in brackets):
Single move
The focal animal is moving (speed > 5 m/s) without being in contact with any other animal (total duration, number of events, mean duration of events).
Move in contact
The focal animal is moving (speed > 5 m/s) while being in contact with another animal (total duration, number of events, mean duration of events).
Jumps
The focal animal is jumping against the wall (total duration, number of events, mean duration of events).
Single idle
The focal animal is resting (not moving) without being in contact with any other animal (total duration, number of events, mean duration of events).
Rearing
The focal animal is straightened on its hindlegs (either unsupported or against the wall). Rearing is considered when the body slope is higher than a threshold (total duration, number of events, mean duration of events).
Rearing in contact
The focal animal is straightened on its hindlegs (either unsupported or against the wall) while being in contact with another individual. Rearing is considered when the body slope is higher than a threshold (total duration, number of events, mean duration of events).
Contact
The focal animal is touching another individual (total duration, number of events, mean duration of events).
Group of 2
The focal animal is touching one and only one other individual (total duration, number of events, mean duration of events).
Group of 3
The focal animal is touching two and only two other individuals (total duration, number of events, mean duration of events).
Nose-nose
The focal animal is sniffing the nose of another animal (i.e., the nose is at a whisker distance from the nose of the other animal) (total duration, number of events, mean duration of events).
Nose-anogenital
The focal animal is sniffing the ano-genital region of another animal (i.e., the nose is at a whisker distance from the tail basis of the other animal) (total duration, number of events, mean duration of events).
Side-side
The flank of the focal animal is in contact with the flank of another animal; both animals head in the same direction (total duration, number of events, mean duration of events).
Side-side head-to-tail
The flank of the focal animal is in contact with the flank of another animal; both animals head in opposite directions (total duration, number of events, mean duration of events).
Train2
The focal animal is moving (speed > 5 m/s) while sniffing the ano-genital region of another animal also moving (total duration, number of events, mean duration of events).
Follow: The focal animal is walking in the path of another individual: the two animals are moving at a speed > 5 cm/s, the angles between the two animals are less than 45° apart, and the mass centre of the follower (the focal animal) is within a follow zone of one mean body length of width and two mean body lengths of length (total duration, number of events, mean duration of events).
Approach contact
The focal animal gets closer to another one, with the approaching animal walking at a higher speed than the approached animal; the approach ends by a contact between the two animals (total duration, number of events, mean duration of events).
Make group3
The focal animal is joining a group of two animals to form a group of three animals in contact (number of events).
Make group4
The focal animal is joining a group of three animals to form a group of four animals in contact (number of events).
Break contact
The focal animal is getting away (higher speed) from the animal it has been in contact with; the speed of the focal animal is higher than the speed of the other animal (number of events).
Break group3
The focal animal is leaving a group of three animals to leave a group of two animals in contact; the focal animal has the highest speed among the three animals in contact (number of events).
Break group4
The focal animal is leaving a group of four animals, that remain as a group of three animals in contact; the focal animal has the highest speed among the four animals in contact (number of events).
For social events, we computed the variables either in general or separately according to the identity of the interacting individual. These behaviours are not exclusive: one animal can be involved in several of them simultaneously.
Social encounter between unfamiliar individuals in pairs
We evaluated the social interactions and communication between unfamiliar individuals in pairs. For these recordings of social behaviour and ultrasonic communication, we focused on pairs of individuals since we currently cannot identify the emitter of USVs when animals were interacting closely. Therefore, we recorded undisturbed dyadic interactions between two unfamiliar individuals (from two different housing cages) of the same age (14–20 weeks of age) and genotype for 47h (two days and nights, starting between 03:00 and 04:00 PM). For that purpose, we coupled the LMT system (plugin 931) with one CM16/CMPA microphone (Avisoft Bioacoustics, Glienecke, Germany) connected to the Avisoft Ultrasound Gate 416 (300 kHz sampling rate, 16-bit format; trigger: level of this channel; pre-trigger: 1 s; hold time: 1 s; duration > 0.005 s; trigger event: 2% energy in 25–125 kHz with entropy < 50%; Avisoft Bioacoustics, Glienecke, Germany). LMT and Avisoft systems were synchronised based on the protocol described in (24). Altogether, we recorded eight pairs of WT females and ten pairs of Del/+ females. We focused on females since males were too aggressive toward each other when they were taken out of their housing group to conduct robust (and safe) social monitoring. We recorded the same behaviours as in quartets recordings, except those involving more than two animals. USVs were analysed using LMT – USV Toolbox (24).
Transitions between exclusive behavioural events
To investigate the transitions between two events in paired encounters, we needed to compute exclusive events, i.e., events that do not overlap in time for each individual. For that purpose, we split the existing overlapping events in more simple events that were not overlapping in time to obtain new exclusive events (script ComputeTransitionsBetweenEvents.py). We obtained the following exclusive events:
Move
The focal animal is moving (speed > 5 m/s) without being in contact with any other animal.
Idle
The focal animal is resting (not moving) without being in contact with any other animal.
Nose-nose
The focal animal is sniffing the nose of another animal (i.e., the nose is at a whisker distance from the nose of the other animal).
Nose-anogenital
The focal animal is sniffing the ano-genital region of another animal (i.e., the nose is at a whisker distance from the tail basis of the other animal).
Passive nose-anogenital
The focal animal is being sniffed in the ano-genital region by another animal (i.e., the nose is at a whisker distance from the tail basis of the focal animal).
Side-side
The flank of the focal animal is in contact with the flank of another animal; both animals head in the same direction.
Side-side head-to-tail
The flank of the focal animal is in contact with the flank of another animal; both animals head in opposite directions.
Nose-nose & Side-side
The focal animal is sniffing the nose of the other animal during a side-side contact with this same animal.
Nose-anogenital & side-side head-to-tail
The focal animal is sniffing the ano-genital region of the other animal during a side-side head-to-tail contact with this same animal.
Passive nose-anogenital & side-side head-to-tail
The focal animal is being sniffed in the ano-genital region by the other animal during a side-side head-to-tail contact with this same animal.
Other contact
The focal animal is in contact with another animal and this type of contact is not one of the above described ones (i.e., nose-nose, nose-anogenital, side-side, side-side head-to-tail, nose-nose & side-side, or nose-anogenital & side-side head-to-tail).
Undetected
The focal animal is not detected (tracking issues). This event was needed to have each animal engaged in one event at each time frame.
We computed the proportion of transitions ‘A to B’ from one event (event A) to another (event B) by dividing the number of transitions ‘A to B’ by the total number of occurrences of event A. This was conducted for each individual separately, as each individual was involved in one and only one event at each moment.
Statistical analyses
We did not exclude any outlier. For the behavioural profiles computed in quartets, we centred and reduced data of the Del/+ mice per cage (i.e., per quartet) and compared these z-score values for each Del/+ individual to 0 using Student’s one-sample T tests (ttest_1samp() function from the SciPy 1.8.0 package of Python 3.8). Given the small sample sizes of our data for social behaviours at the pair level (e.g., contact, nose-nose contact, side-side contact, side-side head-to-tail, total number of USVs) in encounters between unfamiliar individuals, we used non-parametric Mann-Whitney U tests from the SciPy 1.8.0 package of Python 3.8. For behaviours in quartet monitoring and at the individual level during paired encounters (e.g., activity, exploration, asymmetric social events), and acoustic features of USVs and USV sequences, we used linear mixed models (mixedlm() function from the statsmodels 0.13.2 package in Python 3.8), with genotype as fixed factor and cage as random factor. Proportion of transitions between exclusive behavioural events were compared at the individual level between genotypes using Mann-Whitney U-tests from the SciPy 1.8.0 package of Python (3.8). In this case, P-values were corrected by the number of tests conducted (12*11) and effect size was estimated using the Cohen’s D indicator. All scripts are available (github link available after publication).