β-glucan alleviates goal-directed behavior in mice infected with Toxoplasma gondii

doi:10.21203/rs.3.rs-2109273/v1

Download PDF

Research Article

β-glucan alleviates goal-directed behavior in mice infected with Toxoplasma gondii

https://doi.org/10.21203/rs.3.rs-2109273/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 13 Feb, 2023

Read the published version in Parasites & Vectors →

You are reading this latest preprint version

Background

Toxoplasma gondii (T. gondii) is a neuroinvasive parasite causing neuroinflammation, which is associated with a higher risk for several psycho-behavioral disorders. There is an urgent need to identify drugs capable of improving cognitive deficits induced by T. gondii infection. (1, 3)/(1, 6)-β-glucan, an active ingredient in mushrooms, could significantly enhance immunity. However, the effects of β-glucan against neuroinflammation and cognitive decline induced by T. gondiiinfection remain unknown. The present study aimed to investigate the neuroprotective effect of β-glucan on goal-directed behavior of mice chronically infected by T. gondii Wh6 strain.

Methods

A mice model of chronic T. gondii Wh6 infection was established by gavage of 10 cysts. Intraperitoneal injection of β-glucan was manipulated two weeks before T. gondiiinfection. Y-maze test and temporal order memory (TOM) test were performed to assess the goal-directed behavior. Golgi-Cox staining, transmission electron microscopy, immunofluorescence, Real-Time PCR and western blot assays were used to detect prefrontal cortex-associated pathological change and neuroinflammation.

Results

We reported that administration of β-glucan significantly prevented T. gondii Wh6-induced goal-directed behavioral impairment assessed behaviorally by Y-maze test and TOM test. In the prefrontal cortex, β-glucan could counter T. gondii Wh6 -induced degeneration of neurites, impairment of synaptic ultrastructure, and decrease of pre- and postsynaptic protein levels. Also, β-glucan significantly prevented the hyperactivation of pro-inflammatory microglia and astrocytes, as well as the upregulation of proinflammatory cytokines caused by chronic T. gondii Wh6 infection.

Conclusion

This study revealed that β-glucan prevents goal-directed behavioral impairment induced by chronic T. gondii infection in mice. These findings suggested that β-glucan may be an effective drug candidate to prevent T. gondii-associated psycho-behavioral disorders including goal-directed behavioral injury.

Toxoplasma gondii

β-glucan

prefrontal cortex

cognitive impairment

neuroinflammation

Toxoplasma gondii (T. gondii) is a central nervous system (CNS)-tropic protozoan parasite with a broad host range that infects nearly 30% of the persons globally [1]. Upon infecting host, T. gondii transforms into the replicative stage, spreads to the whole body, then quickly converts into the quiescent stage that forms cysts in host tissues, especially large accumulation in neurons of CNS, establishing chronic infection for life. Generally, chronic T. gondii infections are asymptomatic [2]. However, compelling evidence links chronic T. gondii infection with psycho-behavioral disorders, such as Alzheimer's disease (AD), and Parkinson's disease (PD), characterized by cognitive dysfunction [3, 4]. For example, it has been reported that seropositive individuals infected with T. gondii exhibit subclinical alteration of behavior and a higher risk of PD [5]. Another study reported that mice suffering from toxoplasmosis exhibit signs of AD [6]. Notably, previous efforts to ameliorate behavioral alterations caused by T. gondii infection have been failed. Therefore, it is urgent to identify therapeutic strategy for psycho-behavioral disorders induced by T. gondii.

The prefrontal cortex (PFC), covering the anterior end of the brain, is an important brain region for regulating goal-directed behavior [7, 8, 9]. It is known that many psycho-behavioral disorders have certain degrees of damage in the PFC [10, 11]. Notably, in a recent randomized controlled trial, elderly T. gondii seropositive individuals have shown delaying processes of attentional allocation and disengagement [12]. In support, in rodent models of chronic T. gondii infection, higher cyst density, neuroinflammation and neuronal degeneration were found in the PFC of mice [13, 14], indicating that T. gondii may be a PFC-tropic parasite. Additionally, a study reported that mice continued to display behavior changes even when were infected with an attenuated T. gondii strain incapable of forming cyst [15]. However, it is still unknown if remolding neuroinflammation and neuronal degeneration could improve T. gondii-induced goal-directed behavioral disorders.

β-glucan is an immunomodulating polysaccharide extracted from the Lentinula edodes (L. edodes), a cultivated edible and medicinal mushroom widely distributed in Southeast Asia [16]. As the main bioactive component of L. edodes, β-glucan could enhance host immune response and play a defensive role against the pathogen invasion [17]. For example, it has been reported that β-glucan has the capability to protect host from Leishmania donovani (L. donovani) infection [18]. Combined with spiramycin, β-glucan could inhibit acute T. gondii infection [19, 20]. Interestingly, β-glucan can also reduce the secretion of inflammatory factors IL-1β and IL-6 [21]. Previously, we demonstrated that dietary β-glucan could improve steatohepatitis and cognitive impairment in high-fat diet (HFD)-induced obese mice via remolding gut microbiota [22, 23]. Recently, another study reported that intraperitoneal injection of β-glucan induces immune training of microglia in mice [24]. However, it remains unknown if intraperitoneal injection of β-glucan can improve goal-directed behavioral disorders caused by chronic T. gondii infection.

In this study, we hypothesized that intraperitoneal injection of β-glucan could ameliorate goal-directed behavior in mice chronically infected with T. gondii. Therefore, we infected mice with Wh6 strain (a low virulence T. gondii strain in China) to induced goal-directed behavioral impairment [25]. Then the neuroprotective effects of β-glucan were evaluated in the infected model. The effects of β-glucan on prefrontal cortex-related cognitive functions were detected by Y-maze test and temporal order memory (TOM) test. Transmission electron microscopy, Golgi silver staining and immunofluorescence were used respectively to characterize synaptic ultrastructure, neuronal dendrites and neuroinflammation in the PFC of mice treated with β-glucan.

Animal care and Treatment

C57BL/6J mice aged 7 weeks were obtained from the Experimental Animal Center of Xuzhou Medical University (Xuzhou, China, SCXK (Su) 2020-0048), and they were kept 5 mice per cage in environmentally controlled conditions with 12-h light/12-h dark cycle at temperature 22 ℃, unrestricted water and food. After a week of acclimatization, mice were randomly divided into four groups (n = 10 mice per group): (I) mice gavaged with phosphate buffer saline (PBS) as a vehicle control (NC) group; (II) mice intraperitoneally injected with β-glucan solution (50 mg/kg/mouse, Sigma-Aldrich, St. Louis, MO, USA) before 2 weeks prior to PBS gavage as the NB group; (III) mice gavaged with 10 cysts of T. gondii Wh6 strain as the T. gondii infection (TG) group; (Ⅳ) mice intraperitoneally injected with β-glucan solution before 2 weeks prior to T. gondii infection as the β-glucan treated (TGB) group. 4 weeks after T. gondii infection, the behavior tests were performed as detailed below. 4 days after behavioral experiment, all mice were euthanized. Brain tissues of mice were dissected and frozened in -80 ℃ refrigerator for further analyses. All experiments were performed according to the methods approved by the ethics committee of Xuzhou Medical University.

Animal model for T. gondii Wh6 infection

T. gondii Wh6 strain was used in the present study [26]. Ten brain cysts in 200 µl of PBS were gavaged into C57BL/6J mice. Four weeks later, brain tissues of the infected mice were collected and homogenized in the 1ml PBS. The cysts were counted microscopically. Ten brain cysts were gavaged into C57BL/6J mice to establish mouse model of chronic T. gondii infection as previously reported [27].

Y-maze Test

The Y-maze test was performed to measure spatial working retention based on procedures described previously [28]. In brief, the arms of the maze were labeled with different pictures after acclimatization of the mice. Each mouse was put in the center and allowed to freely explore the maze for 8 min. The number of all arm entries and alternations were recorded. An spontaneous alternation was defined as the mouse entering all three arms consecutively (i.e., 123, 213, and 321, but not 313 and 211). The alternation triplet (%) was counted using the following formula: [number of spontaneous alternations / (number of all arms entries-2) × 100].

Temporal Order Memory (Tom) Test

The temporal order memory test was carried out to evaluate recognition memory processes according to methods described previously [29]. Briefly, the test is consisted of three stages: two sample stage and one test stage. One day before the test, each mouse was placed in behavioral testing room for 60 min to acclimatize the environments. During two sample stages, each mouse explored two identical objects freely for 4 min; the objects between two sample stages were diverse, as object A for sample stage 1 and object B for sample stage 2. The time intervals between each sample stage was 60 min. 120 min later, the test stage began. For the test stage, one object from the sample stage 1 (object A, old object) and another object from the sample stage 2 (object B, recent object) were parallelly presented, and each mouse was allowed to explore the open field freely for 3 min. The discrimination index was calculated as follows: (old object exploration time - recent object exploration time) / (total exploration time) × 100%. Intact temporal order memory was thought if mice used longer time to explore the old object than the recent object.

Transmission Electron Microscope

After cardiac perfusion with saline, the prefrontal cortex (PFC) of brain was rapidly dissected and fixed in glutaraldehyde for 24 h. Immediately, the PFC tissues of NC, NB, TG and TGB were cut into thin section. Then, the sections were fixed in 2.5% glutaraldehyde overnight at 4 ℃. After washed 3 times in phosphate-buffered saline (PBS), they were post-fixed with 1% osmium tetroxide. Subsequently, the samples were stained with 2% uranyl acetate, dehydrated in ascending concentrations of ethanol and acetone series, and embedded in epoxy resin. Finally, the sections were cut into 70 nm thickness by using ultramicrotome, stained with 4% uranyl acetate and 0.5% lead citrate after collected on copper grids. Ultrastructure of synapses in the PFC was observed by using a transmission electron microscopy (FEI, Portland, OR, United States), and the morphometrics of synapses were detected. The density of postsynapse (PSD), the width of synaptic clefts, the curvature of the synaptic interface and the length of activated zone were determined using Image J software (Version 1.53n, https://imagej.nih.gov/ij/).

Golgi-cox Staining And Image Analysis

Variations in neuronal morphology were analyzed by Golgi-Cox staining using the FD Rapid Golgi Stain Kit (Nanjing Well-OffexBiotechnology Co., Ltd, PK401) as previously described [30]. In brief, the brains of mice were dissected and impregnated in mixture of solution A and solution B, and stored at room temperature for 14 days in the darkness, and the solution was replaced every 48 h. Then, brain tissues were immersed in solution C for 5 days, and sectioned (200 µm) by using a Vibratome. Sections were mounted on gelatinized slides, stained with a mixture of solution D and solution E, dehydrated with increasing concentrations of alcohol, hyalinized with xylene, and covered with Permount. Images were taken using a digital camera attached with microscopy (Olympus, Richmond Hill, ON, Canada). The dendritic shafts and spines of pyramidal neurons from layers II/III of the PFC were randomly chosen to analyze by investigators blind to experimental design. Neuron J plugin of ImageJ software was to analyze the morphological data including the total neurite length of the neuron, the length of each neurite, and the number of neurites per neuron. The spine density of dendritic spines were estimated by counting the number of spines along a section of shaft (10 µm on a 30–50 µm segment of a distal branch) using the Cell Counter plugin of ImageJ software. Additionally, a Sholl analysis was performed to evaluate dendritic complexity by using the Sholl plugin of ImageJ software [31]. Images of Golgi-stained neurons were overlaid by concentric circles with diameters increasing at intervals of 10 µm around the soma (10–300 µm). The number of neurites crossing each circle was manually counted. The number of intersections between a circle of a given radius and the neurites was assessed, and the following indicators were calculated: sum intersections, max intersection distance.

Immunofluorescence

Immunofluorescence was carried out according to methods described previously [32]. In brief, dissected brains were fixed in 4% paraformaldehyde overnight, dehydrated in 30% sucrose in PBS, and stored in a -20°C freezer. All sections for immunofluorescence were sectioned into 3 µm thickness by using a rotary microtome (RM2016, Leica, German). After blocked with 5% bovine serum albumin (Servicebio, G5001) for 30 min at room temperature, brain slices were incubated with the primary antibody anti-Iba1 (Abcam, Ab178847) or anti-GFAP (CST, #3670) or anti-IL-6 (Servicebio, GB11117) at 4 ℃ overnight. Then the sections were incubated with HRP-inked goat anti-rabbit IgG secondary antibody (Servicebio, gb21303) or Cy3 conjugated goat anti-mouse IgG secondary antibody (Servicebio, gb25303 ) for 1 h at room temperature. After washing, the sections were incubated with FITC-TSA ( Servicebio, G1222) for 10 min at room temperature, placed in a retrieval box containing EDTA antigen retrieval buffer (Servicebio, G1206), and heated in a microwave to facilitate removal of de-bound primary and secondary antibodies. The secondary antibody rabbit anti-interleukin-6 (IL-6, Servicebio, 1:200) was dropped on the slices and incubated at 4°C overnight. Sections were then incubated with Cy3-conjugated goat anti-rabbit IgG secondary antibody (Servicebio, gb21303) for 50 minutes at room temperature. Finally, the slices were stained with DAPI (Servicebio, G1012). The morphology and the percentage IL-6⁺ of microglia (Iba1⁺ cells) and astrocytes (GFAP⁺ cells) in the PFC were then captured using a microscope (Eclipse C1, Nikon, Japan), and quantified using Image J software.

Western Blotting

Western blot assays were performed as described previously [32]. Briefly, proteins were extracted from PFC in ice-cold RIPA lysis buffer containing EDTA, protease inhibitor cocktail and 1 mM PMSF. The protein concentrations was measured by BCA assay (Beyotime Biotech, China). 20–40 µg proteins were resolved by 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis, and electrotransferred onto polyvinylidene difluoride (PVDF) membranes. Western blot assays were conducted by using primary antibodies included: anti-BDNF (Alomone Labs, ANT-010), anti-PSD95 (CST, #3450), Anti-Synaptophysin [YE269] (Abcam, ab32127) and anti-β-Actin (CST, #4967). Secondary antibody was HRP-inked anti-rabbit IgG (CST, #7074). Immunodetection was detected using Clarity™ ECL western blot substrate (Bio-Rad, 1, 705,060) and captured using the ChemiDoc Touch imaging system (Bio-Rad).

Rna Extraction And Real-time Pcr (Rt-pcr)

RNA extraction and RT-PCR were performed based on methods previously described [23]. Briefly, total RNA was extracted from PFC homogenated in Trizol (Thermo Fisher Scientific, Waltham, MA, USA). 1 µg RNA was reverse-transcripted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Takara, Dalian, China). Subsequently, RT-PCR was performed using the SYBR GREEN Master Mix (Takara, Dalian, China) and detected on a real-time PCR detection system (Bio-Rad, Hercules, CA, USA). The relative mRNA levels were calculated using the 2^−ΔΔCt method and normalized by β-actin mRNA levels. Primer sequences were as follows: mIL-TNFα--forward (F): CTTGTTGCCTCCTCTTTTGCTTA, mIL-TNFα--reverse(R): CTTTATTTCTCTCAATGACCCGTAG; mIL-6–forward (F): CTGCTCATTCACGAAAAGGGA, mIL-6–reverse (R): TCACAGAAGGAGTGGCTAAGGACC; mβ-actin–forward (F): CGTGGGCCGCCCTAGGCACCA, mβ-actin–reverse (R): TTGGCCTTAGGGTTCAGGGGGG.

T. gondii cyst counts

Cyst counts were quantified using the method reported previously [33]. In a nutshell, brain tissues were crushed in 1 ml PBS. Then, cysts of 10 µl brain suspension were counted under a light microscopy (×20). The cyst count was counted in a blind manner to evaluate the total cysts burden in the brain tissue. The counting process for each mouse was repeated 4 times.

Statistical analysis

Data are presented as mean ± standard error of the mean (SEM). Statistical analysis was performed using SPSS (version 20, IBM Corporation, Chicago, IL, USA). All data were tested for normality by applying the Shapiro-Wilk normality test. If normality was given, Comparisons between two groups were done by using the unpaired t test, while comparisons between multiple groups were conducted by one-way ANOVA followed by the post hoc, Tukey’s test. A P value < 0.05 was considered as statistically significant.

β-glucan prevented abnormal goal-directed behavioral impairment caused by T. gondii Wh6 infection in mice

To assess whether β-glucan treatment could prevent abnormal goal-directed behavior induced by T. gondii infection, we performed Y-maze and TOM tests, which could explore PFC-dependent spatial working and recognition memory of daily living [28, 34]. The schematic timeline for behavior tests as shown in Fig. 1A. In the Y-maze test, the ratio of spontaneous alteration in TG group was obviously lower than that in NC group, while β-glucan significantly increased alternation triplet of TG group (P < 0.001, Fig. 1B). The difference in alternation triplet was not due to the variant general activity because the number of alternations and entries were not markedly different among four groups (Fig. 1C, D). In the TOM test, recognition memory was injury in TG group as proved by T. gondii infection significantly reducing the discrimination index compared with NC group, while β-glucan significantly increased the novel object discrimination index of TG group (P < 0.001, Fig. 1E, F). Detaily, the TG group spent more time in recognizing new objects, which could improve by β-glucan treatment (P < 0.01, Fig. 1G). The time spent with recent objects and the total exploration time of objects during the test stage were similar among these groups (Fig. 1H, I). Above all, these results indicate that goal-directed behavioral deficits caused by T. gondii Wh6 infection are preventable by β-glucan treatment. In addition, the cyst number in the brain of TGB group was significantly lower than that in TG group (P < 0.05, Fig. S1).

β-glucan mitigated neurites impairment in the PFC of T. gondii Wh6-infected mice

Following the observation of improved goal-directed behavior by β-glucan administration, we next identified β-glucan’s effects on the neurites impairment of the PFC in mice infected by T. gondii Wh6. The structure of neurites in the PFC was investigated by Golgi silver staining. We observed a significant decrease in the total neurite length per cell and the number of neurite branches after T. gondii Wh6 infection, while β-glucan reversed these changes (Both P < 0.01, Fig. 2A-C). There were no significant changes in the average neurite length per branches (Fig. 2D). Furthermore, Sholl analysis showed that compared with NB group, the TG group had reduced dendritic complexity and synaptic spines morphology in the PFC by reducing the sum number of dendritic intersections, the distance of the max intersections from the soma, and spine density; while these abnormities to some degree were improved by β-glucan (Fig. 2E-I). Collectively, these results indicate that β-glucan could prevent neurite degeneration and decreased neuronal complexity in the PFC induced by T. gondii Wh6 infection.

β-glucan ameliorated synaptic ultrastructural damage in the PFC of T. gondii Wh6-infected mice

Synaptic ultrastructure and plasticity protein are strongly associated with spatial working and recognition memory [35]. We next detectd β-glucan’s effects on the synaptic ultrastructure and the expression of plasticity proteins. The ultrastructure of synapsis in the PFC was analyzed using TEM. We found that T. gondii Wh6 infection reduced the thickness of the postsynaptic densities (PSD), shortened the length of the active zone, decreased the synaptic curvature, and broadened the width of synaptic cleft (All P < 0.05, Fig. 3A-E). Notably, Compared with TG group, β-glucan administration attenuated these pathogenic changes, exhibiting thicker PSDs, longer active zone, higher synaptic curvature, and lesser synaptic cleft (All P < 0.05, Fig. 3A-E). Moreover, the expression of plasticity proteins, synaptophysin (SYN) and postsynaptic density-95 (PSD-95) in the PFC were reduced in TG group; however, none of these changes were found in TGB group (Fig. 3F, G). In summary, the results above suggest that β-glucan could ameliorate the synaptic ultrastructure and plasticity of PFC, thereby preventing PFC-associated cognitive decline caused by T. gondii Wh6 infection.

β-glucan suppressed microglia activation in the PFC of T. gondii Wh6 -infected mice

Activation of microglia are considered critical in the process of neurodegeneration [36]. We then investigated β-glucan’s effects on microgliosis in the PFC of mice infected with T. gondii Wh6. Using Iba-1 as the immunofluorescent marker of microglia, we found that T. gondii infection significantly increased the number of microglia in the PFC, while β-glucan observably decreased the number of microglia (P < 0.001, Fig. 4A, B). Further analyzed the morphology of microglia, we observed that the circularity and solidity of microglia were obviously increased in the PFC of TG group compared with NC, NB and TGB groups (Both P < 0.001, Fig. 4C, D). These results suggest that the microglial activation induced by T. gondii Wh6 infection could mitigate by β-glucan supplementation.

β-glucan inhibited astrocyte activation in the PFC of T. gondii Wh6 -infected mice

Abnormal activation of astrocyte is another risk factor for cognitive decline [37]. Following, we detected the effects of β-glucan on astrogliosis in the PFC of mice infected with T. gondii Wh6. Using GFAP as the immunofluorescent marker of astrocyte, we observed that the number of astrocytes in the PFC of TG group was markedly lower than that in the PFC of NC group, which was restored by β-glucan supplement (P < 0.001, Fig. 5A, B). Meanwhile, we further analyzed the morphology of astrocyte in the PFC, found that the enlarged cell body and the fewer ramifications were found in the PFC of TG group than those in the PFC of TGB group (Both P < 0.001, Fig. 5C, D). These results suggest that β-glucan intervention could prevent astrocyte activation in the PFC of mice infected with T. gondii Wh6.

β-glucan restrained the expression of pro-inflammatory cytokines in the PFC of T. gondii Wh6-infected mice

Following β-glucan improving microglial and astrocyte activation, we examined the effects of β-glucan on pro-inflammatory cytokines. Using double immunofluorescent staining of Iba-1 and IL-6, we found that the average intensity of fluorescence in IL-6⁺ cells and percentages of Iba1⁺IL-6⁺ cells in Iba1⁺ cells in TG group were significantly higher than those in NC group, while β-glucan significantly inhibit these alternations (Both P < 0.001, Fig. 6A-C). Meanwhile, similar results were found in the astrocyte of the PFC by using double immunofluorescent staining of GFAP and IL-6 to evaluate IL-6 expression in astrocyte, as the higher mean fluorescence intensity of IL-6⁺ cells and percentages of GFAP⁺IL-6⁺ cells in GFAP⁺ cells in the PFC were found in TG group than those in other groups (Both P < 0.001, Fig. 6D-F). In addition, β-glucan strikingly prevented the upregulation of IL-6 and TNF-α mRNA expression in the PFC (Both P < 0.001, Fig. 6G-H). These findings indicate that β-glucan suppressed the neuroinflammation induced by T. gondii Wh6 infection.

In the present study, using the T. gondii chronic infection model established by gavage cysts of T. gondii Wh6 strain, we demonstrated that chronic T. gondii Wh6 infection induces PFC-dependent abnormal goal-directed behavior, which could prevent by β-glucan administration. For the first time, we present evidence that β-glucan could prevent T. gondii Wh6-induced goal-directed behavioral disorder via amelioration of neuron integrity, synaptic ultrastructure and neuroinflammation. Here, importantly, our findings of β-glucan in benefits to the cognitive function may provide a new therapeutic strategy for the treatment of neurodegenerative diseases caused by toxoplasmosis.

Previous clinical reports have reported that chronic T. gondii infection are closely linked with psycho-behavioral disorders, such as AD [38]. In a study of a community-based sample, T. gondii seropositive individuals has been reported to display subclinical behavioral changes and a higher risk of PD [5]. As a Chinese 1 genotype isolated from feral cat, T. gondii Wh6 prefers to form cysts in host tissues, although has lower virulence and mortality [39]. Recently, it is reported that chronic Wh6 infection caused tau phosphorylation and neuron apoptosis in mice, similar to the pathological characteristics of AD [26]. In this study, we found that Wh6-infected mice exhibited abnormal goal-directed behavior by using the Y-maze and temporal order memory tests (Fig. 1), further suggesting T. gondii Wh6 impairs cognitive function. Previously, many efforts tried to mitigate abnormal behaviors induced by T. gondii have been unsuccessful [15]. For example, diphenyl diselenide treatment can normalize acetylcholinesterase activity in the CNS of chronically infected mice but failed to reverse changed behaviors [40]. Importantly, in this study, intraperitoneal administration of β-glucan significantly prevented T. gondii Wh6-induced goal-directed behavioral impairment. In addition, cyst burden in the brain has been linked with the development of psycho-behavioral disorders, although mice infected with a T. gondii strain incapable of forming cyst still continued to display behavior change [15, 41]. In rodents, chronic T. gondii infection developed cysts in the PFC [13, 14]. Here, we found that T. gondii Wh6 infection formed cysts in the PFC of mice. However, the number of cysts in the PFC of infected mice was reduced by β-glucan intervention. The mechanism of how β-glucan decreases cyst formation should be further examined in future.

The prefrontal cortex, a region associated with cognitive processing, spatial working and recognition memory, is very susceptive to T. gondii infection [13, 14, 42, 43]. Neurite arborization and synaptic plasticity are essential for neuronal circuits and cognitive function [44, 45]. It is reported that chronic T. gondii infection induced neuronal degeneration and damaged the synaptic ultrastructure in the PFC of mice [13, 14, 46, 47]. Here, using Golgi silver staining and TEM, we observed neuronal morphology and synaptic structural plasticity, and showed neurite degeneration, decreased neuronal complexity and impaired synaptic transmission in the PFC of TG group (Fig. 2 and Fig. 3A-E). These results powerfully suggest that T. gondii Wh6 impairs neurite arborization and synaptic plasticity, resulting cognitive impairment. Importantly, β-glucan supplementation prevented the T. gondii Wh6 infection-induced impairment to neurite and synaptic ultrastructure. In line with these results, we also observed that T. gondii Wh6 infection decrease the expression of SYN and PSD-95 in the PFC of mice, consistent with previous reports found in other T. gondii strains [5]. However, it should be emphasized that β-glucan intervention reversed these T. gondii Wh6-associated decreases (Fig. 3F, G). Therefore, these findings suggest that T. gondii Wh6 infection impaired neuronal integrity and synaptic ultrastructure, which could be evidently prevented by β-glucan, indicating a neuroprotective effect of β-glucan.

Neuroinflammation, characterized by microglia and astrocytes activation, is considered as a key motivation for the progression of neurodegenerative diseases [36, 48]. Previous studies have reported that chronic T. gondii infection induces microglial activation and astrogliosis [49, 50]. Here, similarly to previous reports, we also found that chronic T. gondii Wh6 infection causes the activation of microglia and astrocytes in the PFC of mice (Fig. 4,5), indicating massive neuroinflammation was caused by T. gondii Wh6. Importantly, β-glucan administration attenuated the hyperactivation of microglia and astrocytes induced by T. gondii Wh6. In addition, the activation of microglia and astrocytes leads to the release of po-inflammatory cytokines, such as IL-6 and TNF-α, thereby contributing to the damage of neurons [51]. Our findings also confirm that T. gondii Wh6 infection up-regulated the expression of IL-6 and TNF-α in the PFC region (Fig. 6), which was restrained by β-glucan, suggesting that the neuroinflammation and cytotoxicity of hyperactivated glial cells could be reduced by β-glucan. Thus, it is speculated that chronic T. gondii Wh6 infection caused neuroinflammation, eventually impairing cognitive function, while β-glucan could suppress this process.

β-glucan, as the major bioactive component extracted from mushrooms and fungi, has been shown to promote immune response and induce the expression of inflammatory cytokines at low dose [52].It has been reported that β-glucan extracted from L. donovani could inhibit acute T. gondii infection [18]. Recently, several studies including ours demonstrated that dietary β-glucan could improve cognitive impairment via remolding gut microbiota [22, 23]. Importantly, consumption of a diet rich in β-glucan (polysaccharide) has been reported to improve cognitive performance in humans, thereby reducing the incidence of cognitive impairment [53]. In this study, we found that intraperitoneal injection of β-glucan could maintain the structural integrity of neurons and the complexity of dendritic spines, improve synaptic ultrastructure damage, and inhibit neuroinflammation, thereby preventing goal-directed behavioral impairment induced by chronic T. gondii Wh6 infection (Fig. 7). To our knowledge, the treatment strategy for the T. gondii-induced cognitive impairment is still in the embarrassing situation of no effective treatment drugs [54]. The present study suggests that β-glucan may be a potential drug for the treatment of cognitive diseases caused by T. gondii infection and provides a therapeutic strategy for neurodegenerative diseases.

The present study demonstrates that chronic T. gondii Wh6 infection causes goal-directed behavioral impairment in mice, which could be prevented by intraperitoneal administration of β-glucan. Our findings suggest that T. gondii Wh6 strain, similarly to other strains, is a risk of neurodegenerative diseases. Importantly, β-glucan may be an effective drug candidate to psycho-behavioral disorders induced by toxoplasmosis.

Ethics Approval

All animal experiments described in this study were performed in accordance with the institutional guidelines and approved by the Ethical Management Committee of XuZhou medical university.

Consent for participate

Not applicable.

Consent for publication

This paper has got consent for publication from all authors listed.

Availability of data

All data generated or analyzed during the research process are included in this published article.

Competing interests

The authors declare that they have no conflict of interest.

Funding

This work was supported by the Natural Science Foundation of Jiangsu Province (No. BK20211055, BK20201459), the Jiangsu Qing Lan Project, the China Postdoctoral Science Foundation (No.2022M710120), the Training Programs of Innovation and Entrepreneurship for College Students in Jiangsu Province (No.202210313004Z, No.202210313001Z). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author’s information

Zeyu Cui and Yuying Gong contributed equally to this work.

Author’s Contributions

Xiaoying Yang and Wei Pan contributed to the conception and design of the study and experiments. Zeyu Cui and Yuying Gong complete the experiments. Xiaotong Luo, Niuyi Zheng, Shimin Tan and Shuxi Liu are responsible for literature search and classification.Zeyu Cui, Wei Pan and Xiaoying Yang wrote the manuscript and drew figures.Youwei Li strictly proofread the figure. Qingling Wang, Fenfen Sun and Minmin Hu made critical revisions to the manuscript. All authors reviewed the manuscript.

Corresponding authors

Correspondence to Xiaoying Yang and Wei Pan.

Acknowledgement

Not applicable.

Almeria S, Dubey JP. Foodborne transmission of Toxoplasma gondii infection in the last decade. An overview. Res Vet Sci. 2021;135 1532–2661 (Electronic):371 – 85; doi: 10.1016/j.rvsc.2020.10.019. https://www.ncbi.nlm.nih.gov/pubmed/33148402.
Saraav I, Cervantes-Barragan L, Olias P, Fu Y, Wang Q, Wang L, et al. Chronic Toxoplasma gondii infection enhances susceptibility to colitis. Proc Natl Acad Sci U S A. 2021;118 36; doi: 10.1073/pnas.2106730118. https://www.ncbi.nlm.nih.gov/pubmed/34462359.
Firouzeh N, Ziaali N, Sheibani V, Doustimotlagh AH, Afgar A, Zamanpour M, et al. Chronic Toxoplasma gondii Infection Potentiates Parkinson's Disease Course in Mice Model. Iran J Parasitol. 2021;16 4:527 – 37; doi: 10.18502/ijpa.v16i4.7863. https://www.ncbi.nlm.nih.gov/pubmed/35082880.
Mohle L, Israel N, Paarmann K, Krohn M, Pietkiewicz S, Muller A, et al. Chronic Toxoplasma gondii infection enhances beta-amyloid phagocytosis and clearance by recruited monocytes. Acta Neuropathol Commun. 2016;4 2051–5960 (Electronic):25; doi: 10.1186/s40478-016-0293-8. https://www.ncbi.nlm.nih.gov/pubmed/26984535.
French T, Dusedau HP, Steffen J, Biswas A, Ahmed N, Hartmann S, et al. Neuronal impairment following chronic Toxoplasma gondii infection is aggravated by intestinal nematode challenge in an IFN-gamma-dependent manner. J Neuroinflammation. 2019;16 1:159; doi: 10.1186/s12974-019-1539-8. https://www.ncbi.nlm.nih.gov/pubmed/31352901.
Torres L, Robinson SA, Kim DG, Yan A, Cleland TA, Bynoe MS. Toxoplasma gondii alters NMDAR signaling and induces signs of Alzheimer's disease in wild-type, C57BL/6 mice. J Neuroinflammation. 2018;15 1:57; doi: 10.1186/s12974-018-1086-8. https://www.ncbi.nlm.nih.gov/pubmed/29471842.
Bogdanov M, Timmermann JE, Glascher J, Hummel FC, Schwabe L. Causal role of the inferolateral prefrontal cortex in balancing goal-directed and habitual control of behavior. Sci Rep. 2018;8 1:9382; doi: 10.1038/s41598-018-27678-6. https://www.ncbi.nlm.nih.gov/pubmed/29925889.
Zhong S, Zhang S, Fan X, Wu Q, Yan L, Dong J, et al. A single-cell RNA-seq survey of the developmental landscape of the human prefrontal cortex. Nature. 2018;555 7697:524–8; doi: 10.1038/nature25980. https://www.ncbi.nlm.nih.gov/pubmed/29539641.
Jobson DD, Hase Y, Clarkson AN, Kalaria RN. The role of the medial prefrontal cortex in cognition, ageing and dementia. Brain Commun. 2021;3 3:fcab125; doi: 10.1093/braincomms/fcab125. https://www.ncbi.nlm.nih.gov/pubmed/34222873.
Miller EK. The prefrontal cortex and cognitive control. Nat Rev Neurosci. 2000;1 1:59–65; doi: 10.1038/35036228. https://www.ncbi.nlm.nih.gov/pubmed/11252769.
Park J, Moghaddam B. Impact of anxiety on prefrontal cortex encoding of cognitive flexibility. Neuroscience. 2017;345 1873–7544 (Electronic):193–202; doi: 10.1016/j.neuroscience.2016.06.013. https://www.ncbi.nlm.nih.gov/pubmed/27316551.
Beste C, Getzmann S, Gajewski PD, Golka K, Falkenstein M. Latent Toxoplasma gondii infection leads to deficits in goal-directed behavior in healthy elderly. Neurobiol Aging. 2014;35 5:1037–44; doi: 10.1016/j.neurobiolaging.2013.11.012. https://www.ncbi.nlm.nih.gov/pubmed/24315729.
Li Y, Severance EG, Viscidi RP, Yolken RH, Xiao J. Persistent Toxoplasma Infection of the Brain Induced Neurodegeneration Associated with Activation of Complement and Microglia. Infect Immun. 2019;87 8; doi: 10.1128/IAI.00139-19. https://www.ncbi.nlm.nih.gov/pubmed/31182619.
Petrozziello T, Mills AN, Vaine CA, Penney EB, Fernandez-Cerado C, Legarda GPA, et al. Neuroinflammation and histone H3 citrullination are increased in X-linked Dystonia Parkinsonism post-mortem prefrontal cortex. Neurobiol Dis. 2020;144 1095–953X (Electronic):105032; doi: 10.1016/j.nbd.2020.105032. https://www.ncbi.nlm.nih.gov/pubmed/32739252.
Martynowicz J, Augusto L, Wek RC, Boehm SL, 2nd, Sullivan WJ, Jr. Guanabenz Reverses a Key Behavioral Change Caused by Latent Toxoplasmosis in Mice by Reducing Neuroinflammation. mBio. 2019;10 2; doi: 10.1128/mBio.00381-19. https://www.ncbi.nlm.nih.gov/pubmed/31040237.
Sakamoto Y, Nakade K, Sato S, Yoshida K, Miyazaki K, Natsume S, et al. Lentinula edodes Genome Survey and Postharvest Transcriptome Analysis. Appl Environ Microbiol. 2017;83 10; doi: 10.1128/AEM.02990-16. https://www.ncbi.nlm.nih.gov/pubmed/28314725.
Crespo H, Guillen H, de Pablo-Maiso L, Gomez-Arrebola C, Rodriguez G, Glaria I, et al. Lentinula edodes beta-glucan enriched diet induces pro- and anti-inflammatory macrophages in rabbit. Food Nutr Res. 2017;61 1:1412791; doi: 10.1080/16546628.2017.1412791. https://www.ncbi.nlm.nih.gov/pubmed/29249921.
Patidar A, Mahanty T, Raybarman C, Sarode AY, Basak S, Saha B, et al. Barley beta-Glucan and Zymosan induce Dectin-1 and Toll-like receptor 2 co-localization and anti-leishmanial immune response in Leishmania donovani-infected BALB/c mice. Scand J Immunol. 2020;92 6:e12952; doi: 10.1111/sji.12952. https://www.ncbi.nlm.nih.gov/pubmed/32748397.
Büyükbaba Boral O, Sönmez Tamer G Fau - Keçeli Özcan S, Keçeli Özcan S Fau - Sönmez N, Sönmez N Fau - Işsever H, Işsever H Fau - Tekeli F, Tekeli F. [Investigation of combined effectiveness of spiramycin and beta-glucan in mice models of acute toxoplasmosis and determination of IL-10, IL-12 and TNF-α levels]. 0374–9096 (Print).
Vetvicka V, Fernandez-Botran R. beta-Glucan and Parasites. Helminthologia. 2018;55 3:177–84; doi: 10.2478/helm-2018-0021. https://www.ncbi.nlm.nih.gov/pubmed/31662645.
Morales D, Rutckeviski R, Villalva M, Abreu H, Soler-Rivas C, Santoyo S, et al. Isolation and comparison of alpha- and beta-D-glucans from shiitake mushrooms (Lentinula edodes) with different biological activities. Carbohydr Polym. 2020;229 1879 – 1344 (Electronic):115521; doi: 10.1016/j.carbpol.2019.115521. https://www.ncbi.nlm.nih.gov/pubmed/31826486.
Pan W, Jiang P, Zhao J, Shi H, Zhang P, Yang X, et al. beta-Glucan from Lentinula edodes prevents cognitive impairments in high-fat diet-induced obese mice: involvement of colon-brain axis. J Transl Med. 2021;19 1:54; doi: 10.1186/s12967-021-02724-6. https://www.ncbi.nlm.nih.gov/pubmed/33541370.
Yang X, Zheng M, Zhou M, Zhou L, Ge X, Pang N, et al. Lentinan Supplementation Protects the Gut-Liver Axis and Prevents Steatohepatitis: The Role of Gut Microbiota Involved. Front Nutr. 2021;8 2296–861X (Print):803691; doi: 10.3389/fnut.2021.803691. https://www.ncbi.nlm.nih.gov/pubmed/35127789.
Heng Y, Zhang X, Borggrewe M, van Weering HRJ, Brummer ML, Nijboer TW, et al. Systemic administration of beta-glucan induces immune training in microglia. J Neuroinflammation. 2021;18 1:57; doi: 10.1186/s12974-021-02103-4. https://www.ncbi.nlm.nih.gov/pubmed/33618716.
Zhang A-M, Shen Q, Li M, Xu X-C, Chen H, Cai Y-H, et al. Comparative studies of macrophage-biased responses in mice to infection with Toxoplasma gondii ToxoDB #9 strains of different virulence isolated from China. Parasites & Vectors. 2013;6 1; doi: 10.1186/1756-3305-6-308.
Tao Q, Wang X, Liu L, Ji Y, Luo Q, Du J, et al. Toxoplasma gondii Chinese I genotype Wh6 strain infection induces tau phosphorylation via activating GSK3beta and causes hippocampal neuron apoptosis. Acta Trop. 2020;210 1873–6254 (Electronic):105560; doi: 10.1016/j.actatropica.2020.105560. https://www.ncbi.nlm.nih.gov/pubmed/32492398.
Taniguchi Y, Appiah-Kwarteng C, Murakami M, Fukumoto J, Nagamune K, Matsuo T, et al. Atypical virulence in a type III Toxoplasma gondii strain isolated in Japan. Parasitol Int. 2018;67 5:587 – 92; doi: 10.1016/j.parint.2018.05.010. https://www.ncbi.nlm.nih.gov/pubmed/29775826.
Kraeuter AK, Guest PC, Sarnyai Z. The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. Methods Mol Biol. 2019;1916 1940–6029 (Electronic):105 – 11; doi: 10.1007/978-1-4939-8994-2_10. https://www.ncbi.nlm.nih.gov/pubmed/30535688.
Yang X, Zheng M, Hao S, Shi H, Lin D, Chen X, et al. Curdlan Prevents the Cognitive Deficits Induced by a High-Fat Diet in Mice via the Gut-Brain Axis. Front Neurosci. 2020;14 1662–4548 (Print):384; doi: 10.3389/fnins.2020.00384. https://www.ncbi.nlm.nih.gov/pubmed/32477045.
Restivo L, Ferrari F, Passino E, Sgobio C, Bock J, Oostra BA, et al. Enriched environment promotes behavioral and morphological recovery in a mouse model for the fragile X syndrome. Proc Natl Acad Sci U S A. 2005;102 32:11557–62; doi: 10.1073/pnas.0504984102. https://www.ncbi.nlm.nih.gov/pubmed/16076950.
Srinivasan A, Srinivasan A, Ferland RJ. AutoSholl allows for automation of Sholl analysis independent of user tracing. J Neurosci Methods. 2020;331 1872–678X (Electronic):108529; doi: 10.1016/j.jneumeth.2019.108529. https://www.ncbi.nlm.nih.gov/pubmed/31760060.
Wu J, Zhu Y, Zhou L, Lu Y, Feng T, Dai M, et al. Parasite-Derived Excretory-Secretory Products Alleviate Gut Microbiota Dysbiosis and Improve Cognitive Impairment Induced by a High-Fat Diet. Front Immunol. 2021;12 1664–3224 (Electronic):710513; doi: 10.3389/fimmu.2021.710513. https://www.ncbi.nlm.nih.gov/pubmed/34745091.
Lang D, Schott BH, van Ham M, Morton L, Kulikovskaja L, Herrera-Molina R, et al. Chronic Toxoplasma infection is associated with distinct alterations in the synaptic protein composition. J Neuroinflammation. 2018;15 1:216; doi: 10.1186/s12974-018-1242-1. https://www.ncbi.nlm.nih.gov/pubmed/30068357.
Naya Y, Chen H, Yang C, Suzuki WA. Contributions of primate prefrontal cortex and medial temporal lobe to temporal-order memory. Proc Natl Acad Sci U S A. 2017;114 51:13555–60; doi: 10.1073/pnas.1712711114. https://www.ncbi.nlm.nih.gov/pubmed/29192021.
Zhang X, Zhao Y, Du Y, Sun H, Zhang W, Wang A, et al. Effect of ketamine on mood dysfunction and spatial cognition deficits in PTSD mouse models via HCN1-BDNF signaling. J Affect Disord. 2021;286 1573–2517 (Electronic):248 – 58; doi: 10.1016/j.jad.2021.02.058. https://www.ncbi.nlm.nih.gov/pubmed/33752039.
Catorce MN, Gevorkian G. LPS-induced Murine Neuroinflammation Model: Main Features and Suitability for Pre-clinical Assessment of Nutraceuticals. Curr Neuropharmacol. 2016;14 2:155–64; doi: 10.2174/1570159x14666151204122017. https://www.ncbi.nlm.nih.gov/pubmed/26639457.
Tai LM, Thomas R, Marottoli FM, Koster KP, Kanekiyo T, Morris AW, et al. The role of APOE in cerebrovascular dysfunction. Acta Neuropathol. 2016;131 5:709–23; doi: 10.1007/s00401-016-1547-z. https://www.ncbi.nlm.nih.gov/pubmed/26884068.
Halonen SK, Weiss LM. Toxoplasmosis. Handb Clin Neurol. 2013;114 0072–9752 (Print):125 – 45; doi: 10.1016/B978-0-444-53490-3.00008-X. https://www.ncbi.nlm.nih.gov/pubmed/23829904.
Cheng W, Liu F, Li M, Hu X, Chen H, Pappoe F, et al. Variation detection based on next-generation sequencing of type Chinese 1 strains of Toxoplasma gondii with different virulence from China. BMC Genomics. 2015;16 1471–2164 (Electronic):888; doi: 10.1186/s12864-015-2106-z. https://www.ncbi.nlm.nih.gov/pubmed/26518334.
Machado VS, Bottari NB, Baldissera MD, Rech VC, Ianiski FR, Signor C, et al. Diphenyl diselenide supplementation in infected mice by Toxoplasma gondii: Protective effect on behavior, neuromodulation and oxidative stress caused by disease. Exp Parasitol. 2016;169 1090–2449 (Electronic):51 – 8; doi: 10.1016/j.exppara.2016.07.006. https://www.ncbi.nlm.nih.gov/pubmed/27472985.
Xiao J. Behavioral Changes Induced by Latent Toxoplasmosis Could Arise from CNS Inflammation and Neuropathogenesis. Curr Top Behav Neurosci. 2022; 1866–3370 (Print); doi: 10.1007/7854_2022_370. https://www.ncbi.nlm.nih.gov/pubmed/35676595.
Miller EK, Cohen JD. An integrative theory of prefrontal cortex function. Annu Rev Neurosci. 2001;24 0147-006X (Print):167–202; doi: 10.1146/annurev.neuro.24.1.167. https://www.ncbi.nlm.nih.gov/pubmed/11283309.
Parnaudeau S, Bolkan SS, Kellendonk C. The Mediodorsal Thalamus: An Essential Partner of the Prefrontal Cortex for Cognition. Biol Psychiatry. 2018;83 8:648 – 56; doi: 10.1016/j.biopsych.2017.11.008. https://www.ncbi.nlm.nih.gov/pubmed/29275841.
Head E, Corrada MM, Kahle-Wrobleski K, Kim RC, Sarsoza F, Goodus M, et al. Synaptic proteins, neuropathology and cognitive status in the oldest-old. Neurobiol Aging. 2009;30 7:1125–34; doi: 10.1016/j.neurobiolaging.2007.10.001. https://www.ncbi.nlm.nih.gov/pubmed/18006193.
Tyrtyshnaia A, Manzhulo I. Neuropathic Pain Causes Memory Deficits and Dendrite Tree Morphology Changes in Mouse Hippocampus. J Pain Res. 2020;13 1178–7090 (Print):345 – 54; doi: 10.2147/JPR.S238458. https://www.ncbi.nlm.nih.gov/pubmed/32104056.
Carrillo GL, Ballard VA, Glausen T, Boone Z, Teamer J, Hinkson CL, et al. Toxoplasma infection induces microglia-neuron contact and the loss of perisomatic inhibitory synapses. Glia. 2020;68 10:1968–86; doi: 10.1002/glia.23816. https://www.ncbi.nlm.nih.gov/pubmed/32157745.
Wang T, Sun X, Qin W, Zhang X, Wu L, Li Y, et al. From inflammatory reactions to neurotransmitter changes: Implications for understanding the neurobehavioral changes in mice chronically infected with Toxoplasma gondii. Behav Brain Res. 2019;359 1872–7549 (Electronic):737 – 48; doi: 10.1016/j.bbr.2018.09.011. https://www.ncbi.nlm.nih.gov/pubmed/30253194.
Hou Y, Wei Y, Lautrup S, Yang B, Wang Y, Cordonnier S, et al. NAD(+) supplementation reduces neuroinflammation and cell senescence in a transgenic mouse model of Alzheimer's disease via cGAS-STING. Proc Natl Acad Sci U S A. 2021;118 37; doi: 10.1073/pnas.2011226118. https://www.ncbi.nlm.nih.gov/pubmed/34497121.
Bright F, Werry EL, Dobson-Stone C, Piguet O, Ittner LM, Halliday GM, et al. Neuroinflammation in frontotemporal dementia. Nat Rev Neurol. 2019;15 9:540 – 55; doi: 10.1038/s41582-019-0231-z. https://www.ncbi.nlm.nih.gov/pubmed/31324897.
Xiao J. Toxoplasma-induced Behavioral Changes: An Aspecific Consequence of Neuroinflammation. Trends Parasitol. 2020;36 4:317–8; doi: 10.1016/j.pt.2020.01.005. https://www.ncbi.nlm.nih.gov/pubmed/32191847.
Prasad JD, Gunn KC, Davidson JO, Galinsky R, Graham SE, Berry MJ, et al. Anti-Inflammatory Therapies for Treatment of Inflammation-Related Preterm Brain Injury. Int J Mol Sci. 2021;22 8; doi: 10.3390/ijms22084008. https://www.ncbi.nlm.nih.gov/pubmed/33924540.
Karumuthil-Melethil S, Gudi R, Johnson BM, Perez N, Vasu C. Fungal beta-glucan, a Dectin-1 ligand, promotes protection from type 1 diabetes by inducing regulatory innate immune response. J Immunol. 2014;193 7:3308–21; doi: 10.4049/jimmunol.1400186. https://www.ncbi.nlm.nih.gov/pubmed/25143443.
Haider A, Inam W, Khan SA, Hifza, Mahmood W, Abbas G. beta-glucan attenuated scopolamine induced cognitive impairment via hippocampal acetylcholinesterase inhibition in rats. Brain Res. 2016;1644 1872–6240 (Electronic):141–8; doi: 10.1016/j.brainres.2016.05.017. https://www.ncbi.nlm.nih.gov/pubmed/27180103.
Kang HJ, Chu KB, Lee SH, Kim MJ, Park H, Jin H, et al. Toxoplasma gondii virus-like particle vaccination alleviates inflammatory response in the brain upon T gondii infection. Parasite Immunol. 2020;42 6:e12716; doi: 10.1111/pim.12716. https://www.ncbi.nlm.nih.gov/pubmed/32249951.

No competing interests reported.

SupplementalData.docx

Download PDF

Journal Publication

published 13 Feb, 2023

Read the published version in Parasites & Vectors →

Editorial decision: Major revision
03 Nov, 2022
Reviews received at journal
21 Oct, 2022
Reviewers agreed at journal
19 Oct, 2022
Reviewers agreed at journal
16 Oct, 2022
Reviewers invited by journal
06 Oct, 2022
Editor assigned by journal
29 Sep, 2022
Submission checks completed at journal
29 Sep, 2022
First submitted to journal
27 Sep, 2022

You are reading this latest preprint version

β-glucan alleviates goal-directed behavior in mice infected with Toxoplasma gondii

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Methods And Materials

Animal care and Treatment

Y-maze Test

Temporal Order Memory (Tom) Test

Transmission Electron Microscope

Golgi-cox Staining And Image Analysis

Immunofluorescence

Western Blotting

Rna Extraction And Real-time Pcr (Rt-pcr)

Statistical analysis

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1