Preparation of TE, RAF and PAF
The whole plant of Corydalis hendersonii Hemsl. (the plant name has been checked with http://www.theplantlist.org) was collected from Shannan Autonomous Prefecture of Tibet in July 2017. Prof. Yuan Zhang (Beijing University of Chinese Medicine, BUCM) authenticated CH. The voucher specimen of CH was No. CH201707 and was stored in BUCM. About 160 g of total extract (TE) was obtained after extraction. Disperse the TE with hydrochloric acid aqueous solution and adjust the pH value to 2–3. Then the strong acid cation exchange resin is applied for separation and purification of alkaloids with the condition that passing through the hydrogen cation exchange resin column at the rate of 2 bed volumes per hour (BV/h). The resin column was flushed with water at the rate of 2 BV/h to neutral and the poor alkaloids fraction (PAF, 120 g) was obtained by collecting the combined eluent concentrated in vacuum. At last, the column was eluted at the rate of 2 BV/h to obtain rich alkaloids fraction (RAF, 30 mg) with 90% alkaline ethanol whose pH value at 10–11.
Lcms-it-tof
The research protocol was as the same with previous study [10]. The mobile phase (1.0 mL/min) consists of acetonitrile (A)–0.1% aqueous with formic acid (B) with a gradient program as follows: 0–15 min, 5–15% A; 16–50 min, 15–30% B; 51–80 min, 30–95% B; Roughly 20% portion of the effluent was introduced into the ESI (source by splitting the effluent via two polyetheretherketone tubes with length ratio of 1:4). The diode array detector (DAD) detector scans its absorption wavelength in the full wavelength range of 190–400 nm, so we set a 10 µL injection volume and 254 nm detection wavelength.
Experimental animal and ethics statement
The ICR mice (27–28 g) were obtained from Sibei Fu Biotechnology Co., Ltd. (Beijing, China) and reared in a specific pathogen-free (SPF) environment. The mice were housed with regular food and free water in a 12 h light-dark cycles, under conditions of 22 ± 2°C. According to the previous reports, the AMI model of mice LAD ligation was used to evaluate the effect of TE, RAF and PAF [9]. The Ethics Committee of BUCM had approved the experiments (the ethics permit number: BUCM-3–2015090701-3003), and the research was implemented according to the US guidelines (NIH publication #85 − 23, revised in 1996).
Eight groups were randomly divided: sham, model, Fosinopril (10 mg/kg, i.g.), TE (400 mg/kg, i.g.), PAF (300 mg/kg, i.g.), RAF high dose (RAF-H, 100 mg/kg, i.g.), RAF medium dose (RAF-M, 50 mg/kg, i.g.), RAF low dose (RAF-L, 25 mg/kg, i.g.) groups. Fosinopril was used as the positive control. The drugs were dissolved in 0.5% CMC-Na and were orally administered once a day for 7 days. The control groups were only given solvent.
Echocardiography
The mice were administered drugs or solvent for 7 days and then isoflurane (Ward Life Science and Technology Co., Ltd., Shenzhen, China) was used to anesthetize for 2D M-mode and B-mode echocardiography ultrasonic. The levels of left ventricular internal diameter (LVEDd), ejection fraction (EF), left ventricular internal diameter (LVEDs) and fractional shortening (FS) were calculated for measurement of the cardiac function.
Sample collection
After the echocardiography, 0.5% pentobarbital sodium were used to anaesthetize the mice at 50 mg/kg by intraperitoneal injection, and then they were sacrificed for collecting blood samples and heart samples. The serum and plasma were obtained through centrifugation for 20 min at 3000 rpm and then stored at − 80°C. The serum levels of lactate dehydrogenase (LDH) and creatine kinase-MB (CK-MB) were detected by Hitachi 17080 Automatic Biochemical Analyzer (Hitachi Co., Ltd., Japan). The plasma level of AngII was detected by ELISA. Heart was divided into two pieces along the ligature line and then the lower half was immediately put in liquid nitrogen for frozen, then it was stored at − 80°C until testing. The left of the heart was prepared for paraffin section, which was placed in 4% paraformaldehyde for 72 h.
Histological examination
After 72 h fixing, cardiac tissues were cut into 4 µm thin slices and prepared for pathological examination. The paraffin sections were stained with haematoxylin and eosin (HE), masson stain and sirius red stain, and then were observed with microscope.
TUNEL assay
The cardiac tissue samples were embedded in paraffin and sectioned into 3 µm thick flakes to determine apoptotic cells. Paraffin sections were immersed two times with xylene for 5 min each and then putted in 100%, 95%, 90%, 80%, 70% ethanol solutions for 3 min, respectively. Then treated tissue with Proteinase K working solution for 15–30 min, at 21–37°C. After incubation with 2'-deoxyuridine 5'-triphosphate for 1 h at 37°C, the nucleus was counterstained with 4',6-Diamidino-2-phenylindole dihydrochloride (DAPI).
qRT-PCR
The TRIzol reagent (Gibco-BRL, Paisley, UK) was used to extract total RNA according to the manufacturer's protocols. The concentration of the samples was determined by Nano Drop 2000 (Thermo Scientific, USA). Subsequently, the PCR Mix kit (Transgen Biotech Co.) was used to amplify the mice tissue cDNA. Afterwards, the expression of mRNA was measured by qRT-PCR: 1 cycle at 94°C for 30 s and 40 cycles at 94°C for 5 s and 50°C for 30 s and then determined by melting curve. The primer sequences were showed as follows: p38 mitogen-activated protein kinases (p38 MAPK) F, CCTATCCTGGAAGAGCCATACT; p38 MAPK R, ACTTTGTCACGCTGACCAGAT; Bax F, AGACAGGGGCCTTTTTGCTAC, Bax R, AATTCGCCGGAGACACTCG; Bcl-2 F, GAGCCTGTGAGAGACGTGG, Bcl-2 R, CGAGTCTGTGTATAGCAATCCCA; GAPDH F, TATGACTCTACCCACGGCAAG, GAPDH R, TACTCAGCACCAGCATCACC.
Immunofluorescence detection of tissue
After deparaffinized and immersed in xylene, the paraffin slices were eluted with an alcohol gradient. The tissue slices were placed in EDTA (pH 8.0) for antigen retrieval. The interval of power-off after 8 min at medium heat to boiling is 16 min and then low heat for 7 minutes to boiling. The sections were incubated with anti-p38 MAPK (8690T, Cell Signaling Technology), anti-Bcl-2 (26593, Proteintech) and anti-Bax (50599, Proteintech) at 4°C overnight. And then incubated with goat anti-rabbit IgG (LP1001B, ABGENT) at room temperature for 50 min. Counter-stain the cell nucleus with DAPI and incubate for 10 min in the dark at room temperature. After washing with PBS, the images were captured with the laser scanning confocal microscope (FV1000 Olympus, Japan).
Cell viability assay
H9c2 cells (China Infrastructure of Cell Line Resources, Beijing, China) was cultured under the condition of 37°C with 5% CO2 and the medium was DMEM (Corning, Manassas, VA, USA) mixed with 10% FBS (Corning, Manassas, VA, USA). DMSO (Sigma, USA) was used to dissolve RAF and the initial concentration was 40 mg/mL. Firstly, the H9c2 cells were seeded in 96-well plates with the density of 8 × 103 cells/well for 24 h before incubating with RAF (1.25, 2.5, 5, 10, 20, 40, 80, 160, and 320 µg/mL) for 24 h. Secondly, we put the 96-well plates into the hypoxia box and added RAF at the concentrations of 0.63, 1.25, 2.5, 5, and 10 µg/mL for 8 h. Control group was cultured without the hypoxia box and other conditions are the same. Finally, each well was added 100 µL CCK-8 and incubated for 2 h, then a microplate reader was used to measure the OD value of the plates at 450 nm.
Immunofluorescence detection of cells
The H9c2 cells were seeded into 6-well plates and the density was 2 × 105 cells/mL under the condition of 37°C with 5% CO2 for 24 h. After removed the supernatant, each well was added 500 µL of PBS and discarded. Then the cells were fixed in 4% paraformaldehyde and Hoechst 33258 was (1 µg/mL) was stained for 10 min in dark. Afterwards, the cells were washed with PBS and dried while protected from light. The fluorescence microscope (Leica Micro systems GmbH) was used to observe the apoptotic cells at 350 nm and 460 nm.
Western blot
Myocardial tissue (50 mg) and the H9c2 cells treated with hypoxia were harvested and fragmented in RIPA lysis buffer (Applygen Technologies Inc., Beijing, China) supplemented with 1% protease inhibitor and phosphatase inhibitor (PierceTM, Thermo Fisher Scientific, USA). After the sample content was measured by BCA method (Applygen Technologies Inc., Beijing, China), the protein was boiled at 99°C for 10 min. The protein samples of tissue and cells were separated by 10% SDS-PAGE gels and then they were transferred onto PVDF membranes (Millipore, Boston, MA, USA). After that, the primary antibodies (1:1000 or 1:2000, Table 1) and secondary antibodies (1:2000) were incubated with the membranes at 4°C overnight and at room temperature for 2 h, respectively. Then the bands were reacted with ECL (ECL Plus, GE Healthcare, United States) in the dark for 1 min, and were analyzed through the Image lab software.
Table 1
Primary antibodies used in western blot experiment
| Protein | Primary antibody | Concentration |
| p38 MAPK | Anti-p38 MAPK 8690T CST | 1 :1000 |
| p-p38 MAPK | Anti-p-p38 MAPK 4511T CST | 1 :1000 |
| MKK3 | Anti-MKK3 ab195037 Abcam | 1 :1000 |
| MKK6 | Anti-MKK6 ab33866 Abcam | 1 :1000 |
| p-MKK3/6 | Anit-MKK3/6 12280 CST | 1 :1000 |
| Bax | Anti-Bax 50599 Proteintech | 1 :2000 |
| Bcl-2 | Anti-Bcl2 26593 Proteintech | 1 :2000 |
| GAPDH | GAPDH 51332S CST | 1 :1000 |
Statistical analysis
In the study, all data were showed as the mean ± SEM and analyzed by GraphPad Prism 5.0 (GraphPad Software, Inc., San Diego, CA, United States). The differences among groups were calculated by one-way analysis of variance (ANOVA) with post hoc Dunnett’s test. P < 0.05 represented significant.
