Animals and MHE model
Sprague-Dawley rats (male, 220–250g) were purchased from the experimental animal center of the Chinese Academy of Sciences in Shanghai. This study was approved by Institutional Animal Care and Use Committee of Wenzhou Medical University (Wenzhou, Zhejiang, China). All animal experiments were conducted following the guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health and Institutional Animal Care and Use Committee of Wenzhou Medical University.
To induce liver cirrhosis, the rats (n = 50) were injected intraperitoneally with thioacetamid (TAA; 200 mg/kg in normal saline; Sigma-aldrich, St. Louis, MO, USA) twice per week for 8 weeks. The rats exhibited delayed motor activity, lethargy, and subsequent coma were categorized into the HE group (n = 4) 14. The rats without HE symptoms (n = 46) were subjected to water-finding and Y-maze tests to confirm MHE.
Water-finding and Y-maze tests
Water-finding and Y-maze tests were performed before and after drug administration. For water-finding test, the rat was placed at the near-right corner of the apparatus and allowed to find and drink the water in the alcove within 3 min. The entry latency (the time take to enter into the alcove), contacting latency (the time between entering into the alcove and the first touching/sniffing/licking the water tube), and drinking latency (the time between entering into the alcove and drinking the water) were measured 15.
For Y-maze test, the rat was placed at the end of one arm in a three-arm apparatus to explore the maze freely for 8 min. The percentage of spontaneous alternation, defined as the arm choices/total choices ratio, was measured 16.
Before drug treatment, the TAA-treated rats with water-finding test score > the mean ±1.96·SD or Y-maze test value > the mean ±1.96·SD were categorized into the MHE group (n =4 4).
Animal treatment
For Thrombopoietin receptor agonist eltrombopag (ELT, Selleck Chemicals #S2229) administration, MHE rats were conducted oral administration (0,5,25mg/kg). For TPO or MPL overexpression, 2 μL TPO- or MPL-overexpressing plasmids or control plasmids pCMV-Tag2A (0.5 μg; Santa Cruz, CA, USA) was injected into the right lateral ventricles of MHE rats at a rate of 0.1 μL/min. After water-finding and Y-maze tests, rats were anaesthetized with isoflurane and decapitated. The hippocampus and cerebral cortex were collected immediately and stored at -80 ºC until use.
Cell culture and treatment
Primary rat hippocampal neurons (PHNs) were derived from the hippocampus and cerebral cortex, respectively, from 1-day-old Sprague-Dawley rat pups via trypsin and DNase digestion. PHNs were seeded in poly-L-lysine-precoated six-well plates at a density of 2 × 106 cells/well and cultured in Neurobasal® medium supplemented with 0.5 mM GlutaMAX™-I, B-27® 17. For dose-response analysis, PHNs and PC12 cells were treated with Thrombopoietin receptor agonist eltrombopag (ELT, Selleck Chemicals #S2229) (0, 6.25, 12.5, 25 μM), Recombinant human Thrombopoietin protein (ab217448) (0, 50, 100, 200 ng/mL) or NRG1 (abcam, ab242321) (0, 1, 5, 20 ng/mL) for 24 h. For time-response analysis, the cells were treated with 12.5 μM ELT or NRG1 for 0, 6, 12, 24, 48, or 72 h. To explore the effects of the antibody and inhibitors, the cells were pretreated with 10 μg/mL anti-NRG1 mouse monoclonal antibody or mouse IgG, 50 μmol/L ErbB4 inhibitor AG1478, or 10 μmol/L sirtuin 1 (Sirt1) inhibitor sirtinol (Origene, Rockville, MD, USA) for 24 h, followed by ELT or NRG1 treatment for an additional 24 h. In the loss-of-function assay, cells were transfected with 0.25 μg small interfering RNA (siRNA) against NRG1, siRNA against ErbB4, or scrambled siRNA (Santa Cruz, CA, USA), followed by ELT (12.5 μM) treatment for an additional 24 h.
Semi-quantitative PCR and real-time quantitative PCR (qRT-PCR)
For semi-quantitative PCR, cDNA was synthesized from the total RNA using omniscript reverse transcriptase (Qiagen, Hilden, Germany), followed by PCR amplification using Taq DNA polymerase (Sigma-Aldrich).
For qRT-PCR, the cDNA was obtained using an iScriptTM cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) from the mRNA collected from tissue samples. RT-PCR was performed using an iQTM SYBR®Green Supermix (Bio-Rad) on a CFX96 Touch system (Bio-Rad) according to the manufacturer’s instruction. GAPDH was used as an internal reference. The primers (Invitrogen, Carlsbad, CA, USA) were as follows: NRG1, 5'AATGGACAGCAACACAAG3' (forward) and 5'TTAGCGATTACACTAGACAG3' (reverse);
TPO, 5'GAAGAGCGACCCTCACATCAAG3' (forward) and 5'CTGCCCAGTTCGTTTCAGTG3' (reverse); GAPDH, 5'TGTCATCAACGGGAAGCCCA3' (forward) and 5'TTGTCATGGATGACCTTGGC3' (reverse).
Measurement of ammonia levels
A total of 300–800 mL 0.4 M HClO4 containing 0.1 % (w/v) Na2S2O5 was added to the liver/serum/hippocampus samples. The mixture was homogenized by sonication (Labsonic-U; Braun, Kronberg, Germany), followed by centrifugation at 200,009 g for 15 min at 4 °C. The aliquots of the supernatants were taken for the analysis of ammonia using high-performance liquid chromatography with electrochemical detection using modifications in the mobile phase.
Measurement of NRG1 secretion
The NRG1 levels in the culture medium of primary neurons were measured using high sensitivity sandwich enzyme-linked immunosorbent assay (ELISA) kits (ab213902, abcam) according to the manufacturer’s instructions. The NRG1 levels were determined using a Multiskan MCC plate reader (Thermo Fisher Scientific, Waltham, MA, USA).
Western blot analysis and co-immunoprecipitation (Co-IP) assay
The total proteins was obtained from homogenized tissue samples or cells and determined using a Bradford quantification assay (Bio-Rad). The protein samples were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore, Bedford, MA, USA). After blocking with 5% (w/v) non-fat dry milk in phosphate-buffered saline (PBS), the membrane was incubated overnight at 4 ºC with primary antibody against ErbB4, phosphorylated ErbB4 (pErbB4), ErbB2, pErbB2, NRG1, TPO, Sirt1, syntaxin, Homer, or β-actin (Abcam, Cambridge, UK), followed by incubation with horseradish peroxidase-conjugated secondary antibodies (Pierce, Thermo Fisher Scientific) for 1 h at room temperature. The blots were developed using ECL reagent (Amersham, Arlington Heights, IL, USA) and exposed to a Kodak Biomax film.
For Co-IP assay, the lysates of tissue samples or cells were incubated with above mentioned antibodies overnight at 4°C, followed by incubation with protein G-agarose beads (Millipore) for an additional 5h at 4 °C. The beads were washed with lysis buffer. The eluent was separated by SDS-PAGE and transferred to a PVDF membrane to probe proteins using primary and secondary antibodies mentioned above.
Functional labeling of presynaptic boutons with FM4-64
The primary neurons were incubated with 5 mg/mL FM4-64 (Invitrogen) and 50 mM KCl in Hanks’ balanced salt solution for 1 min at 4°C. After reaction, free FM4-64 was removed by washing with Hanks’ balanced salt solution. Images were acquired using Leica TCS SP8.
Immunofluorescence staining
Brain tissue sections or glass coverslips were fixed with 4 % paraformaldehyde for 30 min and then incubated with 0.1% Triton X-100 for 10 min at room temperature. After blocking with PBS containing 5% normal goat serum for 1 h at room temperature, the sections or coverslips were incubated with the primary antibody against ErbB4, NRG1, TPO, Sirt1, syntaxin, Homer, or MAP2 (Abcam) overnight at 4 °C, followed by incubation with Alexa Fluor 488 (green)- or Alexa Fluor 594 (red)-conjugated secondary antibody (Abcam) for 1 h.
For dendritic spine analysis, the primary neuron coverslips were incubated with the primary antibody against microtubule-associated protein 2B (MAP2B; 1:200; BD Transduction Laboratories, San Jose, CA, USA) or vesicular glutamate transporter 1 (vGlut1; 1:100; Neuromab, Davis, CA, USA) overnight at 4 °C, followed by incubation with Alexa Fluor 488 (green)- or Alexa Fluor 594 (red)-conjugated secondary antibody (Abcam) for 1 h. At least 10 primary neurons per coverslip were used for quantitative analysis.
Electrophysiological Analysis
Rats were anaesthetized with isoflurane and decapitated. The hippocampus was cut into 400-mm thick transverse slices using a vibratome. After an incubation in artificial cerebrospinal fluid (a-CSF) at room temperature for 60–90 min, the slices were placed in a recording chamber on the stage of an upright microscope (Olympus CX-31) and perfused with a-CSF (containing 1 mM MgCl2) at a rate of 3 mL per min at 23–24℃. A 0.1 MΩ tungsten monopolar electrode was used to stimulate the Schaffer collaterals. The field excitatory postsynaptic potentials (fEPSPs) were recorded in CA1 stratum radiatum using a glass microelectrode filled with a-CSF with resistance of 3–4 MΩ. The field potential input-output curves were generated by measuring fEPSP slope responding to the stimulus intensity increased from 1 to 7 V, with an 0.5 V increment. The long-term potentiation (LTP) of fEPSPs was induced by 3 theta-burst stimulation (4 pulses at 100 Hz) with a 200-ms interval. The paired-pulse facilitation was examined by applying pairs of pulses, which were separated by 20–500 ms intervals. The magnitudes of LTP are expressed as the mean percentage of baseline fEPSP initial slope.
Statistical analysis
Data were expressed as mean ± standard deviation. Statistical analysis was performed using SPSS 18.0 (IBM, Armonk, NY, USA). Differences between groups were compared using one-way analysis of variance, followed by Dunnett’s post hoc multiple comparison test. The P values were adjusted using Bonferroni correction. A P value < 0.05 was considered statistically significant.