Effects of Corn oligopeptide on Dexamethasone-induced muscle atrophy in Sprague-Dawley rats

doi:10.21203/rs.3.rs-2118655/v1

Download PDF

Research Article

Effects of Corn oligopeptide on Dexamethasone-induced muscle atrophy in Sprague-Dawley rats

https://doi.org/10.21203/rs.3.rs-2118655/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Corn oligopeptide (COP) derived from corn gluten meal (CGM) was proved to possess plenty of biological properties. However, there is no scientific evidence to support that COP can ameliorate muscle atrophy. To find a new therapeutic nutritional substrate of muscle atrophy, we investigated the anti-myopathy effects of COP in DEX-inducted rat muscle atrophy model and tried to explore the underlying mechanisms. Co-administration of COP (2.0g/kg.bw) with DEX for 5 weeks reversed DEX-induced reduction in gastrocnemius (Gas) and plantaris (Pla) muscles weight, grip strength, exercise tolerance and myofiber cross sectional area (CSA) of soleus (Sol), up-regulated the protein levels of Phospho-Akt and mTOR that are closely relate to protein synthesis, and down-regulated the expression of FoxO3a, NF-κBp65, Atrogin-1, MuRF-1, LC3 and ULK1 that are the key components of Ubiquitin–proteasome system and Autophagy that activate proteolysis. In addition, according to muscles weight, grip strength, exercise tolerance changing over experiment time, we found the three indexes were all improved at 3rd week. Therefore, we conclude that the optimal duration for COP to improve DEX-induced muscle atrophy might be 3 weeks, and mechanistically, COP activates protein synthesis through Akt/mTOR pathway, while inhibits proteolysis by inactivating the expression of Ubiquitin proteasome system (UPS) and Autophagy.

Corn oligopeptide

Muscle atrophy

Dexamethasone

Rat

Muscle atrophy has been defined as a progressive and generalized skeletal muscle disorder, characterized by the accelerated loss of muscle mass and function, which occurs in various conditions such as denervation, disuse, fasting, excessive glucocorticoid treatment¹. It has been widely recognized that an excess of proteolysis over protein synthesis in muscle cells reduces myofiber CSA and lowers muscle mass, resulting in muscle atrophy. Proteolysis is mostly regulated by two vital pathways: autophagy-lysosomal and ubiquitin-proteasomal pathways, and muscle atrophy is strongly correlated with abnormal activation of the two systems ². A rapidly aging population around the world leads to an increase in the number of patients suffering from muscle atrophy. According to the latest definition of muscle atrophy, the incidence of that reach 1.6% in European aged 40–79 years³, and 9.8% in Chinese aged 60 + years⁴. Muscle atrophy substantially increases the risks of falls, functional decline, and frailty, resulting in elevating health care burden. Therefore, it is urgently needed to find effective treatments that cure muscle atrophy.

Currently, the clinical therapies of muscle atrophy mainly focus on pharmacological and non- pharmacological approaches. At present, it is a pity that no specific drugs have been approved in the treatment of muscle atrophy. A review analyzed some pharmacological treatments to ameliorate muscular atrophy symptoms: growth hormone-releasing hormone, vitamin D, testosterone, growth hormone, dehydroepiandrosterone, and so on, and concluded that only vitamin D and testosterone shown improvement effect in daily clinical practice⁵. Non-pharmacological approaches are mainly including resistance exercise⁶ and nutritional intervention⁷. Among in of which, resistance exercise is proved to be valid in accelerating muscle mass rehabilitation following muscle atrophy. Whereas, there is a nonnegligible flaw that it is inadaptable for the bedridden and elderly patients. Therefore, nutritional intervention has become the primary treatment for muscle atrophy. Omega-3 fatty acid that is one of essential fatty acids and cannot be synthesized by our body has been reported to attenuate skeletal muscle atrophy in young women through promoting myofibrillar muscle protein synthesis⁸. Moreover, numerous studies have shown that HMB, a leucine metabolite, enhances muscle protein turnover in experiments on animals and populations^9–11. Notably, among masses of nutritional treatments, bioactive peptides that generally are composed of between 3–20 amino residues exhibit various physiological benefits¹².

Corn oligopeptide (COP), a low molecular weight peptide, containing a large percentage of branched chain amino acids (BCAA), hydrophobic amino acids, neutral amino acids and small amounts of alkaline amino acids such as lysine, has been reported to possess various physiologic functions including lowering blood pressure, anti-fatigue effect, anti-inflammatory effect and protecting the liver^13–15. However, the effect of COP on muscle atrophy has been yet retain unclear. Therefore, in this study, we investigated the effects of COP on DEX-induced muscle atrophy and its possible molecular mechanism. Firstly, we explored the optimum duration of improvement effects of COP on muscle atrophy in DEX-treated rats. Subsequently, we explored the possible mechanism by which COP ameliorates DEX-induced muscle atrophy. Our data may provide theoretical support for exploring new bioactive functions of COP and new nutritional substrates for precise clinical interventions of muscle atrophy.

2.1 Reagents

The COP that is light yellow powder, was prepared by Zhejiang Haishi Biotechnology Co., Ltd (Zhoushan, China). DEX was procured from Solarbio Science & Technology Co., Ltd (Beijing, China), the purity is more than 98%.

Antibodies against FoxO3a, Phospho-FoxO3a (Ser253), MyoD, NF-κBp65, Akt, mTOR, GAPDH, Phospho-Akt and Pax7 were respectively purchased from HuaBio (Hangzhou, China), Cell Signaling Technology (Massachusetts, USA), Abcam (London, UK), Proteintech (Wuhan, China). The secondary horseradish peroxidase (HRP) antibodies (Anti-rabbit and anti-mouse) were bought from Elabscience Biotechnology Co., Ltd (Wuhan, China). The extraction of RNA was performed by Animal Total RNA Isolation Kit of Vazyme (Nanjing, China), and subsequently RNA reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) experiments were carried out by Iscript cDNA Synthesis Kit (Bio-Rad, USA) and Real Time PCR EasyTM-AYBR GreenⅠ Kit (Foregene, China). The other reagents used were all commercially available.

2.2 Animal

One hundred and twelve SD male rats (specific pathogen-free, 6–7 weeks old, 240-260g) were bought from Charles River Laboratory Animal Technology Company (Beijing, China, Permit No.: SCXK [zhe]2019–0001). All rats were raised in the SPF Animal Center of West China School of Public Health of Sichuan University (25℃±2℃; 50–60% humidity; 12 h light/dark cycle, Permit No.: SYXK [chuan] 2018–011). Animal experiments and care were conducted according to the West China Hospital Sichuan University Guide for the Care and Use of Laboratory Animals and were approved by the Animal Ethics Committee of our Institute (Animal ethical approval No.: 20211548A). Prior to the experiments, rats were fed a standard laboratory pellet diet and water ad libitum for five days to acclimate.

2.3 Experimental Scheme

In order to successfully construct an animal model of muscular dystrophy, rats were randomly divided into two groups: CON group (n = 40) and Model group (n = 72) before the COP intervention. Rats in the Model group were administrated with 1.0mg/kg DEX by intraperitoneal injection once a day for 2 weeks, whereas rats in CON group were administrated with saline. The duration and dose of DEX in order to induce of skeletal muscle atrophy were adopted on the basis of previous study¹⁶. After a 2-week model building stage, to determine whether the success of the model or not, eight rats from CON group and Model group respectively were sacrificed to measure body composition, grip straight and muscle weight. Subsequently, rats in the Model group were randomly divided into two groups (n = 32 each group): DEX group (0.5mg/kg DEX by intraperitoneal injection and normal diet), DEX + COP group (0.5mg/kg DEX by intraperitoneal injection and 2.0g/kg COP by intragastric administration). The stage of COP intervention lasted for 5 weeks. The duration and dose of COP were selected based on our previous study. The reason of halving the dose of DEX at COP intervention stage was an increase in mortality after 2-week DEX treatment, and DEX at a dose of 0.5mg/kg is also frequently used in the construction of muscle atrophy models¹⁷. Body weights were recorded twice every week. The protocol of entire experimental is presented in Fig. 1.

At the dissection days, after the rats were fasted overnight, they were anesthetized with sodium pentobarbital (30 mg/kg) by intraperitoneal injection, and whereafter their gastrocnemius (GA), soleus (Sol), tibialis anterior (TA) and plantaris (Pla) muscles were speedily anatomized, weighed, snap frozen in liquid nitrogen and stored at − 80 ℃ (muscles collected for follow-up experiments).

2.4 Body composition

Body composition was assessed with an EchoMRI™ 2012 analyzer (USA) in model building stage rats. Rats were placed into a transparent measuring tube containing small holes for air exchange in the wall at the end of the tube. To minimize movement while the measurement is taking place, rats were restrained by introducing another tube with a smaller diameter.

2.5 Skeletal muscle function tests

The grip strength was estimated by measuring peak force of forelimbs grip using a Grip Strength Meter (YLS-13A; Jinan Yiyan Science & Technology Development Co., Ltd, China). In brief, a rat was held by the base of its tail between the thumb and the forefinger and placed with its forelimbs on the metal sensors of the Grip Strength Meter. When the rat was grasping properly with forelimbs, it was pulled along a straight line leading away from the sensor until the grip was released. A total of five trials were performed with at least 15 min break between trials. For each rat, the maximum and minimum values of five trials are removed and the remaining 3 values are averaged as its grip force value.

The exercise tolerance test was performed on a six-lane open treadmill system (Jiangsu SANS Biological Technology Co. Ltd., Jiangsu, China). On the testing day, Maximum endurance was evaluated by letting the rats run on a treadmill with 5° inclination using a long duration incremental step protocol: 5 min at 15 m/min, 5 min at 20 m/min, 20 min at 25 m/min and 70 min at 30m/min. Exhaustion was determined by the rats failing to remain on the treadmill belt despite a mild electric stimulus (2mA) or completing the duration incremental step protocol. Maximum running capacity was estimated using two parameters: the distance ran (m), the duration of the run (h). To ensure the reliability of the experimental data, the six channels of the treadmill were placed in different groups rats respectively during every exercise tolerance experiment.

2.6 Muscle weights

The hindlimb skeletal muscles (GA, Sol, TA, Pla) were excised and weighed under anesthesia. The muscle weights were adjusted by wet muscle weight/fasting body weight *100.

2.7 Myofiber cross-sectional area (CSA) measurement

After fixed, processed, and embedded, muscle tissues were sliced into 5–7µm thick transverse sections by an automated microtome (Thermo Fisher, USA), and installed on slides. Subsequently, hematoxylin and eosin (H&E) was implemented to stain these samples, and slides were scanned by light microscopy (UNIC TECHNOLOGIES INC, China). Finally, to determine muscle fiber CSA, Image Pro Plus software (Bethesda, MD, USA) was performed to measure 60 muscle fibers from 3 random fields (n = 6 mice per treatment).

2.8 Quantitative real-time PCR

Following the manufacturer's protocols, animal total RNA isolation kit was used to extract total RNA from the samples and purity was evaluated using the NanoDrop TM 2000 (A260/A280 and A260/A230 values were > 1.9, Thermo Fisher). Reverse transcription was performed using the Iscript cDNA Synthesis Kit as directed by the manufacturer. Primer sequences of target genes were commercially designed and synthesized by Sangon Biotech Company (Table 1). In a CFX96 Real-Time PCR Detection System (Bio-Rad, USA), the following conditions were performed to amplify the genes using Real Time PCR EasyTM-SYBR Green I kits (Bio-Rad, USA): 3 min of enzyme activation at 95°C, followed by 40 cycles of denaturation at 95°C for 10 s, and then 30 s of annealing and extension at 65°C. To confirm primer specificity, the melting curve was routinely established at 65°C-95°C for 5 s. The GAPDH gene was used as an internal control. Relative gene expression levels were determined using the comparative ∆∆CT method: ∆CT = CT (target gene) − CT (GAPDH gene). ∆∆CT=∆CT (treatment group) −∆CT (CON group). Lastly, the relative levels of mRNA expression for the target-genes were determined using the 2^−∆∆CT method and displayed as fold changes compared to the CON group.

Table 1
Primer sequences used for RT-PCR (5′-3′)
Gene	Sequences	Amplicon (bp)
FoxO3	Forward: CCTTCCGTAAGCAAGCCGTGTAC Reverse: TGGTCTGTTCTCCTGGATGGTCTG	303
Atrogin-1	Forward: ACTACGATGTTGCAGCCAAGAAGAG Reverse: AGGATGTGTAGAGGGTCTGGAGAAG	363
MuRF-1	Forward: GTTTGACGCCCTCTACGCCATC Reverse: CTTGATCCTCCTCCTCCTCCTCTTC	389
LC3-Ⅰ	Forward: GAGCGAGTTGGTCAAGATCATCCG Reverse: GATGTCAGCGATGGGTGTGGATAC	115
ULK1	Forward: GGTTCTGTACTTGAAGGTGGCTGAG Reverse: ATGTCTGCCTGGTCCGTGAGAG	381
GSK-3β	Forward: GGCTGTGTGTTGGCTGAATTGTTG Reverse: AAAGTTGAAGAGGGCAGGTGTGTC	357
p70^S6K	Forward: CGTGCTGTGGATTGGTGGAGTC Reverse: AGAGTTGAGTCATCGGGGCTGTC	386
GAPDH	Forward: GTCCATGCCATCACTGCCACTC Reverse: CGCCTGCTTCACCACCTTCTTG	264

2.9 Western blot analysis

Muscle tissue that was preconditioned by rinsing 2–3 times with a pre-cooled PBS buffer to remove blood and cut into small pieces was homogenized in RIPA buffer (P0013D, Beyotime) using a homogenizer (KZ-Ⅲ-FP, Servicebio,). Subsequently, transferring the homogenate to the centrifuge tube, icing bath for 30 min, and the supernatant was gained by centrifugation at 12000 rpm at 4℃ for 5 min as the total protein solution. Subsequently, protein concentration was measured with the PierceTM Rapid Gold BCA Protein Assay Kit (A53225, Thermo Fisher), and samples concentration were unified according to the minimum concentration using RIPA buffer, added 1/4 volume loading buffer that included SDS (#S8010-500g, Solarbio), boiled for 5 min at 100°C. Equal amounts of protein were separated on Precast Protein Gels (10% separation gel and 5% concentration gel, G2003-50T, Servicebio) and transferred on PVDF membranes (IPVH00010, Millipore). Membranes were blocked for 1 h in 5% milk (5 g skim milk powder was dissolved into 100 ml TBS-T that contained Tris-buffered saline and 0.1%Tween 20) before overnight incubation at 4°C and shaken with the following antibodies: GAPDH (1:10000 in 5%BSA, ab8245, Abcam), NF-κBp65 (1:1000 in 5%BSA, #8242, CST), mTOR (1:1000 in 5%BSA, ab32028, Abcam), Phospho-FoxO3a (1:5000 in 5%BSA, ET1609-49, Huabio), FoxO3a (1:1000 in 5%BSA, ER1706-79, Huabio), Phospho-Akt (1:10000 in 5%BSA, 66444-1-Ig, Proteintech), Akt (1:1000 in 5%BSA, #4691, CST). After TBS-T washing, membranes were incubated with peroxidase-conjugated secondary antibodies (1:3000 in 5% milk, Elabscience) for 1 h at RT, followed by antibody binding detection using chemiluminescence horseradish peroxidase substrate detection kits (ECL, 170–5060, Bio-Rad) and Chemiluminescence imager (Monad, China). The optical density of the target bands was analyzed by ImageJ software 8.0 (NIH, USA). Relative protein levels were determined by normalizing the band intensity of the target to the loading control (GAPDH) within one gel.

2.10 Immunofluorescence staining of MyoD and Pax7 in TA muscles

After being fixed in 4% paraformaldehyde for 48 hours, muscle sections were embedded in paraffin. Two representative sample from each group was stained with Immunofluorescence. Muscle sections were deparaffinized and hydrated routinely. For antigen retrieval, slices were dissolved in a 50X TRIS-EDTA buffer (pH 9.0, BL617A, Biosharp) and heated for 23 minutes in a microwave oven (Midea, China).To eliminate the interference of tissue own fluorescence, muscle sections were dropped into tissue autofluorescence quench solution A, and incubated at RT for 30 min. Followed by sections were blocked with 5% normal goat serum (primary liquid: PBS = 1:19) for 30 min at RT and incubated with anti-MyoD (1:200, 18943-1-AP, Proteintech) and anti-Pax7 (1:100, ET1612-60, Huabio) primary antibodies overnight at 4℃. Whereafter, at RT, the sections were incubated with secondary antibody (CY3 labeled goat anti-rabbit (BS-0295G-Cy3, 1:500, Bioss) for 50 minutes. For staining nuclei, sections were counterstained with 4,6-diamidino-2-phenylindole (DAPI) (BS097, Biosharp) in PBS for 10 minutes, followed by dropping again with tissue autofluorescence quench solution B for 5 min, and washing with running water for 3 min. Finally, sections were mounted using mounting medium (Solarbio). Three random microscopic fields from each sample were photographed with a fluorescence microscope (Beijing Century Science Instrument Co., LTD, China), according to DAPI emitted bule light (UV excitation wavelength of 510–560 nm, emission wavelength of 420 nm), and CY3 emitted red light (UV excitation wavelength of 330–380 nm, emission wavelength of 590 nm). Image-pro Plus 6.0 software was used to calculate the percentage of MyoD and Pax7 positive cells in TA muscle sections.

2.11 Statistical analysis

All data was expressed as mean ± standard deviation (SD) and was performed statistical analysis using IBM SPSS 26.0 (USA). At the model building stage, t-test was implemented to compare differences between CON group and Model group. At the intervene stage, the one-way analysis of variance (ANOVA) was used for analyzing the total differences between groups, and when P<0.05, Dunnett-T was used to further compare the difference between DEX group and other two groups.

3.1 DEX successfully induced muscle atrophy

DEX is a potent synthetic glucocorticoid that is widely used because of its powerful anti-inflammatory, anti-nausea and immunosuppressive properties, while prolonged or excessive use of dexamethasone can be accompanied by side effects such as muscle weakness. The large number of studies have reported that DEX-induced muscle atrophy is characterized by reduced muscle mass, myofiber CSA and type II muscle fiber-specific atrophy¹⁸. According to these pathological characteristics, we chosen intraperitoneal injection of DEX to induce muscle atrophy as an animal model. Consistent with those reported previously¹⁹, our date shown that the body weight of Model group rats was significantly decreased compared with that of the CON group (Fig. 2A). Moreover, DEX significantly decreased the lean body mass (Fig. 2B), grip strength (Fig. 2C) and Gas, Sol, TA and Pla muscles weight (Fig. 2D) during model building stage. These results indicated that we successfully induced muscle atrophy.

3.2 Improvement effects of COP on muscles weight and sol myofiber CSA in DEX-induced skeletal muscle atrophy rat model

To investigate whether COP can ameliorate DEX-induced muscle atrophy, rats in Model group were treated either with DEX or DEX + COP for 5 weeks after successfully modeling.

Our results showed that DEX reduced Gas muscle weight compared with CON group at 3rd and 4th weeks, while administration of COP to DEX significantly increased Gas (3rd and 4th weeks) and Pla (3rd week) muscles weight (Fig. 3A, B), although during the trial, the body weight failed to show difference between DEX group and DEX + COP group (Fig. 3C).

Next, we performed histological analysis to examine the effects of COP on myofiber in the end of experiment (Fig. 3D). As we expected, analysis of myofiber CSA showed that DEX reduced the proportion of larger myofibers (> 1500 µm²) in Sol muscle, but increased the proportion of smaller myofibers (< 1500 µm²). In stark contrast, administration of COP to DEX reduced the proportion of smaller myofibers (< 2500 µm²), but increased in the proportion of larger myofibers (> 2500 µm²) (Fig. 3E). Consistent with this, the average Sol myofiber CSA of DEX + COP group was significantly increased, when compared with DEX group (Fig. 3F).

3.3 COP alleviates DEX-induced recession of skeletal muscle function

To gain further insights into the effects of COP on skeletal muscle function in DEX-induced muscle atrophy model, grip strength and exercise tolerance tests were conducted throughout the experiment's duration by using the devices as Fig. 4A Ι and Ⅱ. As we expected, treatment with DEX significantly decreased grip strength starting from 3rd week compared with CON group, while co-administration of COP with DEX progressively normalized muscle function compared with DEX-treated rats (Fig. 4B). Similarly, the exercise tolerance of the rats that were intervened with COP was clearly improved, as running distance covered (Fig. 4C) and time to exhaustion (Fig. 4D) were both significantly longer than DEX-treated rats during 2–4 weeks of intervene stage. So far, according to the results of muscle weight and muscle function, we speculated that the optimal duration for COP to improve DEX-induced muscle atrophy might be 3 weeks.

3.4 The effect of long-term use of COP on protein synthesis and proliferation of SCs in DEX-induced muscle atrophy model.

What’s more, to investigate the mechanism of long-term use of COP on ameliorating DEX-induced muscle atrophy, we next analyzed the expression levels of Akt, mTOR and p70^S6K in the Gas and TA muscles at end of the experiment, which is activated has been shown to promote skeletal muscle hypertrophy. Indeed, in this research, treatment of rats with COP leaded to a considerable augmentation in the level of Phospho-Akt (Fig. 5A and B). As mTOR is the key downstream factor of Akt and activated by Phospho-Akt, we next explored the expression level of mTOR. We noted the protein level of mTOR in DEX + COP group markedly overtop that in DEX group (Fig. 5A and C). However, we failed to observe the mRNA level of p70^S6K that is the downstream factors of mTOR in DEX + COP group shown significant difference compared with DEX group (Fig. S1A). These data indicated that COP promoted skeletal muscle hypertrophy through activating Akt/ mTOR pathways.

On the other side, to determine the effect of COP on proliferation of SC, the numbers of nucleus positive for MyoD and Pax7 (markers of the SCs) in TA muscle were analyzed with immunohistochemistry staining. This assay revealed numbers of nuclei positive for MyoD and Pax7 in DEX + COP group tended to increase compared with DEX group, although statistically insignificant (Fig. 5D-F).

3.5 The effect of long-term use of COP on protein breakdown in DEX-induced muscle atrophy model.

As the Akt pathway is closely linked to protein degradation through ubiquitination and Autophagy, we next analyzed the expression levels of FoxO3a, NF-κB p65, Atrogin-1, MuRF-1, LC3 and ULK1. Subsequent analysis revealed an observably down-regulation in the mRNA level of FoxO3a (Fig. 6A), as well as increased protein levels of inactive Phospho-FoxO3a (Fig. 6B) upon treatment with COP. Simultaneously, we found a significant reduction in the mRNA levels of MuRF-1 and Atrogin-1 following COP treatment (Fig. 6C and D). The protein level of NF-κB p65 in DEX + COP group significantly was also lower than DEX group (Fig. 6E). Furthermore, the mRNA levels of LC3 and ULK1 that are related to Autophagic vesicles formation in DEX + COP group were markedly lower than those in DEX group (Fig. 6F and G).

COP, containing a high proportion of branched chain amino acids, exhibits various biological effects including anti-inflammatory effect, anti-fatigue effect, lowering blood pressure and protecting the liver. In the present study, we investigated the improvement effect of COP on skeleton muscle atrophy and elucidated its potential mechanism. The data showed that COP treatment increased the muscle weight, myofiber CSA, skeletal muscle function, the activity of Akt and mTOR, but decreased the expressions of FoxO3a, NF-κBp65, LC3, ULK1, Atrogin-1 and MuRF-1. This study demonstrates, for the first time that COP offers an amelioration role against DEX-induced muscle atrophy possibly through activating Akt-mediated mTOR pathway, while inhibiting UPS and Autophagy systems.

The UPS system plays an important role in proteolysis especially skeletal muscle protein, and increase expression of two E3 ubiquitin ligases including MuRF-1 and Atrigin-1 is the key indicator of UPS activation. Animal and cell experiments have shown that the expression of the two genes was up-regulated during DEX treatment^20,21, and their transcription are regulated by FoxO3a that is one of the FoxO family of transcriptional regulators²². During muscle atrophy, FoxO3a activity is in connection with location, and only after being de-phosphorylated, it can be allowed entry into the nucleus^23,24. Increasing studies have reported that inactivation of FoxO3a can block the transcription of Atrogin-1 and MuRF-1 under some muscle atrophic conditions^25,26. Further, Akt is the upstream factor of FoxO3a, and increased phosphorylation levels of Akt inhibit FoxO3a and prevent it from entering nuclei^27,28. In our experiment, COP increased the phosphorylation levels of Akt, accompanying by increase in the protein levels of phosphorylated-FoxO3a and decrease in mRNA levels of FoxO3a, Atrogin-1 and MuRF-1. Moreover, NF-κBp65 is the anther regulator of MuRF-1, which is controlled by TNF-α²⁴. Previous studies have reported blocking NF-κBp65 is sufficient to prevent muscle atrophy, possibly in part, through decreased the expression of ubiquitin-ligase MuRF-1²⁹. Indeed, in this study, COP down-regulated the expression levels of NF-κBp65 and MuRF-1. According to above-mentioned data, we guess that COP can inhibit protein breakdown possibly through reducing the activity of UPS.

On the other hand, Akt is not only involved in FoxOs-mediated protein degradation, but also regulates mTOR to promote protein synthesis though the IGF-1/PI3K/Akt pathway^30,31. mTOR, a serine threonine protein kinase, is the downstream factor of Akt, and its activity is tightly regulated by amino acid especially BCAA availability to the mammalian cells³². It has been known that the elevated expression levels of mTOR can lead to phosphorylation of p70^S6K that activates its downstream factor ribosomal protein S6, resulting in protein synthesis^24,33. Simultaneously, mTOR inhibits protein breakdown by blocking autophagy via ULK1 and LC3^34–37. Increasing studies have shown that, during muscle atrophy, the phosphorylation level of mTOR were down-regulated, while some amino acids intervene (such as BCAA) can up-regulate the phosphorylation rate of mTOR³⁸, which is consistent with our current findings. COP significantly elevated the protein expression of mTOR, and reduced the mRNA levels of LC3 and ULK1, though the mRNA levels of p70^S6K did not show significant increase. The results motivated us to suppose that the mechanism by which COP promote muscle protein synthesis involve activating the Akt/mTOR axle but independent of p70^S6K, as well as restraining autophagy system. In addition, we fortuitously found the mRNA levels of Gsk3β in Gas muscle was down-regulated under COP treatment (Fig. S1B), which is another key Akt mediated downstream pathway and independent of mTOR. Gsk3β has been known to suppress protein synthesis by inhibiting eukaryotic transcription factor 2B-dependent translation, and inhibition of protein degradation by Gsk3β inhibitors is associated with the blockade of the upregulation of atrogin-1 and MuRF-1 gene expression^39,40. Thus, the down-regulated mRNA levels of Gsk3β suggested that COP also inhibited protein breakdown possibly through Akt/Gsk3β pathway. Whereas, further researches are needed to unravel the function of the specific downstream factors of the Akt/ Gsk3β pathway under COP treatment.

In addition to the signaling pathways involved in muscle atrophy, we further investigated the effects of COP on SCs in DEX-induced muscle atrophy. In our experiment, COP failed to cause significantly changes the numbers of nuclei positive for MyoD and Pax7, indicating that the proliferation of SC played little role in COP against DEX-induced muscle atrophy.

Increasing evidences have shown that oligopeptides and their metabolites improve muscle atrophy, because of some advantages such as small molecular weight, fast digestion, low energy consumption, and less competition with free amino acids absorption⁴¹. Thus, we supposed that the reason why COP ameliorating muscle atrophy might function as quickly supplement nutritional substrates. For another thing, COP is rich in BCAA, glutamic acid and alanine, these amine acids especially BCAA can significantly improve most causes-induced muscle atrophy in both human and animal experiments⁷. Therefore, we also thought that the main bioactive compounds responsible for COP’s beneficial outcomes may be these specific amine acids.

In present study, we demonstrated that COP has the capacity to ameliorate DEX-induced muscle atrophy through inhibiting expression of the components of the UPS and Autophagy systems with relation to proteolysis, and activating the Akt/mTOR pathway in connection with protein synthesis. The optimal duration of COP intervention for DEX-induced muscle atrophy perhaps be 3 weeks, based on the muscle weight, grip strength and exercise tolerance tests. These findings mean that COP might be a potential oligopeptide for integration into nutritional interventions as a substrate to protect against skeleton muscle atrophy.

Supplementary Materials: Figure S1: The effect of long-term use of COP on the mRNA levels of P70 S6K and Gsk3β in DEX- induced muscle atrophy model. Figure S2: The original, uncropped and unadjusted the Western blots image. Table S1: The gray value data in Western blots analysis. Table S2: The information COP in this study. Table S3: Component of the Quantitative real-time PCR reaction system.

Ethical Approval: The study was conducted in accordance with the guidelines of the West China Hospital Sichuan University Guide for the Care and Use of Laboratory Animals and approved by the Animal Ethics Committee of our Institute (Animal ethical approval No.: 20211548A).

Competing interests: Not applicable.

Author Contributions: Conceptualization, W.H and J.Y.; methodology, Y.W., J.G.; software, Y.W. and Z.Z.; validation, W.H., L.S.; formal analysis, Y.W.; data curation, Y.W.; writing—original draft preparation, Y.W.; writing—review and editing, Y.W., W.H., J.Y.; supervision, W.H., L.S.; project administration, W.H., L.S.; funding acquisition, W.H. All authors have read and agreed to the published version of the manuscript.

Funding: This research was funded by the Key Research and Development Program of China that “Modern Food Processing and Grain collection, Storage and Transportation Technology and Equipment” Key Special “Nutrition Functional Food Manufacturing Technology Research and New Product Development” [grant number 2016YFD0400600] and the Key Research and Development Program of Sichuan Province that “Development and efficacy evaluation of new compound peptide nutritional functional food based on diabetic sarcopenia” [grant number 22ZDYF1938]

Availability of data and materials: The datasets supporting the conclusions of this article are included within the article and Supplementary Materials. Further inquiries can be directed to the corresponding author.

Cruz-Jentoft AJ, Sayer AA. Sarcopenia. The Lancet. 2019;393(10191):2636-2646. doi:10.1016/s0140-6736(19)31138-9
Sandri M. Protein breakdown in muscle wasting: role of autophagy-lysosome and ubiquitin-proteasome. Int J Biochem Cell Biol. Oct 2013;45(10):2121-9. doi:10.1016/j.biocel.2013.04.023
Gielen E, O'Neill TW, Pye SR, et al. Endocrine determinants of incident sarcopenia in middle-aged and elderly European men. J Cachexia Sarcopenia Muscle. Sep 2015;6(3):242-52. doi:10.1002/jcsm.12030
Gao L, Jiang J, Yang M, Hao Q, Luo L, Dong B. Prevalence of Sarcopenia and Associated Factors in Chinese Community-Dwelling Elderly: Comparison Between Rural and Urban Areas. J Am Med Dir Assoc. Nov 1 2015;16(11):1003.e1-6. doi:10.1016/j.jamda.2015.07.020
De Spiegeleer A, Beckwée D, Bautmans I, Petrovic M. Pharmacological Interventions to Improve Muscle Mass, Muscle Strength and Physical Performance in Older People: An Umbrella Review of Systematic Reviews and Meta-analyses. Drugs Aging. Aug 2018;35(8):719-734. doi:10.1007/s40266-018-0566-y
He N, Ye H. Exercise and Muscle Atrophy. Adv Exp Med Biol. 2020;1228:255-267. doi:10.1007/978-981-15-1792-1_17
Gielen E, Beckwee D, Delaere A, et al. Nutritional interventions to improve muscle mass, muscle strength, and physical performance in older people: an umbrella review of systematic reviews and meta-analyses. Nutr Rev. Jan 9 2021;79(2):121-147. doi:10.1093/nutrit/nuaa011
McGlory C, Gorissen SHM, Kamal M, et al. Omega-3 fatty acid supplementation attenuates skeletal muscle disuse atrophy during two weeks of unilateral leg immobilization in healthy young women. FASEB J. Mar 2019;33(3):4586-4597. doi:10.1096/fj.201801857RRR
Bear DE, Langan A, Dimidi E, et al. β-Hydroxy-β-methylbutyrate and its impact on skeletal muscle mass and physical function in clinical practice: a systematic review and meta-analysis. Am J Clin Nutr. Apr 1 2019;109(4):1119-1132. doi:10.1093/ajcn/nqy373
Noh KK, Chung KW, Choi YJ, et al. β-Hydroxy β-methylbutyrate improves dexamethasone-induced muscle atrophy by modulating the muscle degradation pathway in SD rat. PLoS One. 2014;9(7):e102947. doi:10.1371/journal.pone.0102947
Pimentel GD, Rosa JC, Lira FS, et al. β-Hydroxy-β-methylbutyrate (HMβ) supplementation stimulates skeletal muscle hypertrophy in rats via the mTOR pathway. Nutr Metab (Lond). Feb 23 2011;8(1):11. doi:10.1186/1743-7075-8-11
Jia L, Wang L, Liu C, Liang Y, Lin Q. Bioactive peptides from foods: production, function, and application. Food Funct. Aug 21 2021;12(16):7108-7125. doi:10.1039/d1fo01265g
Zhang F, Zhang J, Li Y. Corn oligopeptides protect against early alcoholic liver injury in rats. Food Chem Toxicol. Jun 2012;50(6):2149-54. doi:10.1016/j.fct.2012.03.083
Li G, Liu W, Wang Y, et al. Functions and Applications of Bioactive Peptides From Corn Gluten Meal. Adv Food Nutr Res. 2019;87:1-41. doi:10.1016/bs.afnr.2018.07.001
Lu L, Liu G, Wang XH, Lou SJ. [Effects of supplement of corn peptides combined with aerobic exercise on lipolysis key enzymes:adipose triglyceride lipase and lipoprotein lipase of obese rats]. Zhongguo Ying Yong Sheng Li Xue Za Zhi. Apr 8 2016;32(4):326-331. doi:10.13459/j.cnki.cjap.2016.04.010
Konno S. Hydroxyl radical formation in skeletal muscle of rats with glucocorticoid-induced myopathy. Neurochem Res. May 2005;30(5):669-75. doi:10.1007/s11064-005-2755-4
Krug AL, Macedo AG, Zago AS, Rush JW, Santos CF, Amaral SL. High-intensity resistance training attenuates dexamethasone-induced muscle atrophy. Muscle Nerve. May 2016;53(5):779-88. doi:10.1002/mus.24906
Schakman O, Kalista S, Barbe C, Loumaye A, Thissen JP. Glucocorticoid-induced skeletal muscle atrophy. Int J Biochem Cell Biol. Oct 2013;45(10):2163-2172. doi:10.1016/j.biocel.2013.05.036
Savary I, Debras E, Dardevet D, et al. Effect of glucocorticoid excess on skeletal muscle and heart protein synthesis in adult and old rats. Br J Nutr. Mar 1998;79(3):297-304. doi:10.1079/bjn19980047
Fappi A, Neves JC, Sanches LN, et al. Skeletal Muscle Response to Deflazacort, Dexamethasone and Methylprednisolone. Cells. May 1 2019;8(5)doi:10.3390/cells8050406
Castillero E, Alamdari N, Lecker SH, Hasselgren PO. Suppression of atrogin-1 and MuRF1 prevents dexamethasone-induced atrophy of cultured myotubes. Metabolism. Oct 2013;62(10):1495-502. doi:10.1016/j.metabol.2013.05.018
Seok YM, Yoo JM, Nam Y, et al. Mountain ginseng inhibits skeletal muscle atrophy by decreasing muscle RING ﬁnger protein-1 and atrogin1 through forkhead box O3 in L6 myotubes. J Ethnopharmacol. Apr 24 2021;270:113557. doi:10.1016/j.jep.2020.113557
Vainshtein A, Sandri M. Signaling Pathways That Control Muscle Mass. Int J Mol Sci. Jul 4 2020;21(13)doi:10.3390/ijms21134759
Sartori R, Romanello V, Sandri M. Mechanisms of muscle atrophy and hypertrophy: implications in health and disease. Nat Commun. Jan 12 2021;12(1):330. doi:10.1038/s41467-020-20123-1
Sandri M, Sandri C, Gilbert A, et al. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell. Apr 30 2004;117(3):399-412. doi:10.1016/s0092-8674(04)00400-3
Senf SM, Dodd SL, McClung JM, Judge AR. Hsp70 overexpression inhibits NF-kappaB and Foxo3a transcriptional activities and prevents skeletal muscle atrophy. Faseb j. Nov 2008;22(11):3836-45. doi:10.1096/fj.08-110163
Yoshida T, Delafontaine P. Mechanisms of IGF-1-Mediated Regulation of Skeletal Muscle Hypertrophy and Atrophy. Cells. Aug 26 2020;9(9)doi:10.3390/cells9091970
Stitt TN, Drujan D, Clarke BA, et al. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. May 7 2004;14(3):395-403. doi:10.1016/s1097-2765(04)00211-4
Cai D, Frantz JD, Tawa NE, Jr., et al. IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell. Oct 15 2004;119(2):285-98. doi:10.1016/j.cell.2004.09.027
Zheng R, Huang S, Zhu J, Lin W, Xu H, Zheng X. Leucine attenuates muscle atrophy and autophagosome formation by activating PI3K/AKT/mTOR signaling pathway in rotator cuff tears. Cell Tissue Res. Oct 2019;378(1):113-125. doi:10.1007/s00441-019-03021-x
Bodine SC, Stitt TN, Gonzalez M, et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol. Nov 2001;3(11):1014-9. doi:10.1038/ncb1101-1014
Liu GY, Sabatini DM. mTOR at the nexus of nutrition, growth, ageing and disease. Nat Rev Mol Cell Biol. Apr 2020;21(4):183-203. doi:10.1038/s41580-019-0199-y
Paturi S, Gutta AK, Katta A, et al. Effects of aging and gender on muscle mass and regulation of Akt-mTOR-p70s6k related signaling in the F344BN rat model. Mech Ageing Dev. Mar 2010;131(3):202-9. doi:10.1016/j.mad.2010.01.008
Sato T, Ito Y, Nagasawa T. Dietary L-Lysine Suppresses Autophagic Proteolysis and Stimulates Akt/mTOR Signaling in the Skeletal Muscle of Rats Fed a Low-Protein Diet. J Agric Food Chem. Sep 23 2015;63(37):8192-8. doi:10.1021/acs.jafc.5b03811
Nakashima K, Ishida A. Regulation of Autophagy in Chick Skeletal Muscle: Effect of mTOR Inhibition. J Poult Sci. Jan 25 2020;57(1):77-83. doi:10.2141/jpsa.0190008
Zhao J, Goldberg AL. Coordinate regulation of autophagy and the ubiquitin proteasome system by MTOR. Autophagy. Oct 2 2016;12(10):1967-1970. doi:10.1080/15548627.2016.1205770
Zhao J, Zhai B, Gygi SP, Goldberg AL. mTOR inhibition activates overall protein degradation by the ubiquitin proteasome system as well as by autophagy. Proc Natl Acad Sci U S A. Dec 29 2015;112(52):15790-7. doi:10.1073/pnas.1521919112
Yamanashi K, Kinugawa S, Fukushima A, et al. Branched-chain amino acid supplementation ameliorates angiotensin II-induced skeletal muscle atrophy. Life Sci. Jun 1 2020;250:117593. doi:10.1016/j.lfs.2020.117593
Evenson AR, Fareed MU, Menconi MJ, Mitchell JC, Hasselgren PO. GSK-3beta inhibitors reduce protein degradation in muscles from septic rats and in dexamethasone-treated myotubes. Int J Biochem Cell Biol. Oct 2005;37(10):2226-38. doi:10.1016/j.biocel.2005.06.002
Merli M, Giusto M, Molfino A, et al. MuRF-1 and p-GSK3β expression in muscle atrophy of cirrhosis. Liver Int. May 2013;33(5):714-21. doi:10.1111/liv.12128
Zdzieblik D, Oesser S, Baumstark MW, Gollhofer A, König D. Collagen peptide supplementation in combination with resistance training improves body composition and increases muscle strength in elderly sarcopenic men: a randomised controlled trial. Br J Nutr. Oct 28 2015;114(8):1237-45. doi:10.1017/s0007114515002810

No competing interests reported.

SupplementaryMaterials.docx

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Effects of Corn oligopeptide on Dexamethasone-induced muscle atrophy in Sprague-Dawley rats

Status:

Version 1

Abstract

Figures

1 Introduction

2 Materials And Methods

2.1 Reagents

2.2 Animal

2.3 Experimental Scheme

2.4 Body composition

2.5 Skeletal muscle function tests

2.6 Muscle weights

2.7 Myofiber cross-sectional area (CSA) measurement

2.8 Quantitative real-time PCR

2.9 Western blot analysis

2.10 Immunofluorescence staining of MyoD and Pax7 in TA muscles

2.11 Statistical analysis

3 Result

3.1 DEX successfully induced muscle atrophy

3.2 Improvement effects of COP on muscles weight and sol myofiber CSA in DEX-induced skeletal muscle atrophy rat model

3.3 COP alleviates DEX-induced recession of skeletal muscle function

3.4 The effect of long-term use of COP on protein synthesis and proliferation of SCs in DEX-induced muscle atrophy model.

3.5 The effect of long-term use of COP on protein breakdown in DEX-induced muscle atrophy model.

4 Discussion

5 Conclusions

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1