Role of a novel neuroblastoma amplified sequence mutation, c.1342T&gt;C (p.Cys448Arg), in an infant with fever-triggered recurrent acute liver failure

doi:10.21203/rs.3.rs-2123724/v1

Download PDF

Article

Role of a novel neuroblastoma amplified sequence mutation, c.1342T>C (p.Cys448Arg), in an infant with fever-triggered recurrent acute liver failure

https://doi.org/10.21203/rs.3.rs-2123724/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 13 Apr, 2023

Read the published version in Human Genome Variation →

You are reading this latest preprint version

Mutations localized in the neuroblastoma amplified sequence (NBAS) gene correlate with infantile liver failure syndrome 2. In this study, we identified a novel NBAS mutation in a 26-month-old Chinese female diagnosed with fever-triggered recurrent acute liver failure (ALF). The proband exhibited highly elevated liver enzymes, severe coagulopathy, and acute renal failure. Whole-exome and Sanger sequencing revealed that the proband carried a compound heterozygous missense mutation in NBAS c.938_939delGC and c.1342T > C (p.Cys448Arg), the former of which causes a truncated NBAS protein without normal function and the latter of which affects evolutionarily conserved amino acid residues. The ratio of peripheral CD3+, CD4+, and CD45 + to CD3+, CD8+, and CD45 + cells was lower in the patient than in children without ALF. Moreover, the c.1342T > C mutation reduced the expression of NBAS mRNA and protein, enriched intracellular reactive oxygen species, and induced cell apoptosis and endoplasmic reticulum stress in in vitro cell models. Our study clarifies the mechanism by which NBAS mutations regulate ALF progression. Furthermore, we suggest employing NBAS gene detection in children with unexplained fever-triggered recurrent ALF or liver dysfunction.

Acute liver failure (ALF) is a life-threatening event in infancy and childhood that can result from infectious diseases, inherited metabolic diseases, toxin exposure, autoimmune diseases, shock, and other causes.¹ The cause of this disease remains unknown in approximately 50% of cases, although almost 25% of ALF cases result in congenital metabolism.^2–4 Regarding the genetic factors, researchers have identified many mutations related to ALF in genes such as neuroblastoma amplified sequence (NBAS),^2–6 SCYL1,³ E3 ubiquitin protein ligase,⁷ perforin,⁸ LARS,⁹ ATP7B,¹⁰ RINT1,¹¹ and mitochondrial TRMU genes.¹² Among these genes, NBAS is the most widely studied, and the genotype–phenotype correlation has recently been deciphered.² Because the progression of ALF with an NBAS mutation can be effectively ameliorated by early antipyretic therapy and the induction of anabolism, it is crucial to differentially diagnose NBAS mutation-based disease. Here, we describe a novel compound heterozygous missense mutation in NBAS that was identified in a 26-month-old Chinese female with recurrent episodes of ALF. We also show that this mutation may affect the peripheral T cell balance by inducing intracellular oxidative stress and endoplasmic reticulum (ER) stress, both of which contribute to ALF progression.

Whole-exome sequencing

Peripheral blood DNA from the proband was used to conduct whole-exome sequencing by Mingma Biotechnology (https://www.mingmatechs.com/) using the HiSeq X10 System (Illumina Inc., San Diego, CA, USA). Raw reads were assigned according to the human genome GRCh37 and distinguished using an in-house method that performed Burrows-Wheeler Aligner mapping and FreeBayes variant calling protocol. During the analysis, mapped reads were filtered by comparison with in-house and public databases. Potential pathogenic gene variations correlating to ALF or those containing autosomal recessive mutations were listed as candidate genes.

Sanger direct sequencing

To verify the two variants in exons 11 and 15 of the NBAS gene obtained from whole-exome sequencing, Sanger sequencing of the polymerase chain reaction (PCR) products from PCR amplification was performed using genomic DNA from the patient and her parents as templates. PCR amplification was conducted using the primers for NBAS exon 11 (forward 5ʹ-GAGAAGAGCTTGCGGTGGAT-3ʹ, reverse 5ʹ-CCAGTGTCTTCGGTACCTGC-3ʹ) and exon 15 (forward 5ʹ-GAGAAGAGCTTGCGGTGGAT-3ʹ, reverse 5ʹ-CCAGTGTCTTCGGTACCTGC-3ʹ). PCR products were sequenced by Biosun Biotechnology Shanghai Co., Ltd. (Shanghai, China).

Analysis of peripheral lymphocytes

The isolated peripheral blood lymphocytes from the patient and children without ALF were stained with fluorescent-labeled anti-CD45, CD3, CD4, and CD8 antibodies before being loaded into the FACS assay, according to the instructions of the CD45-FITC/CD4-PE/CD8-ECD/CD3-PC5 antibody cocktail (6607013, Bechman).

NBAS gene synthesis and vector construction

The human NBAS cDNA ORF clone (7116 bp) was synthesized by Jiangsu Dongxuan Gene Technology Co. Ltd. Company. Full-length NBAS cDNA was obtained by PCR using LA Taq® DNA Polymerase. The primers used in this study were as follows: forward primer 5ʹ-GGGGATATCATGGCGGCCCCCGAGTCAG-3ʹ and reverse primer 5ʹ-TGG CGGCCGCCTACTTGTCATCGTCGTCCTTGTAGTCCACCCAGTGCTGTGCTGC-3ʹ. The underlined letters represent the cleavage sites of the restriction endonucleases used for vector construction. After digestion by the endonucleases EcoRV and NotI, the PCR product was inserted into the pcDNA3.1(+) vector with T4 ligase to form pCDNA3.1-NBAS-Flag. Using the pcDNA3.1-NBAS-Flag vector as a template, PCR amplification was conducted with the following primer pairs: NBAS-C448R forward primer, 5ʹ-TTTAAGTTTGGAGCGTAGATTAAACTTGCCCCCAAACGATCTCGTTTGGAG-3ʹ; NBAS-C448R reverse primer, 5ʹ-CACGCTCCAAACTTAAAAATCCCCCATCATGGGTAGCAGTGAC-3ʹ. The PCR products were digested with DpnI before recombination by GeneArt™ Gibson Assembly HiFi (Invitrogen) to obtain pcDNA3.1-NBAS-C448R-Flag.

RNA extraction and quantitative (real-time) PCR

As described in a previous study,¹³ total RNA was extracted from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA was then used to conduct reverse transcription using PrimeScript RT Reagent Kits (Takara, Kusatsu, Japan) according to the cDNA. cDNA was amplified in triplicate via qRT-PCR using the CFX Connect Real-Time PCR Detection System (Bio-Rad, CA, USA) and SYBR Premix Ex Taq (Takara Bio), with β-actin as an internal control. The qRT-PCR cycling was arranged as follows: denaturation at 95°C for 3 min, 95°C for 35 s, and annealing at 60°C for 35 s over 40 cycles. The 2^−ΔΔCT method was used to calculate the relative expression.

Western blot analysis

Western blotting was conducted as described.¹³ Briefly, the cells were washed with PBS and lysed with RIPA buffer (#89901; Thermo Scientific) containing a protease inhibitor cocktail (#78420). The lysate was centrifuged at 13,000 × g for 10 min at 4°C before the supernatant was collected and the protein concentration measured. Then, 20–80 µg of protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis before being electrotransferred to a nitrocellulose membrane. The membrane was blocked with 5% non-fat milk in TBST before incubation with primary antibodies. The antibodies used were ATF4 (ab184909, Abcam), XBP1 (ab37152, Abcam), CHOP (#5554, CST), BiP (#3177, CST), FLAG tag (#14793, CST), and β-actin (#4967, CST). Specific peroxidase-conjugated secondary antibodies and an enhanced chemiluminescence kit (Pierce; Thermo Fisher Scientific, Waltham, MA, USA) were used for enzyme-catalyzed reactions to amplify the protein signals. Enhanced chemiluminescence signals were analyzed using ImageJ software (v1.50i) (US, Bethesda, MD, USA).

Cell apoptosis assay

Cell apoptosis was determined using a PE Annexin V Apoptosis Detection Kit (BD Biosciences, USA) in three independent experiments.¹⁴ Briefly, Jurkat cells from each treatment group were collected by centrifugation. The cells were then resuspended at 1 × 10⁶ cells/mL at room temperature. Each 100 µL of cell suspension was incubated with 7-AAD and annexin V-FITC according to the manufacturer’s instructions at room temperature for 15 min. Finally, the forward cell suspension was added to another 400 µL of binding buffer before analysis using a flow cytometer (CytoFLEX, Beckman, USA). The percentage of apoptotic cells for each treatment was analyzed using the FlowJo application (V10).

During emergency treatment, a 26-month-old sick female infant (height 80.5 cm and weight 9 kg) was sent to our hospital for treatment for a fever accompanied by a thermal spike at 40°C and vomiting. The patient had slight abdominal distension, poor food intake, and drowsiness, and was negative for the Babinski, Brudzinski, and Kernig signs. From seven months old, the patient had been repeatedly hospitalized in our department because of fever and abnormal liver function, with the highest serum-level of glutamic pyruvic transaminase (1629 U/L). Pathological slices showed cloudy swelling in the liver cells and swelling of the renal tubule epithelium.

On hospital admission, blood tests were performed to assess liver and kidney functions. The results showed that the levels of glutamic pyruvic transaminase, aspartate aminotransferase, glutamyl transpeptidase, total bilirubin, direct bilirubin, total bile acid, and adenosine deaminase were higher than the reference values, whereas the levels of alkaline phosphatase and indirect bilirubin were lower than the reference values in the serum (Table 1). During the evaluation of kidney function, the creatinine level (27.10 µmol/L) was lower than the reference range, whereas the uric acid level (461.20 µmol/L) was higher than the reference range. The ammonia level in the blood was 57.50 µmol/L, which was much higher than the reference value. In addition, the alpha-fetoprotein antibody and cytomegalovirus antibody levels in the serum of the patient were higher than the reference values, with levels reaching 16.85 g/ml and 12.922 AU/ml, respectively. Other autoantibodies related to hepatitis in the serum were also tested. The anti-AMA-M2 and anti-M2-3E antibodies tested positive in the patient’s serum (Table S1). Regarding the overall immune function, the levels of immunoglobulin κ-light chain, immunoglobulin λ-light chain, and immunoglobulin G were 5.40 g/L, 2.54 g/L, and 22.75 g/L, respectively, all of which were higher than the reference range.

Table 1

Blood test results for assessing liver and kidney function.
Parameters	Feb 25 Values	Feb 27 Values	Reference
Glutamic pyruvic transaminase	7011 U/L	2875 U/L	5–40 U/L
Aspartate aminotransferase	8103 U/L	901 U/L	5–35 U/L
Glutamyltranspeptidase	45 U/L	74 U/L	7–45 U/L
Alkaline phosphatase	274 KU/L	314 KU/L	35–135 KU/L
Total bilirubin	42.1 µmol/L	54.4 µmol/L	1.70–17.1
Direct bilirubin	37.9 µmol/L	52.5 µmol/L	0–7.0 µmol/L
Indirect bilirubin	4.2 µmol/L	1.9 µmol/L	3.0–16.0 µmol/L
Total bile acid	374 µmol/L	426.90 µmol/L	0–20 µmol/L
Adenosine deaminase	45.9 U/L	41.6 U/L	5.0–25.0 U/L
Note that Feb 25 and Feb 27 values were tested on February 25th and 27th, respectively.

In addition to liver function evaluation, we also assessed the blood coagulation of the patient. The results showed that the D-dimer, prothrombin time, fibrinogen degradation products, and international normalized ratio (INR = 2.77), which is a mean value of risk stratification among patients with liver disease, were higher than the reference ranges (Table 2). As the main clinical presentation of this patient comprised hyperammonemia, hepatic dysfunction, elevated liver biochemical values, and coagulopathy, we identified this patient as having ALF.

Table 2

Blood test results for assessing coagulation-related parameters.
Parameters	Values	Reference
Fibrinogen	2.60 g/L	2.00–4.00 g/L
Thrombin time	20.1 s	14.0–21.0 s
Prothrombin time	29.8 s	10.0–16.0 s
International normalized ratio	2.77	0.82–1.50
Partial thromboplastin time	31.4 s	20.0–40.0 s
D-dimer	9,672.0 µg / L	0–1,000 µg / L
Anti-thrombin III	394.4%	70.0–140.0%
Fibrinogen degradation products	18.23 µg/mL	0.00–5.00 µg/mL

We further investigated whether the ALF in the patient was caused by a gene mutation. Using whole-exome sequencing, we found that NBAS was the only potential gene mutated in the patient. The NBAS mutations were novel and likely pathogenic, containing heterozygote frameshift insertion mutation c.938_939delGC and missense mutation c.1342T > C. Moreover, the missense mutation c.1342T > C lay in the N-terminal regions of NBAS. Sanger sequencing showed that the mother of the proband carried the heterozygous missense mutation c.1342T > C and the father of the proband carried the heterozygous frameshift insertion mutation c.938_939delGC (Fig. 1). According to Sanger sequencing, the primer pair 5ʹ-GAGAAGAGCTTGCGGTGGAT-3ʹ and 5ʹ-CCAGTGTCTTCGGTACCTGC-3ʹ was used for PCR amplification of the DNA segments overlapping the c.938_939delGC mutation site, whereas the primer pair 5ʹ-GAGAAGAGCTTGCGGTGGAT-3ʹ and 5ʹ-CCAGTGTCTTCGGTACCTGC-3ʹ was used for PCR amplification of the DNA segments overlapping the c.1342T > C mutation site. The heterozygous frameshift insertion mutation c.938_939delGC from the paternal allele would cause translation failure of functional NBAS proteins, and the phenotype of the proband would result in the heterozygous missense mutation c.1342T > C from the maternal allele. The heterozygous missense mutation c.1342T > C correlated with the amino acid mutation C448R in the NBAS protein, which is highly conserved in multiple species (Fig. 1). Conversely, the p.C448R mutation is localized at the edge of the β-propeller of the NBAS protein.²

Because T-lymphocyte subsets could be important in the pathogenesis of ALF,^{9, 15} we further analyzed changes in the peripheral T lymphocytes of the proband using flow cytometry. The results showed that the subtypes of lymphocytes carrying antigens of CD45⁺, CD3⁺CD45⁺ (total T cells), CD3⁺CD4⁺CD45⁺ (T helper lymphocytes), and CD3⁺CD8⁺CD45⁺ (cytotoxic T lymphocytes) were higher in the proband than in children without ALF (Fig. 2A,2B). The ratio of CD3⁺CD4⁺ Th cells and CD3⁺CD8⁺ cytotoxic T lymphocytes in the proband was significantly lower than that in children without ALF (Fig. 2C).

To uncover the potential mechanism by which the mutation contributes to ALF progression, we investigated whether the mutation affected NBAS mRNA and protein expression. The results showed that ectopic expression of the NBAS C448R construct significantly induced less mRNA (Fig. 3A) and protein expression (Fig. 3B) than that of the wild-type construct. We also found that ectopic expression of NBAS C448R increased reactive oxygen species in 293T cells (Fig. 4A). Forced expression of NBAS C448R induced apoptosis in Jurkat cells (an immortalized T-lymphocyte cell line) (Fig. 4B,4C). These results indicate that NBAS C448R could induce oxidative stress, which contributes to changes in T cell homeostasis (Fig. 2). NBAS regulates the stability of ER-associated transcripts and the ER unfolded protein response,¹⁶; thus, we hypothesized that NBAS C448R could induce ER stress. Western blotting revealed that overexpression of NBAS C448R significantly increased the expression of ER stress-related genes, including ATF4, XBP1, CHOP, and BIP (Fig. 4D).¹⁷

Together, these preliminarily results showed that the C448R mutation in NBAS, as a novel compound heterozygous mutation that is highly conserved in multiple species, could affect the expression of functional NBAS mRNA and protein, leading to the induction of reactive oxygen species stress and ER stress in T lymphocytes, which contributes to ALF progression.

Initially identified as co-amplified with the MYCN gene in neuroblastoma cells, NBAS is believed to play an important role in Golgi-to-ER transport.¹⁸ Harmful mutations in NBAS were originally related to a high prevalence of hereditary short stature syndrome.¹⁹ Subsequently, growing evidence has supported the notion that NBAS mutations are associated with recurrent acute liver failure.^{3, 5, 20} In this study, by combining whole-exome sequencing with Sanger sequencing using the genome from peripheral leukocytes of the proband, we diagnosed a child with acute liver failure and identified the C448R mutation in NBAS as a novel compound heterozygous variation that is highly conserved in multiple species.

We also found that the NBAS C448R mutation could be linked to immunodeficiencies. Mutations in the NBAS gene have previously been linked to immunodeficiencies,^{21, 22} with general symptoms of NBAS-linked immunodeficiencies including decreased immunoglobulin G levels, CD56⁺ NK, and CD19⁺ naive B cells.^{21, 23} However, our patient displayed normal IgG levels in another study,²⁰ and we believe that NBAS dysfunction also changed T cell homeostasis (Fig. 2) with no a decrease in CD19 B cells (Table S2). Our results suggest that the NBAS C448R mutation could affect the ratio of peripheral CD3⁺CD4⁺CD45⁺ (T helper lymphocytes) to CD3⁺CD8⁺CD45⁺ (cytotoxic T lymphocytes) (Fig. 2), which improves our understanding of the effect of NBAS on the development of immune cells.

We also revealed that the NBAS C448R mutation reduced the expression of NBAS mRNA and protein (Fig. 3A,3B), which indicated that the C variation was a loss-of-function mutation. Moreover, the ectopic expression of NBAS C448R induced ER stress in Jurkat cells (Fig. 4B‒D), which was consistent with the finding that the NBAS mutant significantly increased the expression of genes involved in the ER stress response in fibroblasts.⁵ Regarding ER stress in CD4 + T lymphocytes attributed to acute liver failure²⁴ and human cytotoxic T-lymphocyte-mediated acute liver failure,¹⁵ our findings also provide useful insights into the mechanisms underlying ALF. Considering our finding that the forced expression of NBAS C448R increased intracellular reactive oxygen species and induced cellular apoptosis (Fig. 4A), this study elucidates the molecular mechanism by which the NBAS gene affects immunodeficiencies.

In this study, we identified a novel compound heterozygous variation, c.1342T > C (p.Cys448Arg), in the NBAS gene and preliminarily suggest that this mutation may affect the peripheral T cell balance by inducing intracellular oxidative stress and ER stress, which contributes to ALF progression. Further studies are required to determine the mechanism by which NBAS affects immune cell function and participates in the pathological progression of ALF.

NBAS: neuroblastoma amplified sequence gene

ALF: acute liver failure

ER: endoplasmic reticulum

qRT-PCR: quantitative real-time polymerase chain reaction

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of the Second Affiliated Hospital of Nantong University, Jiang Su, China (approval number: 2021KT116). All experimental protocols involving humans were conducted in accordance with the guidelines of the Declaration of Helsinki. Written informed consent was obtained from the parents after providing details of the survey, and all concerns were answered before the questionnaire was introduced.

Availability of data and materials

The datasets analyzed in the current study are available from the corresponding author upon reasonable request.

CONFLICT OF interest

The authors declare no competing interests.

Acknowledgements

This study was supported in part by grants from the Nantong Municipal Bureau of Science and Technology (MS12020001 to H.X CUI, MS22020010 to B. F. Zhu) and the Nantong Municipal Health and Family Planning Commission (M2020010 to H.X CUI and QA2021017 to X. CHU). We would also like to thank Editage (www.editage.cn) for their assistance with English language editing.

Authors’ contributions

Juhua Ji, Mingming Yang, and Junjun Jia contributed equally to this study. Xin Chu, Baofeng Zhu, and Hengxiang Cui wrote the manuscript. Juhua Ji, Mingming Yang, Junjun Jia, and Qi Wu prepared the figures and tables. All authors reviewed the manuscript and provided suggestions and revisions to the initial draft. All authors have read and approved the final manuscript.

Stravitz RT, Lee WM. Acute liver failure. Lancet 2019; 394: 869–881.
Staufner C, Peters B, Wagner M, Alameer S, Baric I, Broue P, et al. Defining clinical subgroups and genotype-phenotype correlations in NBAS-associated disease across 110 patients. Genet Med 2020; 22: 610–621.
Chavany J, Cano A, Roquelaure B, Bourgeois P, Boubnova J, Gaignard P, et al. Mutations in NBAS and SCYL1, genetic causes of recurrent liver failure in children: Three case reports and a literature review. Arch Pediatr 2020; 27: 155–159.
Ono S, Matsuda J, Watanabe E, Akaike H, Teranishi H, Miyata I, et al. Novel neuroblastoma amplified sequence (NBAS) mutations in a Japanese boy with fever-triggered recurrent acute liver failure. Hum Genome Var 2019; 6: 2.
Haack TB, Staufner C, Kopke MG, Straub BK, Kolker S, Thiel C, et al. Biallelic mutations in NBAS cause recurrent acute liver failure with onset in infancy. Am J Hum Genet 2015; 97: 163–169.
Staufner C, Haack TB, Kopke MG, Straub BK, Kolker S, Thiel C, et al. Recurrent acute liver failure due to NBAS deficiency: phenotypic spectrum, disease mechanisms, and therapeutic concepts. J Inherit Metab Dis 2016; 39: 3–16.
Kleine-Eggebrecht N, Staufner C, Kathemann S, Elgizouli M, Kopajtich R, Prokisch H, et al. Mutation in ITCH gene can cause syndromic multisystem autoimmune disease with acute liver failure. Pediatrics 2019; 143.
Danhaive O, Caniglia M, Devito R, Piersigilli F, Corchia C, Auriti C. Neonatal liver failure and haemophagocytic lymphohistiocytosis caused by a new perforin mutation. Acta Paediatr 2010; 99: 778–80.
Casey JP, McGettigan P, Lynam-Lennon N, McDermott M, Regan R, Conroy J, et al. Identification of a mutation in LARS as a novel cause of infantile hepatopathy. Mol Genet Metab 2012; 106: 351–358.
Chen L, Li X, Zheng Z, Lu X, Lin M, Pan C, et al. A novel ATP7B gene mutation in a liver failure patient with normal ceruloplasmin and low serum alkaline phosphatase. Gene 2014; 538: 204–206.
Cousin MA, Conboy E, Wang JS, Lenz D, Schwab TL, Williams M, et al. RINT1 bi-allelic variations cause infantile-onset recurrent acute liver failure and skeletal abnormalities. Am J Hum Genet 2019; 105: 108–121.
Zeharia A, Shaag A, Pappo O, Mager-Heckel AM, Saada A, Beinat M, et al. Acute infantile liver failure due to mutations in the TRMU gene. Am J Hum Genet 2009; 85: 401–407.
Cui H, Yu W, Yu M, Luo Y, Yang M, Cong R, et al. GPR126 regulates colorectal cancer cell proliferation by mediating HDAC2 and GLI2 expression. Cancer Sci 2021; 112: 1798–1810.
Cong R, Sun L, Yang J, Cui H, Ji X, Zhu J, et al. Protein O-GlcNAcylation alleviates small intestinal injury induced by ischemia-reperfusion and oxygen-glucose deprivation. Biomed Pharmacother 2021; 138: 111477.
Uchida T, Hiraga N, Imamura M, Tsuge M, Abe H, Hayes CN, et al. Human cytotoxic T lymphocyte-mediated acute liver failure and rescue by immunoglobulin in human hepatocyte transplant TK-NOG mice. J Virol 2015; 89: 10087–10096.
Longman D, Jackson-Jones KA, Maslon MM, Murphy LC, Young RS, Stoddart JJ, et al. Identification of a localized nonsense-mediated decay pathway at the endoplasmic reticulum. Genes Dev 2020; 34: 1075–1088.
Park S, Aintablian A, Coupe B, Bouret SG. The endoplasmic reticulum stress-autophagy pathway controls hypothalamic development and energy balance regulation in leptin-deficient neonates. Nat Commun 2020; 11: 1914.
Aoki T, Ichimura S, Itoh A, Kuramoto M, Shinkawa T, Isobe T, et al. Identification of the neuroblastoma-amplified gene product as a component of the syntaxin 18 complex implicated in Golgi-to-endoplasmic reticulum retrograde transport. Mol Biol Cell 2009; 20: 2639–2649.
Maksimova N, Hara K, Nikolaeva I, Chun-Feng T, Usui T, Takagi M, et al. Neuroblastoma amplified sequence gene is associated with a novel short stature syndrome characterised by optic nerve atrophy and Pelger-Huet anomaly. J Med Genet 2010; 47: 538–548.
Segarra NG, Ballhausen D, Crawford H, Perreau M, Campos-Xavier B, van Spaendonck-Zwarts K, et al. NBAS mutations cause a multisystem disorder involving bone, connective tissue, liver, immune system, and retina. Am J Med Genet A 2015; 167A: 2902–2912.
Lenz D, Pahl J, Hauck F, Alameer S, Balasubramanian M, Baric I, et al. NBAS variants are associated with quantitative and qualitative NK and B cell deficiency. J Clin Immunol 2021; 41: 1781–1793.
Albar RF, Alsulimani EF, Alsalmi KA, Alnamlah A, Alhuzali A, Aljehani S. Natural killer cell deficiency in neuroblastoma amplified sequence gene mutation. Cureus 2021; 13: e19270.
Ricci S, Lodi L, Serranti D, Moroni M, Belli G, Mancano G, et al. Immunological features of neuroblastoma amplified sequence deficiency: report of the first case identified through newborn screening for primary immunodeficiency and review of the literature. Front Immunol 2019; 10: 1955.
Jin L, Wang K, Liu H, Chen T, Yang Y, Ma X, et al. Genomewide histone H3 lysine 9 acetylation profiling in CD4 + T cells revealed endoplasmic reticulum stress deficiency in patients with acute-on-chronic liver failure. Scand J Immunol 2015; 82: 452–459.

(Not answered)

Download PDF

Journal Publication

published 13 Apr, 2023

Read the published version in Human Genome Variation →

Editorial decision: revise
27 Oct, 2022
Review #1 received at journal
27 Oct, 2022
Reviewer #1 agreed at journal
13 Oct, 2022
Reviewers invited by journal
12 Oct, 2022
Submission checks completed at journal
05 Oct, 2022
Editor assigned by journal
01 Oct, 2022
First submitted to journal
01 Oct, 2022

You are reading this latest preprint version

Role of a novel neuroblastoma amplified sequence mutation, c.1342T>C (p.Cys448Arg), in an infant with fever-triggered recurrent acute liver failure

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Material And Methods

Whole-exome sequencing

Sanger direct sequencing

Analysis of peripheral lymphocytes

NBAS gene synthesis and vector construction

RNA extraction and quantitative (real-time) PCR

Western blot analysis

Cell apoptosis assay

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1