Accumulation of soxC-expressing cells facilitated by MMPreg is essential for blastema formation in annelids

doi:10.21203/rs.3.rs-2127139/v1

Download PDF

Article

Accumulation of soxC-expressing cells facilitated by MMPreg is essential for blastema formation in annelids

https://doi.org/10.21203/rs.3.rs-2127139/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 22 Aug, 2024

Read the published version in Nature Communications →

Version 1

posted

You are reading this latest preprint version

Regeneration in many organisms involves the formation of a blastema that differentiates and organises into appropriate missing tissues. Although the mechanisms involved in blastema formation have been an intriguing topic of study in regeneration biology, the cellular and molecular basis of blastema formation remains poorly understood. Here, we demonstrate that during regeneration in E. japonensis, which can regenerate all organs from small fragments, the Sry-related high-mobility group (HMG) box (Sox) C-expressing cells accumulate in the head blastema. In addition, using RNAi silencing, we showed that MMPreg, a member of the matrix metalloprotease (MMP) family involved in extracellular matrix remodelling, is necessary for the accumulation of soxC-expressing cells in the head blastema, suggesting that MMPreg facilitated soxC-expressing cell migration to the head blastema. These findings provide insight into the cellular and molecular mechanisms underlying blastema formation.

The ability to regenerate missing or damaged body parts is a prominent feature in many animals^{1, 2}. Upon amputation, a structure called a blastema, which includes an undifferentiated mass of proliferative cells and an epidermal cover overlying the wound², forms at the amputation site after wound healing and provides the source material for eventual regeneration of lost structures or organs^{1, 3, 4}. Most instances of regeneration, with varying degrees of regenerative capability across species, depend on blastema formation^{2, 4, 5, 6, 7}. Although understanding the cellular and molecular basis underlying blastema formation is critical, the molecular mechanisms underlying this phenomenon remain poorly understood.

Advances in lineage-tracing tools have identified the source cells involved in blastema formation. In salamander, a urodele capable of regrowing missing limbs, connective tissue progenitors migrate to the amputation site to build the limb blastema and contribute to limb regeneration^{8, 9}. In planaria, which is capable of regenerating the entire body from small fragments, eye-specialised progenitors produce non-dividing progeny cells that progressively migrate to specific target locations in the blastema where they differentiate¹⁰. However, it remains unclear whether these cellular mechanisms of blastema formation are species-specific or generalisable across different animals. At the molecular level, platelet-derived growth factor signalling was shown to be a potent inducer of fibroblast migration, which is required to form the blastema in a salamander.⁸ In addition, planaria eye progenitors can move to the correct location with respect to position control genes which are predominantly expressed in muscles and regionally expressed to constitute positional information^{11, 12}. However, despite comprehensive analyses of the molecules involved in blastema formation ^{13, 14}, many key processes in blastema formation remain poorly understood at the molecular level.

Annelids have long been used as model animals for studying regeneration because of their impressive regenerative abilities^{15, 16}. Some annelids exhibit regenerative abilities comparable to planaria, which can regenerate all organs, including the entire body, from very small fragments^{6, 15}. In oligochaetes (a subclass of annelids, including earthworms), a large population of cells was speculated to migrate to the head blastema along the ventral nerve cord (VNC) from a distant location ^{17, 18, 19}, which has not yet been determined. Putative stem cells, called "Neoblasts" in oligochaete, are thought to be involved in this "massive cell migration"³; however, no solid evidence has been reported to date. Nevertheless, the germ cell precursors are one cell population reported to accumulate along the VNC to the regenerating tissue²⁰.

The potworm Enchytraeus japonensis, which is an enchytraeid (one of the oligochaetes) reported in Japan, reproduces asexually by dividing its body into several fragments, which then regenerates a complete individual within 4–5 days²¹ (Fig. 1a). Artificially amputated fragments can regenerate new individuals in the same manner²². E. japonensis is a small, whitish animal approximately 10 mm in length. Owing to its simple metameric morphology and ease of culture and handling, E. japonensis is an excellent laboratory animal for studying the mechanisms of regeneration²².

Using RNA-seq transcriptome analysis, we identified Ej-soxC as an upregulated gene during blastema formation in E. japonensis. Since the mammalian SOX transcription family generally contributes to determining cell fate and identity in many lineages²³, we presumed that the Ej-soxC-expressing cells might be important progenitors involved in blastema formation in E. japonensis. On examining the behaviour of Ej-soxC-expressing cells during head blastema formation, we found that they were attached to the body wall after amputation and gradually accumulated in the head blastema. In addition, using RNAi-mediated knockdown, we showed that the gradual accumulation of Ej-soxC-expressing cells in the head blastema was facilitated by MMPreg, a member of the matrix metalloprotease (MMP) family of extracellular proteases that are major executors of extracellular matrix remodeling²⁴. Our results showed that the gradually accumulated soxC-expressing cells constituted a large part of the blastema, suggesting that the population of soxC-expressing cells represents the blastema (historically called the blastemal mass in annelid²⁵). At the same time, the evidence shown here suggests that the soxC-expressing cells attached to the body wall are the cellular source of blastema and proves that the soxC-expressing cells represent the “migrating cells” during blastema formation that several researchers have speculated for over 130 years. These findings provide new insights into the cellular and molecular mechanisms underlying blastema formation across different animals.

Ej-soxC is upregulated during regeneration in E. japonensis

We attempted to identify the differentially expressed genes during blastema formation. In the case of E. japonensis, a blastema is formed 12–24 hours post-amputation (hpa)²⁶. Intact worms (intact, “blastema-less” group) were cut into 3 fragments (“blastema-poor” group) or 8 fragments (“blastema-rich” group), cultured for 24 h, and used for RNA-seq analysis (Fig. 1b). We generated large-scale mRNA sequencing data, which resulted in 86,094 non-redundant gene contigs (Fig. 1b). We found 465 functionally annotated contigs that were differentially expressed. Among them, we identified 278 contigs that were more upregulated in the “blastema-rich” group compared to the “blastema-poor” group at 10 fragments per kilobase of exon per million reads mapped (FPKM) values or higher (Fig. 1c-e, Supplementary Table S1). Interestingly, this group included Sry-related high-mobility group (HMG) box (Sox) C (7.9 fold upregulated in the “blastema-rich” group, Fig. 1e). The Ej-soxC gene belongs to the soxC gene subfamily, containing a highly conserved HMG box DNA-binding domain (Fig. 1f), which is distinct from other subfamilies, SoxB and SoxD (Fig. 1g). Because the mammalian SOX transcription family generally contributes to determining cell fate and identity in many lineages, we focused on Ej-soxC²³. Further quantitative analysis with qRT-PCR showed that Ej-SoxC was highly upregulated at 24 hpa and levelled off at later stages (Fig. 1h), suggesting that Ej-soxC is involved in the regeneration of E. japonensis.

Ej-soxC- expressing cells accumulate in the head blastema during blastema formation

To understand the role of Ej-soxC in regenerating worms, we first examined the expression pattern of Ej-soxC by in situ hybridisation (ISH) analysis using horizontal and sagittal sections of regenerating worms (Fig. 2a, b). We did not detect Ej-soxC-positive cells immediately after amputation (0.25 hpa), suggesting that Ej-soxC is expressed at low levels in intact worms. Ej-soxC-expressing cells were found on the body wall and septa near the posterior amputation site one hour after amputation. Three hours after amputation, Ej-soxC-expressing cells were also found on the body wall near the anterior amputation site. At 5 h after amputation, the number of Ej-soxC-expressing cells started to increase at the amputation site and subsequently accumulated until 24 h after amputation. The area of Ej-soxC-expressing cells corresponded to the developing blastema, suggesting that the population of soxC-expressing cells represented the blastema. The Ej-soxC-expressing cells on the body wall (at 3 and 5 hpa) were spread out and flat (Fig. 2a’, a’’), typical of migrating cells^{27, 28, 29}.

To test whether Ej-soxC is involved in blastema formation, we silenced Ej-soxC by RNA interference (RNAi) by feeding the worms with dsRNA (Fig. 2c). The level of Ej-soxC transcript was reduced by 40% (Fig. 2d). After 6 h of amputation, Ej-soxC silencing led to a decrease in the number of cells around the amputation site compared to the control (Fig. 2e–g), indicating that Ej-soxC is required for blastema formation. Taken together, Ej-soxC-expressing cells gradually accumulate in the head blastema, and the downregulation of soxC using RNAi led to a decrease in the number of accumulated cells around the blastema. A possible interpretation of the results of RNAi-mediated knockdown of Ej-soxC is that Ej-soxC is involved in the proliferation and/or migration of Ej-soxC-expressing cells.

Ej-MMPreg modulates the accumulation of Ej-soxC-expressing cells in the blastema

In mammals, two SOXC family members (SOX11 and SOX4) regulate genes involved in cytoskeletal/extracellular matrix organisation and cell migration in the embryonic epidermis³⁰. The extracellular matrix (ECM) provides structural support and relays environmental signals to the cells³¹. ECM remodelling occurs in various physiological processes, including regeneration^{24, 32}. Therefore, we investigated the possibility that ECM remodelling might be involved in the accumulation of Ej-soxC-expressing cells during blastema formation. Using the 465 contigs differentially expressed between regenerating and intact animals (Fig. 1d), we performed a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis to map these contigs to functional categories. Among the 110 transcripts that were mapped, the “ECM-receptor interaction pathway” category was frequently detected (Fig. 3a). This pathway analysis raised the possibility that ECM remodelling might modulate the accumulation of soxC-expressing cells. The cleavage of ECM components is the main process during ECM remodelling²⁴. MMPs are the main enzymes involved in ECM degradation²⁴.

Among the 278 contigs differentially expressed in regenerating worms, one transcript encodes a protein belonging to the MMP family of extracellular proteases (35.8 fold upregulated in the “blastema-rich” group, Fig. 1d, Fig. 3b, Supplementary Table S1), characterised by a pro-domain and a zinc-binding motif with potential catalytic properties and hemopexin-like motifs (Fig. 3c). qRT-PCR analysis showed that this MMP was highly upregulated at 24 hpa and levelled off at a later stage (Supplementary Fig. S1a), suggesting that this MMP might be involved in the regeneration of E. japonensis. ISH analysis showed that this MMP was expressed in the chloragocytes of regenerating worms (Fig. 3d, d’). Chloragocytes are specialised peritoneal cells of the intestine that participate in the metabolism, storage, and excretion of glycogen and lipids³³.

To explore whether MMP is involved in blastema formation, we examined whether the downregulation of this MMP using RNAi would affect Ej-soxC-expressing cells. By feeding the worms dsRNA specific for this MMP, its transcription was reduced by 60% (Fig. 3e). At 6 and 24 h after amputation, downregulation of this MMP led to a decrease in the number of soxC-expressing cells in the blastema compared to that in control (Fig. 3f–i). Consistent with this, treatment with an MMP inhibitor decreased the number of Ej-soxC-expressing cells in the blastema (Fig. 3j, k). These results show that MMP is necessary for the accumulation of soxC-expressing cells in the blastema. Therefore, we refer to this MMP as MMPreg (“reg” referring to regeneration). In planaria, four MMP-related genes (Smed-mmp1, Smed-mmp2, Smed-mt-mmpA, and Smed-mt-mmpB) were identified³⁴. Phylogenetic analysis showed that Ej-MMPreg was close to Smed-mt-mmpA (Supplementary Fig.S1b). Silencing Smed-mt-mmpA alters tissue integrity and delays blastema growth without affecting stem cell proliferation and reducing the accumulation of BrdU-stained cells in the anterior region³⁴. Our results are in agreement with those obtained for planaria. In addition to the expression of Ej-MMPreg in the chloragocytes, MMPreg was also expressed in the blastema (Supplementary Fig. S1c), suggesting that MMPreg might be involved in mechanisms other than the accumulation of cells in the blastema.

In summary, our results suggest that MMPreg facilitates the migration of soxC-expressing cells to the blastema during blastema formation. Further, our results suggest that the soxC-expressing cells attached to the body wall are the cellular source of blastema and proves that the soxC-expressing cells represent the “migrating cells” during blastema formation.

Germline multipotency program (GMP) genes followed an expression pattern different from SoxC in the blastema

The germline multipotency program (GMP) genes, including piwi, vasa, nanos, and pl10, are broadly expressed in germline and multipotent cells across metazoans and are known as reliable markers of the undifferentiated status of invertebrate cells³⁵. The expression patterns of GMP genes have been partially examined in E. japonensis^{20, 36, 37}. Our results showed that soxC expression was upregulated after amputation (Fig. 1h). In an effort to understand the relationship between Ej-soxC-expressing cells and putative stem cells, we examined the expression patterns of different GMP genes during the regeneration of E. japonensis. To this end, we first identified transcripts of two vasa genes (Ej-vasa1 and Ej-vasa2), Ej-nanos, Ej-pl10, and Ej-piwi, in the assembled contigs derived from the RNA transcriptome analysis (Supplementary Fig. S2a–c). The amino acid sequence of Ej-vasa1 was similar to that of Ej-vasa like gene (vlg)-1 (89.9% identity, Supplementary Fig. S3a), and the amino acid sequence of Ej-vasa2 was similar to Ej-vlg-2 (86.6% identity, Supplementary Fig. S3b), as previously reported for E. japonensis³⁶. ISH analysis showed Ej-vasa1-positive cells on the body wall immediately after amputation (0.25 hpa) (Fig. 4a), suggesting that Ej-vasa1 was expressed in intact worms. The Ej-vasa1-expressing cells were not found near the anterior or posterior amputation sites until 5 h after amputation (Fig. 4a). In contrast, at 24 h after amputation, Ej-vasa1 was found to be expressed in a small portion of the blastema, but its area was clearly smaller than that of Ej-soxC-expressing cells (Fig. 2a, b, Fig. 4a). This is consistent with previous studies which showed that GMP genes appear to be expressed de novo in the early blastema of the sandworm A.virens³⁸, and the freshwater annelid P. leidyi³⁹.

The other GMP genes, Ej-vasa2, Ej-nanos, and Ej-pl10. Ej-nanos and Ej-pl10 were expressed in the cells attached to the body wall immediately after amputation (0.25 hpa) (Fig. 4b, c). In addition, Ej-vasa2 was expressed in cells in the body cavity (0.25 hpa) (Fig. 4e). Similar to Ej-vasa1 (Fig. 4a), Ej-nanos, Ej-pl10, and Ej-vasa2 were not expressed in the cells near the anterior and posterior amputation sites until 5 h after amputation, (Fig. 4b, c, e), but were expressed in a small portion of the blastema at 24 h after amputation (Fig. 4b, c, e). This is also consistent with previous studies, which showed that GMP genes appear to be expressed de novo in the early blastema of the sandworm A.virens³⁸ and the freshwater annelid P. leidyi ³⁹.

We also examined the expression pattern of Ej-piwi. Consistent with a previous study²⁰, Ej-piwi-expressing cells were found on the VNC (Fig. 4d). It has been reported that these cells serve as germ cell precursors during gonad regeneration in E. japonensis²⁰. Ej-piwi-expressing cells were not found in the blastema, even 24 h after amputation (Fig. 4d).

Next, we examined the expression pattern of GMP genes in the posterior growth zone (PGZ), multipotent progenitor cell (MPC) clusters, and neoblasts.

The MPC cluster expressed all GMP genes that were examined (vasa1, vasa2, nanos, pl10, piwi) (Fig. 4f), whereas PGZ expressed all GMP genes except piwi (vasa1, vasa2, nanos, pl10) (Fig. 4f). On the other hand, neoblasts only expressed vasa1 (Fig. 4g, Supplementary Fig. S4a). Furthermore, Ej-soxC was expressed in PDZ but not in MPC and neoblasts (Supplementary Fig. S4b).

Taken together, these results show that GMP genes are expressed on cells attached to the body wall of intact worms. More importantly, GMP gene-expressing cells did not accumulate in the blastema during early blastema formation (up to 5 h after amputation). Thus the population of Ej-soxC-expressing cells and that of GMP gene-expressing cells are suggested to be different.

The population of Ej-soxC- and Ej-vasa1-expressing cells differed during blastema formation

Our data showed that the Ej-soxC-expressing cells accumulated in the blastema up to 5 h after amputation, whereas the Ej-vasa1-expressing cells did not accumulate in the blastema until 5 h after amputation. On the other hand, at 24 h after amputation, Ej-vasa1 was expressed in a small portion of the blastema, the area of which was clearly smaller than that of the Ej-soxC-expressing cells. To better understand the relationship between the Ej-vasa1-expressing and Ej-soxC-expressing cells, we examined whether Ej-vasa1 and Ej-soxC were co-expressed in the blastema. A double ISH analysis revealed that Ej-SoxC and Ej-vasa1 were expressed in a mutually exclusive manner in the blastema (Fig. 5a, b). This result supported that the Ej-soxC-expressing cells and the Ej-vasa1-expressing cells represented two different cell populations, suggesting that the Ej-soxC-expressing cells are not the adult stem cells (ASCs).

The cellular and molecular basis of blastema formation are only beginning to be elucidated in model systems, such as salamander limb and planaria eye regeneration, and the extent of our understanding of the underlying mechanisms remains limited. In this study, we examined the behaviour of Ej-soxC-expressing cells during head blastema formation in annelid E. japonensis. We found that the Ej-soxC-expressing cells were attached to the body wall after amputation and gradually accumulated in the head blastema. In addition, we showed that MMPreg facilitates the gradual accumulation of Ej-soxC-expressing cells in the head blastema. Our results showed that the gradually accumulated soxC-expressing cells constituted a large proportion of the blastema, suggesting that the population of soxC-expressing cells represents the blastema. At the same time, the evidence here suggests that the soxC-expressing cells attached to the body wall are the cellular source of blastema and might represent the “migrating cells,” postulated by several researchers for over 130 years, that contribute to blastema formation. Comparison with events in other regenerative organisms might help to understand the underlying general mechanisms that explain blastema formation across different animals.

In mammals, SOX4, SOX11, and SOX12 constitute the group C SRY-box (SOX) transcription factors^{40, 41, 42}. Studies in animal models have revealed that SOXC is highly expressed in neuronal, mesenchymal, and other progenitor cells and controls many developmental processes from early organogenesis onward^{41, 43, 44, 45}. In vitro studies have suggested that SOX4 and SOX11 may promote osteoblast progenitor proliferation and differentiation^{46, 47}, and that SOX11 regulates the differentiation and migration of mesenchymal stem cells⁴⁸. Given the mammalian role of SOXC during development, it is possible that Ej-soxC-expressing cells are the progenitor cells. In addition to its role in embryonic development, SOXC plays critical roles in wound repair in mouse³⁰. Sox4 and Sox11 were found to be highly expressed in embryonic epidermal cells and re-expressed in postnatal skin wounds, where they re-activated an embryonic signature, including cytoskeleton genes, facilitating cell migration³⁰. In molluscs, a marine gastropod, SoxC was suggested to play critical roles in wound repair; haemocytes stained with fluorescent dye were found to migrate to wounds, suggesting cell migration of cells expressing four Sox genes, including SoxC to the wound sites⁴⁹. Considering the molecular function of mammalian and molluscous SOXC in development and wound healing, we speculate that soxC-expressing cells are progenitors and that SoxC transcription factors may regulate cytoskeleton genes facilitating cell migration during blastema formation in E. japonensis.

Despite efforts to understand the molecules involved in blastema formation^{13, 14}, many of the processes central to blastema formation remain poorly understood at the molecular level. One example is ECM remodelling. The MMP family of extracellular proteases is a major executor of ECM remodelling²⁴. ECM remodelling is assumed to occur during blastema formation. Recent studies have shown that ECM modifiers such as matrix metalloproteases (MMPs) are involved in cell migration in regenerating planaria³⁴. In salamander limb regeneration, single-cell transcriptome analysis showed that the expression of many ECM genes was downregulated, and the expression of various MMP genes (Mmp8 and Mmp13) was upregulated during blastema formation, indicating extensive ECM remodelling induced by injury¹⁴. Little is known about whether MMPs modulate the accumulation of some cell populations in the blastema. Our data clearly show that MMPreg is necessary for the accumulation of Ej-soxC-expressing cells in the head blastema of a highly regenerative animal. It is important to clarify the role of MMPreg in regenerating E. japonensis by determining the substrate ECM proteins and the stimulation factors that release MMPreg to better understand the whole picture of blastema formation at the molecular level.

GMP genes are reliable markers of the undifferentiated status of invertebrate cells³⁵. For example, planarian piwi-1-expressing cells constitute a heterogeneous population that includes pluripotent stem cells called cNeoblasts (clonogenic neoblasts)⁵⁰ as well as specialised progenitor stem cells⁵¹. Planarian neoblasts are molecularly defined by the expression of piwi-1⁵². In hydra, piwi is expressed in interstitial stem cells called i-cells, which constitute a population of multipotent cells⁵³. i-cells also expressed Vasa, PL10⁵⁴. ASCs in other whole-body regeneration animals generally express GMP genes⁶. In annelid E. japonesis, GMP gene-expressing cells still reside and attach to the body wall of intact worms, in contrast to the absence of Ej-soxC-expressing cells attached to the body wall of intact worms (Fig. 2, 4). Furthermore, GMP gene-expressing cells did not seem to accumulate in the blastema, at least at the early stage of blastema formation, in contrast to Ej-soxC-expressing cells (Fig. 4a–e, Fig. 6b). Ej-SoxC and Ej-vasa1 were expressed in a mutually exclusive manner in blastemas (Fig. 5). These results showed that the behaviours of Ej-soxC-expressing cells and Ej-vasa1-expressing cells are different, indicating that Ej-soxC-expressing cells are not ASCs.

What cell populations might serve as ASCs that are the source of Ej-soxC-expressing cells in E. japonensis? The simplest interpretation of our findings is that the GMP gene-expressing cells might serve as ASCs; GMP genes-expressing ASCs are already present in intact worms, and after amputation, these multipotent cells (ASCs) might produce Ej-soxC-expressing cells, which then migrate to the blastema and contribute to blastema formation (Fig. 6a). Neoblasts of annelids have long been believed to correspond to ASCs³, albeit not yet proven. In annelids, only a pair of neoblasts are located in each segment⁵⁵, whereas in other highly regenerative animals such as planaria and hydra, relatively higher amounts of ASCs, such as neoblasts in planaria and i-cells in hydra, are present even before amputation. Considering the abundance of ASCs in other whole-body regeneration animals, GMP gene-expressing cells attached to body walls are more likely to correspond to ASCs than to neoblasts in annelids. Our notion is supported by previous observations that annelids that lack cells with obvious neoblast characteristics could regenerate⁵⁵. Recently, the stem cell states of ASCs at the molecular level in planaria^{13, 56} and the stem cell differentiation trajectories in hydra⁵⁷ were characterised by single-cell RNA sequencing (scRNA-seq). In the future, scRNA-seq analysis will allow us to understand the cell-type and lineage relationship between GMP gene-expressing cells, soxC-expressing cells, and neoblasts and to clarify the population of cells serving as ASCs in E. japonensis.

To date, many studies have speculated that the source cells for blastema formation might migrate along the VNC^{3, 18, 19} instead of the body wall, but the evidence is still scarce. Recently, wound-directed “migrating cells” were observed using time-lapse imaging in a freshwater annelid P. leidyi²⁹. However, these migrating cells were detected and classified using purely morphological features and not molecular markers. ISH analysis using GMP genes as markers showed that vasa1-expressing cells and piwi-expressing cells were attached to the dorsal side of the VNC^{20, 36} (Fig. 4a, d, Fig. 6b) and that vasa and piwi were co-expressed³⁶. Ej-piwi-expressing cells attached to the VNC of the pre-existing tissue proliferate by day 2 after amputation and then seem to accumulate anteriorly and populate the regenerating tissue²⁰. Taken together, the piwi-positive cells that appear to serve as germ cell precursors on the VNC might be the speculated blastema source cells.

There are three possible candidates for the origin of ASCs in intact animals: PGZ, MPC cluster, and neoblasts. The PGZ of annelids is a highly proliferative region located at the posterior tip of the animal that produces new segments during normal growth^{39, 58, 59}. The MPC cluster was identified in C. teleta and contained approximately 75 cells with an undifferentiated morphology, suspended in the coelomic cavity of segment 5, ventral to the gut tube⁶⁰. A pair of neoblasts are located adjacent to the septa in each segment and are believed to be multipotent cells³. Neoblasts only expressed Ej-vasa1, whereas the ASCs expressed Ej-vasa1, Ej-nanos, and Ej-pl10, suggesting that neoblasts may be candidates for the origin of some but not all ASCs. The MPC cluster expressed piwi, considered a germline marker in E. japonesis²⁰, suggesting that the MPC cluster may serve as a germline source. In C. teleta, the MPC cluster consisted of a heterogeneous population of cells expressing, especially myc, which is consistently localised to only a few cells within the MPC cluster⁶⁰, suggesting that a part of the MPC cluster could be a candidate for the origin of ASCs. The PGZ expressed all GMP genes that were tested, except for piwi, suggesting that it is the most likely candidate for the origin of ASCs in intact animals. Based on our current understanding, it is not possible to determine the origin of ASCs in intact worms. A comprehensive comparison of the behaviour of GMP gene-expressing cells and soxC-expressing cells among several annelids with considerable variations in regenerative capabilities might lead to a better understanding of the origin of ASCs in annelids.

Considering the Ej-vasa1-expression 24 h after amputation, it is likely that vasa1 did not accumulate gradually over time but was expressed de novo during blastema formation. This could be because of cell dedifferentiation in the blastema, which is supported by the results from the double ISH analysis.

There are three hypotheses in annelid regeneration that have been believed for over 130 years without definitive evidence: 1) existence of multipotent neoblasts, 2) massive cell migration to the amputation site to form the blastema, and 3) migration of cells to the blastema along the VNC. The results from this study address Hypotheses 2 and 3. The results from the present study indicate that the soxC-expressing cells represent the “migrating cells” during blastema formation. Furthermore, we did not detect any Ej-soxC-expressing cells on the dorsal surface of the VNC, but they were attached to the body wall, indicating that Ej-soxC-expressing cells were distinct from the population on the VNC. Presumably, due to the limitations of histological studies and the lack of powerful molecular markers, the piwi-positive cells might have seemed to serve as germ cell precursors on the VNC. Multipotent neoblasts in annelids are believed to serve as ASCs, but this has not yet been proven. Indeed, the role of neoblasts remains unclear, but we propose that the GMP gene-expressing cells attached to body walls are more likely to correspond to ASCs than to neoblasts in annelids.

Animals

Enchytraeus japonensis²¹, worms were reared in 1.0 % agar in Steinberg's solution (58 mM NaCl, 0.67 mM KCl, 0.34 mM Ca(NO₃)₂4H₂O, 0.85 mM MgSO₄7H₂O, 4.6 mM Tris-HCl, pH 7.4) in 150-mm disposable Petri dishes at 24 °C and fed with rolled oats (Quaker Oats). Under these conditions, E. japonensis grows continuously to approximately 10 mm in length and reproduces asexually by fragmentation approximately every two weeks. Artificial amputations of E. japonensis were performed using needle-sharp tweezers (Feather, K-715). The amputees were cultured on filter paper (Whatman No 3030917) wetted with Milli-Q water in 60 ×10 mm disposable Petri dishes at 24 °C. E. japonensis was provided by Dr. Yoshida-Noro, C. (Nihon University, Tokyo, Japan).

cDNA cloning and RNA probe preparation

Worms were cut into several fragments (normally 6–8) and allowed to regenerate for 24 h. Total RNA was extracted from about 100 regenerating fragments using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using the SuperScript III kit (Invitrogen, Carlsbad, CA, USA) using an oligo (dT) primer, following the manufacturer’s protocol. Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the following gene-specific primer pairs.

soxC:(Forward)5´-ATGATACTAAGTTCTAAAAT-3´ and (Reverse) 5´-TTAGTTCACCAATCTCTTA-3´.

MMPreg: (Forward)5´-AACCAGTAACCAAGGCAACG-3´ and (Reverse) 5´-CCCTCATGATTTACGCCACT-3´.

vasa1: (Forward)5´-GCCCGTTGATCCTGATAAGA-3´ and (Reverse) 5´-TGTTACCACATCGCCCTGTA-3´.

vasa2: (Forward)5´- CTGGTAAAACGGCATCATTTCTC -3´ and (Reverse)5´-TTCTCCAGCCACTCCGGCAC-3´.

nanos: (Forward)5´-GCTCGTTGGAATCGATTAGTG-3´ and (Reverse) 5´-CCCACACTGACTTGTGGTTG-3´.

pl10: (Forward)5´-TTCTGGCTGTGGGAAGAGTT-3´ and (Reverse) 5´-CTGCTCCTCGAGCCATTTAG-3´.

piwi: (Forward)5´-GATCAAACAGCACACGGATG-3´ and (Reverse) 5´-CTTGGTCCCATCTTCTCTCG-3´.

The PCR products were subcloned into the pGEM-T easy vector (Promega, Madison, WI, USA). The sequences were confirmed by Sanger sequencing. Plasmids containing cDNA fragments for soxC, MMPreg, vasa1, vasa2, nanos, pl10, and piwi were amplified by PCR using the M13 primer pair. Amplicons containing T7 and SP6 promoter sites were purified using a PCR purification kit (Qiagen, Valencia, CA, USA). Digoxigenin (DIG)-labelled sense and antisense RNA probes were prepared via in vitro transcription using the DIG RNA labelling kit (Roche, Basel, Switzerland). For double ISH analysis, vasa1 fluorescein-labelled sense and antisense RNA probes were prepared by in vitro transcription using the fluorescein RNA labelling kit (Roche, Basel, Switzerland).

In situ hybridisation (ISH)

Worms were fixed in 4% paraformaldehyde in 0.1 M phosphate-buffered saline (pH 7.5, PFA-PBS) at 4 °C overnight. For cryoprotection, the fixed samples were placed in an 18 % sucrose/PFA-PBS solution for 2 days at 4 °C. Subsequently, worms with sucrose substitution were embedded in Tissue-Tek OCT compound (Sakura Finetechnical, Tokyo, Japan) using Cryomold (No.4565, Sakura Finetechnical, Tokyo, Japan), frozen immediately on dry ice, and stored at -80 °C until sectioning. Frozen worm blocks were cut into 12 µm-thick sections using a cryostat (CM3050S; Leica Biosystems, Nußloch, Germany). Ten serial sections were mounted on a glass slide. The sectioned specimens were fixed in 4% PFA-PBS. After incubation in 10 μg/ml proteinase K in 10 mM Tris/HCl and 1 mM EDTA, the specimens were post-fixed for 10 min in 4% paraformaldehyde in PBS, treated with 0.2 M HCl for 10 min, washed in PBS, and then treated with 0.25% acetic anhydride in 0.1 M triethanolamine/HCl (pH 7.5) for 1 h. Hybridisation was carried out in ULTRAhybTM Hybridisation Buffer (Ambion) containing 500 ng/ml of probe at 70 °C for 16 h. The hybridised specimens were washed twice in wash buffer (50% formamide, 2× SSC) at 70 °C for 10 min and were subjected to RNase treatment (20 mg/ml) in TNE (10 mM Tris pH 7.5, 1 mM EDTA, 0.5 M NaCl, pH 7.5) for 10 min, and washed in TNE for 10 min. After stringent washes with a series of saline-sodium citrate (SSC) buffers, specimens were incubated at room temperature for 1 h in 1% blocking reagent (Roche) in DIG buffer I (100 mM Tris, 150 mM NaCl, pH 7.5), then incubated at 25 °C for 30 min with 1/1000 anti-DIG/AP antibody (Roche) in 1% blocking reagents. After incubation, the specimens were washed twice at 25 °C with DIG buffer I for 20 min each. For signal visualisation, a chromogenic reaction with a nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) was performed at 25 °C for 18 h. The sections were counterstained with nuclear fast red solution (ScyTek Laboratories, Cache Valley, CA, USA). Bright-field images of whole sections on each slide glass were semi-automatically captured using the NanoZoomer 2.0HT or NanoZoomer XR systems (Hamamatsu Photonics, Shizuoka, Japan). Microscopic fields of interest were cropped using the NDP.view2 software (ver. 2.7.25; Hamamatsu Photonics). The cropped images were converted to 8-bit images, and their brightness and contrast were adjusted using ImageJ (ver. 1.52a; National Institutes of Health, Bethesda, MD, USA). Sense probes were used as negative controls.

Double in situ hybridisation

The process from the re-fixation of sections to the chromogenic reaction with NBT/BCIP was performed as described above, except for hybridisation. During hybridisation, DIG-labelled RNA probes and fluorescein-labelled RNA probes were mixed and mounted simultaneously. After the first chromogenic reaction with NBT/BCIP, the anti-DIG antibody was detached using 100 mM glycine (pH 2.2). After washing in PBS, fluorescein-labelled probes were immunohistochemically detected with an alkaline phosphatase-conjugated anti-fluorescein antibody (1:1 000; Roche, Basel, Switzerland). To visualise the signals, the second colour chromogenic reactions were performed at room temperature with SIGMAFAST Fast Red TR/Naphthol AS-MX tablets (Sigma-Aldrich, St. Louis, MO, USA cat#F4523) for 4 d. Sense probes were used as negative controls.

Transcriptome sequencing, assembly, and annotation

To identify the genes upregulated during regeneration, we obtained one group of intact worms and two groups of regenerating worms. Both groups contained twenty animals each. Intact worms (approximately 10 mm long, intact group) were cut into 3 fragments (“blastema-poor” group) or 8 fragments (“blastema-rich” group). Both groups of fragments were cultured for 24 h at 24 °C and pooled. Total RNA was extracted from the two groups of regenerating worms (two-cut and seven-cut animals) and intact worms using TRIzol (Invitrogen). Total RNA was purified using an RNeasy Plus Mini Kit (Qiagen, Dusseldorf, Germany) and submitted to Macrogen Corp. Japan (https://www.macrogen-japan.co.jp/). The mRNAs were purified, and mRNA-seq libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Illumina sequencing was performed using the NovaSeq 6000 platform, and 150 bp paired-end reads were generated. Raw sequences were deposited in the NCBI Short Read Archive (SRA) database (http://www.ncbi.nlm.nih.gov/Traces/sra/) under accession number: SRR21413950, SRR21413951, SRR21413952. Trimmomatic 0.38 (http://www.usadellab.org/cms/?page=trimmomatic) was used to quality trim reads using the default settings, and the remaining clean reads were assembled using Trinity version trinityrnaseq_r20140717, bowtie 1.1.2 (https://github.com/trinityrnaseq/trinityrnaseq/wiki) for transcriptome assembly without a reference genome. The longest transcript for each gene was selected as the unigene. For annotation analysis, unigenes were searched against the Kyoto Encyclopedia of Genes and Genomes (KEGG), NCBI Nucleotide (NT), Pfam, Gene ontology (GO), NCBI non-redundant Protein (NR), UniProt, and EggNOG using BLASTN of NCBI BLAST version 2.9.0 (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and BLASTX of DIAMOND version 0.9.21 (https://github.com/bbuchfink/diamond) software with an E-value default cut-off of 1.0E-5. Differentially expressed genes (DEGs) between the control (intact group) and regeneration groups (blastema-rich group or blastema-poor group) were identified using DEGseq analysis from the adjusted read count data. Statistical analysis was performed using fold change and Fisher’s exact test using edgeR per comparison pair. Significant DEGs were determined by setting the threshold of fold change >2 and Fisher’s exact test at a raw p-value<0.05. Unigenes were annotated based on BLASTX results, and the best alignments were used for downstream analyses. The GO and KEGG databases were used to predict the functions of the unigenes. Pathway analysis was performed using the KEGG Mapper tool (http://www.genome.jp/kegg/tool/map_pathway2.html). NCBI-gi numbers were applied as queries, and the acquired pathway search results were grouped under the KEGG pathway maps.

5´-rapid amplification of cDNA end (RACE) for Ej-MMPreg

5´-RACE was performed using the SMARTerRACE5´/3´ kit (Takara Bio, Mountain View, CA, USA) according to the manufacturer’s protocol. Briefly, after first-strand cDNA synthesis, PCR was performed using the gene-specific primer 5´- TCACCTCCTCGACCTTCTCCTGG -3´ and the universal primer included in the kit. Nested PCR was performed using the gene-specific primer 5´-CGGTACCCGGGGATCGCCATCCTGATGATAGCCTGATGAG -3´ and the universal primer short included in the kit. The gene-specific primer for nested PCR contained a sequence at its 5′ end for in-fusion cloning of RACE products (CGGTACCCGGGGATC). In-Fusion cloning was performed using the In-Fusion Snap Assembly Master Mix according to the manufacturer’s protocol (Takara Bio).

Phylogenetic analysis

Multiple sequence analysis was performed using Clustal X 2.1 (https://clustalx.software.informer.com/2.1/) using complete sequences from the selected eukaryotic species. A phylogenetic tree was constructed using the “Draw tree” option in Clustal X⁶¹ using the Neighbour Joining algorithm with default settings (Gap opening:10, Gap extension:0.2, bootstrap number:1000), and the output file was analysed using NJplot software⁶² (http://pbil.univ-lyon1.fr/software/njplot.html). The names of the genes and their accession numbers used for the phylogenetic analysis are listed in Supplementary Table S2. The sequences of E. japonensis have been submitted to the DNA Data Bank of Japan (DDBJ) nucleotide database (LC727633, Ej-MMPreg; LC727634, Ej-nanos; LC727635, Ej-piwi; LC727636, Ej-pl10; LC727637, Ej-soxC: LC727638, Ej-vasa1; LC727639, Ej-vasa2; LC727632, Ej-GAPDH).

RNAi and inhibitor experiments

dsRNA was synthesised following the protocol for RNAi in planarians with some modifications⁶³. Briefly, DNA templates used for subsequent dsRNA synthesis were generated by PCR, using primers designed to amplify limited regions of the cDNA sequence for each gene. Each primer contained a T7 promoter sequence at its 5’-end (TAATACGACTCACTATAGGGAGACCAC). The PCR primers are listed below.

soxC: (Forward) 5´-TAAGCTGTGATGAGCTGAATCA-3´ and (Reverse) 5´-CACCAATCTCTTAATATTCCCA-3´

MMPreg: (Forward) 5´-AACCAGTAACCAAGGCAACG-3´ and (Reverse) 5´-CCCTCATGATTTACGCCACT-3’.

dsRNA was synthesised using the MegaScript^TM T7 kit following the manufacturer’s instructions. Typical yield was approximately 60 μg dsRNA per reaction. dsRNA (60 μg; 100 μl) was diluted with 300 μl distilled water and mixed with 0.15 μg oatmeal power. After vigorous vortexing, 70 μl of the mixture was added dropwise and frozen on dry ice. Frozen dsRNA tablets were stored at -80 °C until use. Approximately 200 animals were placed in a 60-mm disposable Petri dish at 24 °C. Animals were fed one frozen dsRNA tablet/Petri dish once a day for three consecutive days. In all cases, the animals were amputated one day after the last RNAi feeding. For the inhibitor experiment, MMP-2/MMP-9 inhibitor I (Cayman, CAS#193807-58-8) was used. Animals were soaked in 10 μM inhibitor in 0.3% DMSO/PBS for 1 h at 24 °C and then amputated. The amputees were cultured on filter paper wetted with 10 μM inhibitor in 0.3% DMSO/PBS in Petri dishes at 24 °C.

Image analysis for evaluation of RNAi and inhibitor phenotype

To evaluate MMPreg RNAi and inhibitor of MMP phenotype, worms were fixed after 6 h or 24 h amputation, and serial sections were subjected to in situ hybridisation to visualise soxC-expressing cells. The sections in which soxC was most abundantly expressed in the blastema and adjacent serial sections (three consecutive sections) were selected for individual samples. Images, including blastema, were cropped and converted to 8-bit images using ImageJ software. The threshold was determined to appropriately measure areas of cells expressing soxC (GFPdsRNA (6hr), 164-183; SoxCdsRNA (6hr), 175-180; GFPdsRNA (24hr), 174-180; SoxCdsRNA (24hr),180-181; DMSO, 173-179; inhibitor, 175-179). The total area was calculated from the sum of the values obtained from three consecutive sections. To evaluate the soxC RNAi phenotype, worms were fixed 6 h after amputation, and nuclei were stained with DAPI (1/1000). Imaging was performed using a Yokogawa CQ1 confocal high-content analysis system (Yokogawa Electric Corp.). Z-stack images were acquired at intervals of approximately 5 µm (15 sections). The area containing the blastema was enclosed manually, and the total fluorescent intensity was measured by detecting the cell nucleus stained with DAPI using the Cell Pathfinder software (Yokogawa) according to the manufacturer’s protocol.

Reverse-transcription and quantitative PCR analysis

Quantitative PCR (qPCR) was used to determine whether the targeted gene transcripts were downregulated after RNAi intervention. Worms were cut into several fragments (normally 6–8) and allowed to regenerate for 24 h. Total RNA was extracted from four biological replicates (consisting of approximately 100 fragments) of soxC, MMPreg, and control RNAi animals. Total RNA was extracted from each pool of fragments using TRIzol (Invitrogen), and cDNA was synthesised from 1 μg of total RNA using a Reverse-Transcription Kit (Thermofisher). Quantitative analysis of the amount of each gene product was performed using a LightCycler 96 System (Roche). Each reaction contained TB Green^® Premix Ex Taq™ II (Qiagen), gene-specific primers, and the cDNA template and was subjected to PCR as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, 60 °C for 20 s, 1 cycle at 65 °C for 15 s. Measurements were normalised to the expression level of a constitutively transcribed housekeeping gene, Ej-GAPDH. The mean of three replicate qRT-PCR assays were used for quantification. The following PCR primer pairs were used.

soxC: (Forward) 5´-TGCCAGCTTCTACCCTGAAGA-3´ and (Reverse) 5´-GGTGCATGGTGCCAAAACTT-3´

MMPreg: (Forward) 5´-CGATGGGCCAGGTATGGTACT-3´ and (Reverse) 5´-ATGTCACCTCCTCGACCTTCTC-3´

GAPDH: (Forward) 5´-AGGATTGGAGAGGAGGCAGAA -3´ and (Reverse) 5´-CCGGTGGAGGATGGAATG -3´.

Measurements were performed in triplicates. Mann–Whitney U tests were used to determine the significance of mRNA level changes between the control and experimental RNAi conditions. To determine the expression levels of soxC or MMPreg during regeneration, worms were cut into several fragments and allowed to undergo regeneration for 1, 2, or 4 days. Total RNA was extracted from each pool of fragments consisting of approximately 100 regenerating fragments (intact (n=8), day1 (n=6), day2 (n=6), day4 (n=6)). Mann–Whitney U tests with Bonferroni correction were used to determine the significance of mRNA level changes between the conditions.

Statistical analysis

Sample size (n) is indicated in the figure legends. Statistical analyses were performed using EZR software based on R (version 2.7-1). The methods used for each analysis are presented in the corresponding sections.

ACKNOWLEDGEMENTS

We would like to thank Dr Takahiro Ito, Dr Shinji Takada, and Dr Yusuke Mii for critically reading the manuscript.We would like to thank Editage (www.editage.com) for English language editing.

This work was supported by a Teikyo University Research Encouragement Grant (T.F.), a Fund for the Promotion of Joint International Research (Fostering Joint International Research [B]) (T. F., K.J.H. 19KK0211), Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (S.Y., 24590096, 15K07945, 18K06667; N.A., 24790089, 20K06915; C.M., 20K16472 and K.J.H., 26440182, 17K07492, 20K06747), the Uehara Memorial Foundation (S.Y.), the Sagawa Foundation for Promotion of Cancer Research (S.Y.), and a Grant-in-Aid for Scientific Research on Innovative Areas “Memory dynamism” (26115522), “Adaptive circuit shift” (15H01449) and “Evolinguistics” (20H05012) from the Ministry of Education, Culture, Sports, Science and Technology (K.J.H.), the Naito Foundation (K.J.H.), and the Japan Foundation for Applied Enzymology (K.J.H.).

AUTHOR CONTRIBUTIONS

T.F. and S.Y. designed the study and performed the research; T.F., N.A., C.M., K.J.H., and S.Y. analyzed the data; and T.F., N.A., C.M., K.J.H., and S.Y. wrote the paper. All authors have reviewed the manuscript.

COMPETING INTERESTS

The authors declare no competing interests.

Morgan TH. Regeneration and Liability to Injury. Science 14, 235–248 (1901).
Barresi M, Gilbert, S.. Developmental Biology. Oxford University Press (2019).
Randolph H. The regeneration of the tail in Lumbriculus. Journal of Morphology, 317–344 (1892).
Tanaka EM, Reddien PW. The cellular basis for animal regeneration. Dev Cell 21, 172–185 (2011).
Tsonis PA. Regeneration in vertebrates. Dev Biol 221, 273–284 (2000).
Srivastava M. Beyond Casual Resemblance: Rigorous Frameworks for Comparing Regeneration Across Species. Annu Rev Cell Dev Biol 37, 415–440 (2021).
Bely AE, Nyberg KG. Evolution of animal regeneration: re-emergence of a field. Trends Ecol Evol 25, 161–170 (2010).
Currie JD, Kawaguchi A, Traspas RM, Schuez M, Chara O, Tanaka EM. Live Imaging of Axolotl Digit Regeneration Reveals Spatiotemporal Choreography of Diverse Connective Tissue Progenitor Pools. Dev Cell 39, 411–423 (2016).
Bassat E, Tanaka EM. The cellular and signaling dynamics of salamander limb regeneration. Curr Opin Cell Biol 73, 117–123 (2021).
Reddien PW. Principles of regeneration revealed by the planarian eye. Curr Opin Cell Biol 73, 19–25 (2021).
Atabay KD, LoCascio SA, de Hoog T, Reddien PW. Self-organization and progenitor targeting generate stable patterns in planarian regeneration. Science 360, 404–409 (2018).
Hill EM, Petersen CP. Positional information specifies the site of organ regeneration and not tissue maintenance in planarians. Elife 7, (2018).
Fincher CT, Wurtzel O, de Hoog T, Kravarik KM, Reddien PW. Cell type transcriptome atlas for the planarian Schmidtea mediterranea. Science 360, (2018).
Gerber T, et al. Single-cell analysis uncovers convergence of cell identities during axolotl limb regeneration. Science 362, (2018).
Ozpolat BD, Bely AE. Developmental and molecular biology of annelid regeneration: a comparative review of recent studies. Curr Opin Genet Dev 40, 144–153 (2016).
Seaver EC. Annelid models I: Capitella teleta. Curr Opin Genet Dev 39, 35–41 (2016).
Herlant-Meewis H. Regeneration in annelids. Adv Morphog 4, 155–215 (1964).
Cornec J-P, Cresp, J., Delye, P., Hoarau, F., Reynaud, G. Tissue responses and organogenesis during regeneration in the oligochete Limnodrilus hoffmeisteri (Clap.). Can J Zool 65, 403–414 (1986).
Stephan-Dubois F. Migration and Differentiation of Neoblasts in Anterior Regeneration of Lumbriculus variegatus (Annelida, Oligochaeta).. C R Seances Soc Biol Fil 150, 1239–1242. (1956).
Tadokoro R, Sugio M, Kutsuna J, Tochinai S, Takahashi Y. Early segregation of germ and somatic lineages during gonadal regeneration in the annelid Enchytraeus japonensis. Curr Biol 16, 1012–1017 (2006).
Nakamura Y. A new fragmenting enchytraeid species, Enchytraeus japonensis from a cropped Kuroboku soil in Fukushima, Northern Japan (enchytraeids in Japan 5). Edaphologia 50, 37–39 (1993).
Myohara M, Yoshida-Noro C, Kobari F, Tochinai S. Fragmenting oligochaete Enchytraeus japonensis: a new material for regeneration study. Dev Growth Differ 41, 549–555 (1999).
Sarkar A, Hochedlinger K. The sox family of transcription factors: versatile regulators of stem and progenitor cell fate. Cell Stem Cell 12, 15–30 (2013).
Bonnans C, Chou J, Werb Z. Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol 15, 786–801 (2014).
Martinez Acosta VG, Arellano-Carbajal F, Gillen K, Tweeten KA, Zattara EE. It Cuts Both Ways: An Annelid Model System for the Study of Regeneration in the Laboratory and in the Classroom. Front Cell Dev Biol 9, 780422 (2021).
Yoshida-Noro C, Tochinai S. Stem cell system in asexual and sexual reproduction of Enchytraeus japonensis (Oligochaeta, Annelida). Dev Growth Differ 52, 43–55 (2010).
Bretscher MS. On the shape of migrating cells–a 'front-to-back' model. J Cell Sci 121, 2625–2628 (2008).
Bodor DL, Ponisch W, Endres RG, Paluch EK. Of Cell Shapes and Motion: The Physical Basis of Animal Cell Migration. Dev Cell 52, 550–562 (2020).
Zattara EE, Turlington KW, Bely AE. Long-term time-lapse live imaging reveals extensive cell migration during annelid regeneration. BMC Dev Biol 16, 6 (2016).
Miao Q, et al. SOX11 and SOX4 drive the reactivation of an embryonic gene program during murine wound repair. Nat Commun 10, 4042 (2019).
Frantz C, Stewart KM, Weaver VM. The extracellular matrix at a glance. J Cell Sci 123, 4195–4200 (2010).
Murphy G, Nagase H. Progress in matrix metalloproteinase research. Mol Aspects Med 29, 290–308 (2008).
Kinga Molnar GK, Peter Low. Invertebrate Histology. John Wiley & Sons, Inc. (2021).
Isolani ME, Abril JF, Salo E, Deri P, Bianucci AM, Batistoni R. Planarians as a model to assess in vivo the role of matrix metalloproteinase genes during homeostasis and regeneration. PLoS One 8, e55649 (2013).
Juliano CE, Swartz SZ, Wessel GM. A conserved germline multipotency program. Development 137, 4113–4126 (2010).
Sugio M, et al. Exploration of embryonic origins of germline stem cells and neoblasts in Enchytraeus japonensis (Oligochaeta, Annelida). Gene Expr Patterns 8, 227–236 (2008).
Sugio M, Yoshida-Noro C, Ozawa K, Tochinai S. Stem cells in asexual reproduction of Enchytraeus japonensis (Oligochaeta, Annelid): proliferation and migration of neoblasts. Dev Growth Differ 54, 439–450 (2012).
Kozin VV, Kostyuchenko RP. Vasa, PL10, and Piwi gene expression during caudal regeneration of the polychaete annelid Alitta virens. Dev Genes Evol 225, 129–138 (2015).
Ozpolat BD, Bely AE. Gonad establishment during asexual reproduction in the annelid Pristina leidyi. Dev Biol 405, 123–136 (2015).
Dy P, Penzo-Mendez A, Wang H, Pedraza CE, Macklin WB, Lefebvre V. The three SoxC proteins–Sox4, Sox11 and Sox12–exhibit overlapping expression patterns and molecular properties. Nucleic Acids Res 36, 3101–3117 (2008).
Hoser M, Potzner MR, Koch JM, Bosl MR, Wegner M, Sock E. Sox12 deletion in the mouse reveals nonreciprocal redundancy with the related Sox4 and Sox11 transcription factors. Mol Cell Biol 28, 4675–4687 (2008).
Kamachi Y, Kondoh H. Sox proteins: regulators of cell fate specification and differentiation. Development 140, 4129–4144 (2013).
Bhattaram P, et al. Organogenesis relies on SoxC transcription factors for the survival of neural and mesenchymal progenitors. Nat Commun 1, 9 (2010).
Sock E, Rettig SD, Enderich J, Bosl MR, Tamm ER, Wegner M. Gene targeting reveals a widespread role for the high-mobility-group transcription factor Sox11 in tissue remodeling. Mol Cell Biol 24, 6635–6644 (2004).
Schilham MW, et al. Defects in cardiac outflow tract formation and pro-B-lymphocyte expansion in mice lacking Sox-4. Nature 380, 711–714 (1996).
Gadi J, et al. The transcription factor protein Sox11 enhances early osteoblast differentiation by facilitating proliferation and the survival of mesenchymal and osteoblast progenitors. J Biol Chem 288, 25400–25413 (2013).
Nissen-Meyer LS, et al. Osteopenia, decreased bone formation and impaired osteoblast development in Sox4 heterozygous mice. J Cell Sci 120, 2785–2795 (2007).
Xu L, et al. Sox11-modified mesenchymal stem cells (MSCs) accelerate bone fracture healing: Sox11 regulates differentiation and migration of MSCs. FASEB J 29, 1143–1152 (2015).
Furukawa F, et al. Hemocyte migration and expression of four Sox genes during wound healing in Pacific abalone, Haliotis discus hannai. Fish Shellfish Immunol 117, 24–35 (2021).
Wagner DE, Wang IE, Reddien PW. Clonogenic neoblasts are pluripotent adult stem cells that underlie planarian regeneration. Science 332, 811–816 (2011).
Scimone ML, Kravarik KM, Lapan SW, Reddien PW. Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339–352 (2014).
Reddien PW, Oviedo NJ, Jennings JR, Jenkin JC, Sanchez Alvarado A. SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells. Science 310, 1327–1330 (2005).
Plickert G, Frank U, Muller WA. Hydractinia, a pioneering model for stem cell biology and reprogramming somatic cells to pluripotency. Int J Dev Biol 56, 519–534 (2012).
Lim RS, Anand A, Nishimiya-Fujisawa C, Kobayashi S, Kai T. Analysis of Hydra PIWI proteins and piRNAs uncover early evolutionary origins of the piRNA pathway. Dev Biol 386, 237–251 (2014).
Myohara M. What role do annelid neoblasts play? A comparison of the regeneration patterns in a neoblast-bearing and a neoblast-lacking enchytraeid oligochaete. PLoS One 7, e37319 (2012).
van Wolfswinkel JC, Wagner DE, Reddien PW. Single-cell analysis reveals functionally distinct classes within the planarian stem cell compartment. Cell Stem Cell 15, 326–339 (2014).
Siebert S, et al. Stem cell differentiation trajectories in Hydra resolved at single-cell resolution. Science 365, (2019).
de Rosa R, Prud'homme B, Balavoine G. Caudal and even-skipped in the annelid Platynereis dumerilii and the ancestry of posterior growth. Evol Dev 7, 574–587 (2005).
Zattara EE, Bely AE. Evolution of a novel developmental trajectory: fission is distinct from regeneration in the annelid Pristina leidyi. Evol Dev 13, 80–95 (2011).
de Jong DM, Seaver EC. Investigation into the cellular origins of posterior regeneration in the annelid Capitella teleta. Regeneration (Oxf) 5, 61–77 (2018).
Larkin MA, et al. Clustal W and Clustal X version 2.0. Bioinformatics 23, 2947–2948 (2007).
Perriere G, Gouy M. WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364–369 (1996).
Shibata N, Agata K. RNA Interference in Planarians: Feeding and Injection of Synthetic dsRNA. Methods Mol Biol 1774, 455–466 (2018).

There is NO Competing Interest.

Download PDF

Journal Publication

published 22 Aug, 2024

Read the published version in Nature Communications →

Version 1

posted

You are reading this latest preprint version

Accumulation of soxC-expressing cells facilitated by MMPreg is essential for blastema formation in annelids

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1