AKT1 Regulates UHRF1 Protein Stability and Promotes the Resistance to Abiraterone in Prostate Cancer

doi:10.21203/rs.3.rs-2127506/v1

Download PDF

Article

AKT1 Regulates UHRF1 Protein Stability and Promotes the Resistance to Abiraterone in Prostate Cancer

https://doi.org/10.21203/rs.3.rs-2127506/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 02 Jan, 2023

Read the published version in Oncogenesis →

You are reading this latest preprint version

Oncogenic activation of PI3K/AKT signaling pathway, together with epigenetic aberrations is the characters of castration-resistant prostate cancer(CRPC). UHRF1 as a key epigenetic regulator, plays a critical role in prostate cancer (PCa) development, and its expression is closely associated with tumor malignancy. This present study investigated the potential regulatory relationship between AKT1 and UHRF1, and further validated the in vitro and in vivo anti-PCa efficacy of AKT phosphorylation inhibitor MK2206 in combination with abiraterone. Both UHRF1 and p-AKT aberrantly overexpressed in the abiraterone-resistant PCa cells. Further studies revealed that AKT1 protein interacts UHRF1, and AKT1 directly phosphorylates UHRF1 via the site Thr 210. MK2206 induced UHRF1 protein degradation by disrupting AKT1-induced UHRF1 phosphorylation, and then reduced the interaction between UHRF1 and deubiquitinating enzyme USP7, while promoted the interaction between UHRF and E3 ubiquitin protein ligase (BTRC). MK2206 significantly promoted the sensitivity of abiraterone-refractory PCa cells and xenografts to abiraterone by downregulating the levels of UHRF1, and reversed the transdifferentiation of NEPC (SYP and NCAM1), even activated cell senescence (p21 upregulation) and cell apoptosis (cleaved-PARP). Altogether, our present study for the first time revealed a novel molecular mechanism of abiraterone resistance through PI3/AKT-UHRF1 pathway, and provided a novel therapeutic modality by targeting PI3/AKT1 to promote the drug sensitivity of abiraterone in PCa patients.

AKT1

UHRF1

Phosphorylation

Abiraterone

Drug Resistance

Prostate cancer (PCa) is the most common cancer type among man except for skin cancer, which has nearly 1.4 million new cases and almost 375,000 reported deaths worldwide in 2020[1]. In China, the incidence rate of PCa was around 10.23/100,000, taking the sixth incidence of male malignancy, and the crude mortality of PCa was 4.36/100,000 in 2015[2].

The initiation and progression of PCa overwhelmingly depends on androgen/androgen receptor (AR), thereby androgen deprivation therapy (ADT) has become the first-line therapeutic modality for men with advanced PCa. However, ADT resistance develops within 18–24 months, and then the disease develops to castration-resistant PCa (CRPC) [3]. The 5-year survival rate of CRPC patients is only 25%-33%, and ≥ 84% of CRPC patients develops metastasis at diagnosis[4, 5]. The second generation antiandrogen drugs, such as abiraterone and enzalutamide have been approved to treat metastatic CRPC (mCRPC), and prolonged overall survival (OS) of mCRPC patients [6, 7]. However, drug resistance unavoidably develops, and the life quality of patients is pretty poor. Several underlying mechanisms of ADT resistance, such as AR amplification, mutation, AR splice variants, abnormal expression of AR co-activators or co-repressors, glucocorticoid receptor upregulation have been proposed [8, 9].

Phosphatidylinositide-3-kinase (PI3K)-AKT pathway promotes the initiation and progression of PCa by promoting cell proliferation, invasion, autophagy and metabolism [10–12]. The PI3K-AKT pathway activates the genomic and non-genomic AR and other signaling cascades [13, 14]. Furthermore, the activation of PI3K/AKT pathway results in drug resistance by elevating anti-apoptotic molecule Bcl-2[15]. Several molecular inhibitors of PI3K/AKT pathway have been developed[16]. AKT inhibitor ipatasertib in combination with abiraterone significantly improved the survival of mCRPC patients [17], suggesting that the aberration of PI3K-AKT signaling may be one of crucial factors of abiraterone resistance.

Ubiquitin-like containing PHD Ring Finger 1(UHRF1) is a key epigenetic regulator and plays key roles in bridging DNA methylation and histone modification [18]. UHRF1 has been involved in a series of cellular activities, such as DNA replication, DNA damage repair, etc [19–21]. UHRF1 is aberrantly overexpressed in many cancer types, and its expression level is positively correlated with the degree of malignancy [22–24]. The knockdown of UHRF1 retarded cell proliferation, induced cell apoptosis and cell metabolism [25–27]. Therefore, it has been considered as a potential therapeutic target of PCa. UHRF1 are regulated by post-translational modifications such as ubiquitination, methylation and phosphorylation [28–30]. However, whether PI3K/AKT regulates the post-translational modification of UHRF1 remains unclear.

In this present study, we generated two pairs of abiraterone-refractory PCa cell lines LNCaP-R and CWR22Rv1-R. We firstly observed that higher expression levels of both UHRF1 and p-AKT in the abiraterone-resistant PCa cells than the parental cells. In addition, AKT1 phosphorylated UHRF1 and sustained its protein stability. MK2206 as a AKT1 phosphorylation inhibitor, selectively blocked AKT1 activity, and reduced the protein interaction between AKT1 and UHRF1, thereby promoted UHRF1 protein degradation. MK2206 significantly promoted the sensitivity of abiraterone in the abiraterone-resistant PCa cells and xenografts by downregulating the levels of UHRF1, and reversed the transdifferentiation of NEPC (SYP and NCAM1), even activated cell senescence (p21 upregulation) and cell apoptosis (cleaved-PARP). This study provides a novel therapeutic modality in which targeting AKT1 by small molecule inhibitor promoted drug sensitivity of abiraterone in PCa patients.

Cell lines and cell culture

PCa cells LNCaP and VCaP and normal prostate epithelial cells RWPE-1 were purchased from the American Type Culture Collection (ATCC). C4-2 and CWR22Rv1 cells were the gifts from Dr. Chinghai Kao in Department of Urology, Indiana University School of Medicine. HEK293T cells were obtained from Center for Molecular Medicine of Xiangya Hospital, Central South University. LNCaP, VCaP, C4-2 and CWR22Rv1 were cultured in RPMI-1640 medium supplied with 10% fetal bovine serum (ExCellBio, Shanghai, China). HEK293T were cultured in DMEM supplied with 10% fetal bovine serum. RWPE1 was cultured in defined Keratinocyte-SFM (1×) liquid (Invitrogen, Carlsbad, CA, USA). All cells were incubated at 37°C with 5% CO2.

Generation of LNCaP-R and CWR22RV1-R cell lines

LNCaP or CWR22Rv1 cells were initially cultured in the media containing 20uM abiraterone, and the living cells were cultured with the gradually increased drug concentrations for continuous 6 months. The IC50 values of cells response to abiraterone were identified by crystal violet assays. The LNCaP or CWR22Rv1 cells, whose IC50 values of abiraterone are over 50uM were regarded as the abiraterone-resistant LNCaP-R and CWR22Rv1-R cells.

Antibodies and reagents

Anti-UHRF1(A2343), Anti-β-Tubulin(A12289), Anti-NCAM1(A7913), Anti-Synaptophysin (A6344), Anti-USP7 (A13564), Anti-BTRC(A18232) were purchased from ABclonal(Wuhan,HuBei, China). Anti-Cleaved-PARP, Anti-AKT (phospho S473) were purchased from Abcam (Cambirdge,MA,USA). Anti-HA Tag (#3724), Anti-p21(#2947), Anti-Phospho-AKT (Thr308) (#13038), Anti-Normal Rabbit IgG (#2729) were purchased from Cell Signaling Technology(CST, Shanghai, China), Anti-His Tag(A00186) was purchased from GenScript (Nanjing, Jiangsu, China), p-Thr(H-2) was purchased from Santa Cruze Biotechnology(Shanghai, China). Monoclonal ANTI-Flag® M2 antibody (F1804) and Normal Mouse IgG (12–371) were purchased from Merck KGaA(Darmstadt, Germany).

Cycloheximide(HY-12320), MK-2206(HY-108232) and Protein A/G Magnetic Beads(HY-K0202) were purchased from MedChemExpress LLC. (Shanghai,China). MG-132(T2154) was purchased from Topscience Co. Ltd. (Shanghai,China). Lipo6000™ Transfection Reagent(C0526), a cationic liposome for transfection of HEK293T cells, was purchased from Beyotime(Shanghai,China).

Plasmids and Primers

The wild type UHRF1 and UHRF1 T210A mutant were cloned into pcDNA3.1/His or pGEX4T-1 vectors, and pcDNA3.1-Flag-myr-AKT1 was purchased from MiaoLing Plasmid Sharing Platform (Wuhan,China).The sequences of primers for PCR in this study are as follows. UHRF1(Forward: 5’GACAAGCAGCTCATGTGCGATG3’; and reverse: 5’ AGTACCACCTCGCTGGCATCAT3’) and ACTIN(Forward: 5’ CACCATTGGCAATGAGCGGTTC3’, and reverse: 5’ AGGTCTTTGCGGATGTCCACGT3’).

RNA extraction and qRT-PCR.

Total RNA was exacted by using RNAiso PLUS following the manufacturer’s instructions. Total RNA(1ug) was used for synthesizing the first strand cDNA by using Revert Aid First Strand cDNA Synthesis Kit(Thermo Scientific™). 2×SYBR Green qPCR Master Mix (Bimake, Houston, TX) were used for the qPCR. The relative mRNA expression levels were normalized to Actin. The statistical difference of the results was analyzed by Student's t-test, and the significance of data was determined by p value < 0.05.

Western blotting

Cells were washed with cold PBS three times and lysed with cell lysis buffer (Beyotime) for western blotting and IP assays. Cell lysis were separated by SDS-PAGE and then transferred to PVDF membranes(Millipore, Burlington, MA. USA), followed by blocking in 5% milk for 1h at room temperature. The membranes were washed with TBS containing 1% Tween 20 for 3 times, and incubated with primary antibodies overnight at 4℃. After incubating with the second antibodies, the membranes were exposed to chemiluminescence substrate, and the signals were detected by using Chemiluminescence Image Analysis System(Clontech, Mountain View, USA).

Co-immunoprecipitation assay

1×10⁶ HEK293T cells were co-transfected with pcDNA3.1/His-UHRF1 and pcDNA3.1-Flag-myr-AKT1. The transfected cells were washed with cold PBS for 3 times and lysed in cell lysis buffer 48 hours after transfection. The cell extracts were incubated with 1ug Anti-His Tag(A00186, GenScript, Nanjing, Jiangsu, China) or 1ug Anti-Flag Tag(F1804,Merck, Rahway, NJ, USA) at 4℃ overnight, followed by incubating with 20ul Protein A/G Magnetic Beads at 4℃ for one hour. The beads coupled with immunoprecipitates were washed 5 times with cell lysis buffer, and then harvested for western blotting.

Ubiquitination detection assay

HEK293T cells were co-transfected with pcDNA3.1/His-UHRF1, pcDNA3.1- Flag-myr-AKT1 and pcDNA3.1-HA-Ub for 48 hours, and then were treated with 50 uM MG132 plus DMSO or 10 uM MK2206 for 8 hours, respectively. Then cells were lysed in RIPA cell lysis buffer and the extraction were incubated with 1ug Anti-His Tag(A00186, GenScript) at 4℃overnight on a rotating shaker. Protein A/G Magnetic Beads (20ul) were added and incubated for 1 hour. The immunoprecipitates were used for western blotting analysis.

Recombinant protein purification

The plasmids expressing GST-UHRF1-WT and GST-UHRF1-T210A were constructed in pGEX4T-1 vector, and the recombinant proteins were generated and purified following the manufacturers’ manuals (Sangon, Shanghai, china). Briefly, the plasmids pGEX4T-1-UHRF1-WT or pGEX4T-1-UHRF1-T210A were separately transformed to Bacterial BL21 cells for 12h, and 50mg/ml IPTG was added to induce the expression of GST-UHRF1-WT and GST-UHRF1-T210A at 20℃ for 16h. Next, the BL21 cells were collected, and GST tagged UHRF1-WT and UHRF1-T210A proteins were purified by using GST-Sefinose(TM) Resin 4FF(Sangon). The purity of GST-UHRF1-WT or GST-UHRF1-T210A was detected by Coomassie staining after SDS PAGE.

In vitro kinase assay

pcDNA3.1-Flag-myr-AKT1 was transfected to HEK-293T cells, and the myr-AKT1 proteins firstly were immunoprecipitated with the anti-Flag antibody. The myr-AKT1 immunoprecipitates were resuspended in 500 µl 1× kinase buffer (#9802, Cell Signaling Technology) including 500 µM ATP (#9804 Cell Signaling Technology), and then co-cultured with 1ug recombinant proteins GST-UHRF1-WT or GST-UHRF1-T210A or negative control at 30°C for 30 min, and then the reaction was stopped by adding SDS sample buffer at 95°C for 5 min. The sample were used to western blotting.

Cell viability assay

RWPE-1, LNCaP, C4-2, CWR22Rv1, VCaP, LNCaP-R and CWR22Rv1-R were seeded in 24-well cell culture plates, and treated with the indicated concentrations of abiraterone and MK2206 alone or in combination for 4 days. The cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet solution for 15 min. After removing the unbound crystalline violet staining solution, the plates were washed with ddH2O and dried at 37 ℃ for 1h. The cells were lysed on a shake table overnight by 1% SDS. Cellular viability was assessed by measuring the absorbance at 590 nm with VICTOR Nivo microplate reader.

Cell apoptosis assay

Apoptotic cells were quantified by using the Annexin V/FITC Apoptosis Detection Kit (BD Biosience, Shanghai, China) by following the manufacturer’s instruction. PCa cells were treated with the indicated concentrations of abiraterone or MK2206 alone or in combination for 2 days, then the cells were harvested by using EDTA free trypsin and centrifuged at 1000 rpm for 3 min. Afterward, Cells were washed with PBS three times and incubated with 100ul of the 1×binding buffer including 5ul PI and 5ul Annexin-V for 15min. The positive Annexin-V/PI staining cells were detected by BD FACSAria II flow cytometer.

In vivo study

The animal experiments were approved by the Institutional Animal Care and Use Committees(IACUCs) of Xiangya Hospital, Central South University according to the corresponding guidelines. Firstly, the xenograft models were induced by subcutaneously injecting 5×10⁶ CWR22Rv1 cells into the left axillary of 4–5 week-old male BALB/c-nude mice(n ≥ 20). After the volume of the xenografts reached 100mm³, the animals were randomly divided into 4 groups, and then treated with vehicle (control), abiraterone(100 mg/kg.d, i.g., every 3 days), MK2206(70 mg/kg.d, i.g., every 3 days) or abiraterone(100 mg/kg.d, i.g., every 3 days) plus MK2206 (70 mg/kg.d, i.g., every 3 days) for 16 days. The tumor volume was calculated by the following equation: (L × W²)/2 (length (L) and width (W)).The body weight and tumor volume of mice were measured every 3 days, and the tumor growth curve and mouse body weight growth curve were plotted. At the endpoint of experiments, the tumors were dissected, and the weights of tumor nodes and animal bodies were recorded.

Statistical analysis

All statistical analyses were performed by using SPSS 23.0 software. Student’s two-tailed t test was used to analyze the statistical difference between two sets of data. One-way ANOVA was used for statistical analysis of difference of multiple groups. Results were represented as mean ± SD. P values < 0.05 were considered statistically significant(*P < 0.05, **P < 0.01 and ***P < 0.001).

The levels of UHRF1 and p-AKT elevated in abiraterone-refractory PCa cell lines and NEPC tumor specimens. It has been reported that the expression of UHRF1 steadily increased with the elevation of Gleason grade of prostate cancer (PCa) [24]. Furthermore, the overexpression of UHRF1 is closely correlated with drug resistance of PCa [31]. We supposed UHRF1 aberrant overexpression may be one of typical characteristics of the abiraterone resistance. We first established two pairs of abiraterone-refractory PCa cell lines (LNCaP/LNCaP-R and CWR22Rv1/CWR22Rv1-R) by exposing the parental cells with steadily-increasing drug doses for 6 months. We then examined the sensitivity of these two pairs of PCa cell lines to abiraterone by using crystal violet assays. LNCaP, LNCaP-R, CWR22Rv1 and CWR22Rv1-R were treated with stepwise concentrations of abiraterone, and the IC50 values were calculated. The data showed that abiraterone inhibited the proliferation of PCa cells in a dose-dependent manner. The IC50 values increased 3–4 folds in the abiraterone-refractory cell lines compared to the parental cell lines (Fig. 1A and 1B). Additionally, it has well known that PCa develops the transdifferentiation of neuroendocrine prostate cancer (NEPC), which is the most deadly subtype of PCa when PCa develops abiraterone resistance, and expressed typical NEPC markers including NCAM1(CD56) and SYP [32, 33]. We next compared the expression of UHRF1, p-AKT, AKT, NCAM1 and SYP in the abiraterone-refractory and parental PCa cell lines. UHRF1, p-AKT, NCAM1 and SYP are significantly upregulated in the abiraterone-refractory PCa cell lines (Fig. 1C and 1D). We further assessed the protein levels of UHRF1 and p-AKT in PCa tumor specimens of prostate specific pten⁻/p53⁻/Rb1⁻ or pten⁻ gene knockout mice by IHC analysis (n = 3). In consistent to the published data [34], the PCa tumors of pten⁻/p53⁻/Rb1⁻ gene knockout mice developed to the NEPC phenotype. and the levels of UHRF1 protein and p-AKT were significantly higher in NEPC than PCa tumors of pten gene knockout mice (Fig. 1E and 1F). Collectively, both UHRF1 and p-AKT significantly up-regulated when PCa develops abiraterone resistance and NEPC transdifferentiation. Therapeutics targeting UHRF1 or p-AKT may be effective strategy to overcome abiraterone resistance.

AKT1 inhibitor MK2206 sensitized abiraterone-refractory PCa cells to the treatment of abiraterone. UHRF1 plays a vital role in PCa by regulating cell cycle, proliferation, apoptosis and metabolism. In addition, the overexpression of UHRF1 resulted in drug resistance [35]. We speculated that targeting AKT1-UHRF1 axis may restore the sensitivity of abiraterone-refractory cell lines to abiraterone treatment. We treated the abiraterone-refractory LNCaP-R or CWR22Rv1-R cell lines with different combinations of concentrations of abiraterone and MK2206 for 7 days, and the living cells were stained with crystal violet dye. As shown in the Fig. 2A and 2B, the curves of cell proliferation revealed that abiraterone or MK2206 inhibited cell proliferation in a dose-dependent manner. Furthermore, the combination of abiraterone and MK2206 demonstrated synergistic inhibitory effect on cell proliferation in LNCaP-R and CWR22RV1-R cells. The CI values of MK2206 and abiraterone in LNCaP-R cells (1:25) and CWR22Rv1-R cells (1:6.25) are 0.65 or 0.81 respectively (Fig. 2C). Similarly, the apoptosis detection assay revealed that abiraterone or MK2206 induced cell apoptosis, and the combination of abiraterone and MK2206 synergistically induced cell apoptosis in LNCaP-R and CWR22RV1-R cells (Fig. 2D). Mechanistically, abiraterone or MK2206 decreased the protein levels of UHRF1 and p-AKT, and the combination of abiraterone and MK2206 further decreased the protein levels of UHRF1 and p-AKT (Fig. 2E and 2F). In addition, the combination of abiraterone and MK2206 significantly increased the level of the cleaved-PARP (Fig. 2E.and 2F.), which is consistent to the results of apoptosis-detection assay (Fig. 2D). These results suggested that inhibition of AKT1-UHRF1 axis promoted the sensitivity of abiraterone in the abiraterone-refractory cell lines.

AKT phosphorylation inhibitor promotes the degradation of UHRF1 protein through ubiquitin-proteasome pathway. No UHRF1 specific inhibitor is available in clinic, while several AKT phosphorylation inhibitors have been developed, and demonstrated significant anti-cancer efficacy in the pre-clinical or clinical trials [36, 37]. We proposed whether AKT phosphorylation inhibitor destroyed the protein stability of UHRF1. CWR22Rv1-R or LNCaP-R was treated with AKT kinase inhibitor MK2206 for 24 h. The protein or mRNA level of UHRF1 were assessed by western blotting or qRT-PCR respectively. As shown in Fig. 3A and 3B, the levels of UHRF1 protein and p-AKT gradually decreased with the increasing concentrations of MK2206, but the mRNA expression did not significantly decrease (Fig. 3C and 3D). These data suggested that AKT phosphorylation inhibitors promoted UHRF1 protein degradation.

We next added Cycloheximide (CHX) to inhibit the synthesis of new protein, or/and proteasome inhibitor MG132 when treated PCa cells with MK2206, and re-monitored the protein stability of UHRF1. As expected, MK2206 remarkably accelerated the protein degradation of UHRF1, and this degradation was reversed by MG132(Fig. 3E and 3F). These data suggested that AKT inhibitor promoted UHRF1 protein degradation through the ubiquitin-proteasome pathway. We further validated the data by the in vitro ubiquitination assay. These plasmids encoding HA-Ub, His-UHRF1 and Flag-myr-AKT1 were co-transfected to HEK-293T cells, and then were treated with MK2206 for 24 hours. The data showed that AKT phosphorylation inhibition significantly promoted the ubiquitination of UHRF1 protein (Fig. 3G.), thereby resulting in protein degradation. The data suggested that AKT phosphorylation is required for the maintenance of UHRF1 protein stability. It is well known that protein stability is maintained by promoting the interaction of deubiquitinase or/and decreasing the interaction of ubiquitinase. It has been reported that the deubiquitinase USP7 and the ubiquitinase BTRC play critical roles in the maintenance of UHRF1 protein stability^[30,38]. We then examined whether AKT phosphorylation inhibition changed the protein interactions between UHRF1 and USP7, or UHRF1 and BTRC by co-immunoprecipitation. The results showed that AKT inhibition remarkably decreased the protein interaction between UHRF1 and USP7, while increased the interaction between UHRF1 and BTRC (Fig. 3H.). These results suggested that AKT inhibition promoted the ubiquitination-mediated degradation of UHRF1 protein by decreasing the deubiquitynating activity of USP7 and increasing the ubiquitynating activity of BTRC.

AKT induces UHRF1 phosphorylation at the threonine 210 residue, and sustains UHRF1 protein stability through deubiquitinase USP7. It has been reported that UHRF1 can be phosphorylated by many kinases such as CDK1 or CDK2[38, 39], but it is still unclear whether UHRF1 may be directly phosphorylated by AKT kinase. To validate that AKT kinase is required to sustain the protein stability of UHRF1, we first tested whether AKT protein interacts with UHRF1 by co-immunoprecipitation. The plasmids encoding His-UHRF1 and Flag-myr-Akt1 were co-transfected to HEK-293T cells. UHRF1 or AKT was immunoprecipitated with anti-His or anti-Flag antibody from the cell lysates, and the protein of AKT or UHRF1 was detected with anti-Flag or anti-His antibody by western blotting. As shown in Fig. 4A and 4B, both AKT and UHRF1 were detected in their individual immunoprecipitated complexes, but not in the isotype-matched negative control IgG complexes. The data validated that UHRF1 is a novel interactive substrate of AKT1.

By analyzing the amino acid sequence of UHRF1, we identified an AKT consensus motif (RXRXXS/T) at the threonine 210 residue (T210) in the TTD domain of UHRF1 protein, which may be a potential phosphorylation site of AKT1 (Fig. 4C). We performed an in vitro phosphorylation assay to verify the prediction by using the purified AKT1 and wild-type or mutated UHRF1 in which threonine 210 was substituted by alanine (T210A). The data showed that the wild-type UHRF1 may be phosphorylated by AKT, while the T210A mutated UHRF1 could not be phosphorylated (Fig. 4D). Furthermore, we explored whether the mutation of T210 phosphorylation site of UHRF1(T210A) influences the ubiquitination of UHRF1 protein by the in vitro ubiquitination assay. These plasmids encoding HA-Ub, His-UHRF1-WT/His-UHRF1-T210A and FLAG-myr-Akt1 were co-transfected to HEK-293T cells. The data showed that the mutation of AKT phosphorylation sites of UHRF1(T210A) significantly promoted the ubiquitination of UHRF1 protein (Fig. 4E). Furthermore, the T210A mutation of UHRF1 significantly decreased the protein interaction between UHRF1 and USP7, while promoted the protein interaction between UHRF1 and BTRC (Fig. 4F). We further tested whether the mutation of AKT phosphorylation sites of UHRF1(T210A) promotes UHRF1 protein degradation. As shown in Fig. 4G and 4H, the mutation of AKT phosphorylation site markedly promoted the protein degradation of UHRF1 in a dose-dependent manner in both C4-2 and LNCaP cells. These results suggested that AKT1 induced the phosphorylation of UHRF1, and promoted its protein stability by inhibiting the ubiquitination-proteasome pathway-mediated protein degradation.

The combination of abiraterone and AKT inhibitor MK2206 selectively and synergistically inhibited the proliferation of PCa cells in vitro and in vivo. We investigated the effect of abiraterone or/and MK2206 on the cell proliferation of PCa cells and normal cells respectively by the crystal violet assays. The data showed that abiraterone or MK2206 selectively repressed the proliferation of PCa cells in a concentration-dependent manner, but no detectable toxicity on RWPE-1 cells (Fig. 5A and 5B). To examine whether the combination of abiraterone and MK2206 induced a synergistic killing effect on PCa cells, PCa cells VCaP, CWR22-Rv1, LNCaP and C4-2 and no-malignant RWPE-1 cells were treated with abiraterone or MK2206 alone or in combination, and the cell viability was determined by crystal violet assays. The results showed that abiraterone and MK2206 synergistically inhibited the proliferation of PCa cells, but little impact on normal cells (Fig. 5C-5G). The CI values of MK2206 and abiraterone in LNCaP cells (1:25) ,VCaP cells(1:6.25),CWR22Rv1 cells (1:6.25) and C4-2 cells(1:25)are 0.81, 0.94, 0.74 or 0.37 respectively (Fig. 5H). Furthermore, the combination of abiraterone and MK2206 induced more apoptosis of PCa cells than either abiraterone or MK2206 alone (Fig. 5I and 5J). These results suggested that the combination of abiraterone and MK2206 selectively and synergistically inhibited the in vitro proliferation of PCa cells.

We then validated the synergistic in vivo anti-tumor efficacy of abiraterone and MK2206, we established a subcutaneous xenograft tumor models in nude mice using CWR22rv1 cells. Two weeks after tumor cell transplantation, the mice were administered by gavage with abiraterone or MK2206 alone or in combination. The gavages were administered every three days for continuous 15 days, the tumor volume and body weight were measured every three days to obtain tumor growth curves. The results showed that the combination of abiraterone and MK2206 inhibited the growth of tumor xenografts more significantly than abiraterone or MK2206 alone(Fig. 6A), but drug treatment did not significantly decreased the weight of mice (Fig. 6B). The tumor nodes were dissected at the endpoint of experiment, and the weight of tumor nodes verified the results of tumor growth curve (Fig. 6C and 6D.). These results suggested that the combination of abiraterone and MK2206 showed superior anti-cancer efficacy to abiraterone or MK2206 alone, and the combination therapy is safe in the indicated dose window.

PI3k-AKT signaling pathway contributes to ADT resistance not only by activating its downstream signaling molecules such as RTKS, but also by reversely regulating upstream molecules mTOR and AR [40]. In addition, it recently has been reported that 20% of high-grade PCa have the mutations of epigenetic regulators, which play driver roles for the development of mCRPC and drug resistance [41, 42]. UHRF1 is a critical epigenetic coordirator bridging both DNA methylation and histone modifications by interacting with DNMT1 or HDAC1 individually [43], and aberrantly overexpresses in PCa specimens compared to normal prostate tissues. UHRF1 steadily increases with the elevated degree of malignancy and the development of drug resistance [44, 45], but the mechanisms have not been clearly clarified.

It has been reported that the phosphorylation of UHRF1 protein is critical for its functions, UHRF1 Ser-661 may be phosphorylated by the CDK2-CCNA2 complex, thereby promoting zebrafish embryo development [46]. The phosphorylation of UHRF1 ser-298 facilitates ITG1 recognizing DNA replication initiation sites as well as histone H3K9me2/3 by altering the TTD1 structure of UHRF1^[46]. In addition, the phosphorylation of UHRF1 ser-652 reduces the interaction between UHRF1 and deubiquitinase USP7, which promotes the degradation of UHRF1 protein [38]. In the present study, AKT1 promoted its protein stability by inducing UHRF1 phosphorylation, and the mutation of UHRF1 Thr-210 destroyed the stability of UHRF1 protein by inhibiting the protein interaction of UHRF1 with USP7.

Furthermore, we found that targeting AKT1 by MK2206, a selective inhibitor of AKT restored the sensitivity of abiraterone-refractory cells to abiraterone treatment. Moreover, the combination of two drugs demonstrated a significantly improved in vivo antitumor efficacy in a PCa xenograft model (Fig. 6). In mechanistics, abiraterone plus MK2206 significantly decreased UHRF1 protein level, and increased the epigenetic-silenced tumor suppressor genes such as P21, and decreased SYP and NCAM1, the typical NEPC markers. p21 is not only a tumor suppressor gene and cell cycle inhibitor, but also a marker of cell senescence. The combination therapy-elevated p21 overexpression resulted in cell cycle arrest, and induced cell senescence, and eventually triggers cell apoptosis (cleaved PARP) (Fig. 2E and 2F.). In addition, it has been reported that PCa patients develops abiraterone resistance by promoting NEPC transdifferentiation [47]. The combinational therapy of two drugs decreased the levels of NCAM1 and SYP, suggesting that AKT inhibitor reversed abiraterone resistance by reversing the transdifferentiation of NEPC.

Altogether, we for the first time revealed that AKT1 promoted drug resistance of PCa to abiraterone by regulating UHRF1 phosphorylation, thereby sustaining its protein stability. The aberrant overexpression of UHRF1 contributes to abiraterone resistance. Though UHRF1 inhibitor has not been commercially developed, the drug resistance of PCa to abiraterone may be reversed by AKT inhibitor MK2206. This study provided a novel therapeutic modality that AKT1 inhibitor promoted drug sensitivity of abiraterone for mCRPC patients.

DATA AVAILABILITY

The data used and analyzed during the current study are available from the corresponding author on reasonable request.

ACKNOWLEDGEMENTS

We thank the members of the Hunan Key Laboratory of Viral Hepatitis and Center of Molecular Medicine, Xiangya Hospital, Central South University for constructive discussion of this study.

AUTHOR CONTRIBUTIONS

FYM, CTY, ZXR and LJL performed experiments, analyzed data and wrote the manuscript; LYH and PYC participated in generation of LNCaP-R and CWR22Rv1-R cell lines, phosphorylation and ubiquitination assays; DTG and YLL participated in animal experiments and data analysis; LX designed the project, supervised all experiments, analyzed the results, and wrote the manuscript. All authors read and approved the final manuscript.

FUNDING

This work was supported by grants from the National Natural Science Foundation of China (NSFC, 81572542 and NSFC, 81874096). This study was supported by National Key Specialty Construction Project (Clinical Pharmacy) and High Level Clinical Key Specialty in Guangdong Province.

COMPETING INTERESTS

None declared.

H Sung, Ferlay J, Siegel R-L, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries[J]. CA Cancer J Clin, 2021, 71(3): 209–249.
Z-T Fu, Guo X-L, Zhang S-W, et al. [Statistical analysis of incidence and mortality of prostate cancer in China, 2015][J]. Zhonghua Zhong Liu Za Zhi, 2020, 42(9): 718–722.
W-P Harris, Mostaghel E-A, Nelson P-S, et al. Androgen deprivation therapy: progress in understanding mechanisms of resistance and optimizing androgen depletion[J]. Nat Clin Pract Urol, 2009, 6(2): 76–85.
O-W Brawley. Prostate cancer epidemiology in the United States[J]. World J Urol, 2012, 30(2): 195–200.
B Tombal. Non-metastatic CRPC and asymptomatic metastatic CRPC: which treatment for which patient?[J]. Ann Oncol, 2012, 23 Suppl 10x251-x258.
J-S de Bono, Logothetis C-J, Molina A, et al. Abiraterone and increased survival in metastatic prostate cancer[J]. N Engl J Med, 2011, 364(21): 1995–2005.
H-I Scher, Fizazi K, Saad F, et al. Increased survival with enzalutamide in prostate cancer after chemotherapy[J]. N Engl J Med, 2012, 367(13): 1187–1197.
T Chandrasekar, Yang J-C, Gao A-C, et al. Mechanisms of resistance in castration-resistant prostate cancer (CRPC)[J]. Transl Androl Urol, 2015, 4(3): 365–380.
J Lu, Van der Steen T, Tindall D-J. Are androgen receptor variants a substitute for the full-length receptor[J]. Nat Rev Urol, 2015, 12(3): 137–144.
H Chen, Zhou L, Wu X, et al. The PI3K/AKT pathway in the pathogenesis of prostate cancer[J]. Front Biosci (Landmark Ed), 2016, 21(5): 1084–1091.
D Kumar, Shankar S, Srivastava R-K. Rottlerin induces autophagy and apoptosis in prostate cancer stem cells via PI3K/Akt/mTOR signaling pathway[J]. Cancer Lett, 2014, 343(2): 179–189.
C Priolo, Pyne S, Rose J, et al. AKT1 and MYC induce distinctive metabolic fingerprints in human prostate cancer[J]. Cancer Res, 2014, 74(24): 7198–7204.
M Crumbaker, Khoja L, Joshua A-M. AR Signaling and the PI3K Pathway in Prostate Cancer[J]. Cancers (Basel), 2017, 9(4).
D-J Mulholland, Tran L-M, Li Y, et al. Cell autonomous role of PTEN in regulating castration-resistant prostate cancer growth[J]. Cancer Cell, 2011, 19(6): 792–804.
A-B Pilling, Hwang C. Targeting prosurvival BCL2 signaling through Akt blockade sensitizes castration-resistant prostate cancer cells to enzalutamide[J]. Prostate, 2019, 79(11): 1347–1359.
A Gasmi, Roubaud G, Dariane C, et al. Overview of the Development and Use of Akt Inhibitors in Prostate Cancer[J]. J Clin Med, 2021, 11(1).
C Sweeney, Bracarda S, Sternberg C-N, et al. Ipatasertib plus abiraterone and prednisolone in metastatic castration-resistant prostate cancer (IPATential150): a multicentre, randomised, double-blind, phase 3 trial[J]. Lancet, 2021, 398(10295): 131–142.
H Hashimoto, Horton J-R, Zhang X, et al. UHRF1, a modular multi-domain protein, regulates replication-coupled crosstalk between DNA methylation and histone modifications[J]. Epigenetics, 2009, 4(1): 8–14.
E-M Taylor, Bonsu N-M, Price R-J, et al. Depletion of Uhrf1 inhibits chromosomal DNA replication in Xenopus egg extracts[J]. Nucleic Acids Res, 2013, 41(16): 7725–7737.
Y Tian, Paramasivam M, Ghosal G, et al. UHRF1 contributes to DNA damage repair as a lesion recognition factor and nuclease scaffold[J]. Cell Rep, 2015, 10(12): 1957–1966.
H Zhang, Liu H, Chen Y, et al. A cell cycle-dependent BRCA1-UHRF1 cascade regulates DNA double-strand break repair pathway choice[J]. Nat Commun, 2016, 710201.
M Unoki, Daigo Y, Koinuma J, et al. UHRF1 is a novel diagnostic marker of lung cancer[J]. Br J Cancer, 2010, 103(2): 217–222.
M Unoki, Kelly J-D, Neal D-E, et al. UHRF1 is a novel molecular marker for diagnosis and the prognosis of bladder cancer[J]. Br J Cancer, 2009, 101(1): 98–105.
F Babbio, Pistore C, Curti L, et al. The SRA protein UHRF1 promotes epigenetic crosstalks and is involved in prostate cancer progression[J]. Oncogene, 2012, 31(46): 4878–4887.
J-K Kim, Estève P-O, Jacobsen S-E, et al. UHRF1 binds G9a and participates in p21 transcriptional regulation in mammalian cells[J]. Nucleic Acids Res, 2009, 37(2): 493–505.
A-L Tien, Senbanerjee S, Kulkarni A, et al. UHRF1 depletion causes a G2/M arrest, activation of DNA damage response and apoptosis[J]. Biochem J, 2011, 435(1): 175–185.
X Xu, Ding G, Liu C, et al. Nuclear UHRF1 is a gate-keeper of cellular AMPK activity and function[J]. Cell Res, 2022, 32(1): 54–71.
H Zhang, Gao Q, Tan S, et al. SET8 prevents excessive DNA methylation by methylation-mediated degradation of UHRF1 and DNMT1[J]. Nucleic Acids Res, 2019, 47(17): 9053–9068.
J-Y Hahm, Kim J-Y, Park J-W, et al. Methylation of UHRF1 by SET7 is essential for DNA double-strand break repair[J]. Nucleic Acids Res, 2019, 47(1): 184–196.
H. Chen, Ma H, Inuzuka H, et al. DNA damage regulates UHRF1 stability via the SCF(β-TrCP) E3 ligase[J]. Mol Cell Biol, 2013, 33(6): 1139–1148.
X. Ci, Hao J, Dong X, et al. Heterochromatin Protein 1 Mediates Development and Aggressiveness of Neuroendocrine Prostate Cancer[J]. Cancer Res, 2018, 78(10): 2691–2704.
A Berger, Brady N-J, Bareja R, et al. N-Myc-mediated epigenetic reprogramming drives lineage plasticity in advanced prostate cancer[J]. J Clin Invest, 2019, 129(9): 3924–3940.
V Parimi, Goyal R, Poropatich K, et al. Neuroendocrine differentiation of prostate cancer: a review[J]. Am J Clin Exp Urol, 2014, 2(4): 273–285.
S-Y Ku, Rosario S, Wang Y, et al. Rb1 and Trp53 cooperate to suppress prostate cancer lineage plasticity, metastasis, and antiandrogen resistance[J]. Science, 2017, 355(6320): 78–83.
B Yuan, Liu Y, Yu X, et al. FOXM1 contributes to taxane resistance by regulating UHRF1-controlled cancer cell stemness[J]. Cell Death Dis, 2018, 9(5): 562.
B Toson, Fortes I-S, Roesler R, et al. Targeting Akt/PKB in pediatric tumors: A review from preclinical to clinical trials[J]. Pharmacol Res, 2022, 183106403.
H Hua, Zhang H, Chen J, et al. Targeting Akt in cancer for precision therapy[J]. J Hematol Oncol, 2021, 14(1): 128.
H Ma, Chen H, Guo X, et al. M phase phosphorylation of the epigenetic regulator UHRF1 regulates its physical association with the deubiquitylase USP7 and stability[J]. Proc Natl Acad Sci U S A, 2012, 109(13): 4828–4833.
J Chu, Loughlin E-A, Gaur N-A, et al. UHRF1 phosphorylation by cyclin A2/cyclin-dependent kinase 2 is required for zebrafish embryogenesis[J]. Mol Biol Cell, 2012, 23(1): 59–70.
B-Y Shorning, Dass M-S, Smalley M-J, et al. The PI3K-AKT-mTOR Pathway and Prostate Cancer: At the Crossroads of AR, MAPK, and WNT Signaling[J]. Int J Mol Sci, 2020, 21(12).
J Armenia, Wankowicz SAM, Liu D, et al. The long tail of oncogenic drivers in prostate cancer[J]. Nat Genet, 2018, 50(5): 645–651.
R Malik, Khan A-P, Asangani I-A, et al. Targeting the MLL complex in castration-resistant prostate cancer[J]. Nat Med, 2015, 21(4): 344–352.
S Xie, Jakoncic J, Qian C. UHRF1 double tudor domain and the adjacent PHD finger act together to recognize K9me3-containing histone H3 tail[J]. J Mol Biol, 2012, 415(2): 318–328.
S-C Wu, Kim A, Gu Y, et al. UHRF1 overexpression promotes osteosarcoma metastasis through altered exosome production and AMPK/SEMA3E suppression[J]. Oncogenesis, 2022, 11(1): 51.
Y Gao, Liu Y, Liu Y, et al. UHRF1 promotes androgen receptor-regulated CDC6 transcription and anti-androgen receptor drug resistance in prostate cancer through KDM4C-Mediated chromatin modifications[J]. Cancer Lett, 2021, 520172–183.
S Kori, Jimenji T, Ekimoto T, et al. Serine 298 Phosphorylation in Linker 2 of UHRF1 Regulates Ligand-Binding Property of Its Tandem Tudor Domain[J]. J Mol Biol, 2020, 432(14): 4061–4075.
G-K Patel, Chugh N, Tripathi M. Neuroendocrine Differentiation of Prostate Cancer-An Intriguing Example of Tumor Evolution at Play[J]. Cancers (Basel), 2019, 11(10).

There is NO conflict of interest to disclose.

Download PDF

Journal Publication

published 02 Jan, 2023

Read the published version in Oncogenesis →

Editorial decision: revise
12 Oct, 2022
Review #1 received at journal
10 Oct, 2022
Review #2 received at journal
07 Oct, 2022
Reviewer #2 agreed at journal
07 Oct, 2022
Reviewer #1 agreed at journal
07 Oct, 2022
Reviewers invited by journal
07 Oct, 2022
Submission checks completed at journal
04 Oct, 2022
Editor assigned by journal
03 Oct, 2022
First submitted to journal
03 Oct, 2022

You are reading this latest preprint version

AKT1 Regulates UHRF1 Protein Stability and Promotes the Resistance to Abiraterone in Prostate Cancer

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materals And Methods

Statistical analysis

Results

Discussion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1