Animals
A total of 500 30-week-old laying hens (Line BH-01, bred by Sichuan Agriculture University for six generations with black shanks and dotted yellow feathers) were raised under a photoperiod of 16 h of light and 8 h of darkness (16L: 8D). Their oviposition time was monitored and recorded every 30 min from 06:00 h to 16:00 h. Zeitgeber time (ZT) is the nomenclature for time in light-dark cycle. The light in the chicken’s pen was turned on at 06:00 h and turned off at 20:00 h. Illumination was provided by one row of un-shaded incandescent lamps (25 Watts); the mean luminance at a height of 2 m was 15 Lux. ZT0 (06:00 h) was the time at which the lamps were turned on, and subsequent times of light simulation lasted were denoted as ZT4 (10:00 h), ZT8 (14:00 h), ZT12 (18:00 h), ZT16 (22:00 h), and ZT20 (02:00 h), respectively.
Sample collection and RNA extraction
Eighteen hens with similar oviposition time were sacrificed at ZT4, ZT8, ZT12, ZT16, ZT20, and ZT0 (ZT24) (three birds at successive 4-h intervals) by cervical dislocation and their uterine tissues were collected. All uterine samples were quickly frozen in liquid nitrogen and further stored at -80℃ until assayed for RNA and qRT-PCR analyses.
Morphological observation and histological staining
The uterine tissues were cut into sections and were embedded in paraffin for 24 h for further observation of morphological changes. Thereafter, sections were stained with hematoxylin and eosin (H&E) for observation under a fluorescence microscope (DP80; Olympus, Japan); 10 fields were randomly selected for statistical analysis.
Library construction and RNA-Seq
Total RNA was isolated from uterine tissues using TRIzol Reagent (Invitrogen, CA, USA) following the manufacturer’s protocol. We determined the concentration and purity of RNA samples, and the integrity of 18S and 28S rRNA bands using A260/280 absorbance ratio and 2% agarose gel electrophoresis respectively. The cDNA libraries of small RNAs were generated using a Truseq™ RNA sample prep kit (Illumina) according to the manufacturer’s instructions and RNA sequencing was performed with an Illumina Hiseq 2500 system (Denovo Gene, Guangzhou, China).
Identification of circadian miRNAs
The R software package was used to identify the circadian miRNAs through JTK_CYCLE analysis as previously described [42]. Results of JTK_CYCLE analysis were represented as Q-value, P-value, and PER period value. Whereas the P and Q values denote the significance of miRNA rhythmic expression, the PER value stands for the rhythm cycle time. The miRNAs with both Q- and P-values < 0.05 and a periodic PER value of 20–24 were considered as candidate circadian miRNAs.
Bioinformatics analysis
In this study, we filtered the raw reads to obtain clean reads as previously described [43]. The miRNAs expressed were calculated and plotted in the heatmaps (R software v.3.2.4.). Thereafter, we constructed a regulatory interaction network between clock-controlled miRNAs and their target genes using integrative miRNA target-prediction (http://www.targetscan.org/vert_72/ and http://mirdb.org/index.html) [44] and network-analysis (Cytoscape software) [45]. We further conducted Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis to identify the biological functions of the target genes.
Dual-luciferase reporter assay
Chicken embryo fibroblast cell line (DF-1) were seeded in 48-well cell plates and cultured with growth medium containing F12 (Hyclone, State of Utah, USA) + 10% fetal bovine serum (Gibco, Langley, OK) in a cell culture incubator at 37 ℃, 5% CO2 and 95% air saturated humidity. Reaching a cell density coverage of 70 ~ 80%, the plasmid (ATP2B4-3′UTR wild type or mutant type) was co-transfected with mimic negative control (NC) and miR-449c-5p respectively. Later (after 48 h), luciferase activity was tested using a luciferase reporter assay kit (Promega, Madison, WI, USA) following the manufacturer’s instructions.
Immunohistochemical analysis
Uterine samples were collected at these time points ZT4, ZT8, ZT12, ZT16, ZT20, and ZT24, respectively, and were washed in sterile PBS thrice. Thereafter, they were fixed in 4% paraformaldehyde at room temperature (RT) for 20min, after which they were treated with hydrogen peroxide solution (3%) to deactivate the endogenous enzymes. Subsequently, the samples were washed in PBS solution for 5 min, and then a blocking reagent (goat serum) was added at RT for 20 min after which they were incubated with primary antibody rabbit anti-ATP2B4 (Abcam, Cambridge, UK) overnight at 4℃. After the incubation process, the samples were washed and incubated again with fluorescence-labeled secondary antibody at RT for 30 min. After the second incubation process, the samples were further washed in a PBS solution and incubated again for the third time with peroxidase (POD)-labeled streptavidin (DyLight 488) at RT for 30 min. A DAB kit (BBI, Canada) was used for color development at RT for 5 ~ 30 min, which was proceeded by observation, and then photomicrographs were obtained using a light microscope (Nikon Eclipse E100, Japan) equipped with an imaging system (Nikon DS-U3, Japan). The images obtained were analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Silver Spring, USA).
Uterine tubular gland cell culture and transfection
Both ends of the uterine tissue were ligated with a cotton thread and were repeatedly dissected and cleaned with sterile Hank’s balanced salt solution, thereafter the endometrial tissue was collected and cut into pieces. The cells were digested with collagenase (1 mg/mL; type I, Sigma) in a water bath at 37 ℃ for 50 ~ 60 min, and then centrifuged, after which the supernatant was discarded. This was proceeded by resuspending the cells in a growth medium containing F12 (Hyclone) + 10% fetal bovine serum (Gibco) + 0.1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA), and was seeded in 75 cm2 cell culture bottles (T75) (Costar, Cambridge, MA, USA). They were then cultured in a cell culture incubator at 37 ℃, 5% CO2, and 95% air saturated humidity for 3 h before the supernatant was filtered (using cell sieve No.200). Cell counts were performed before they were placed in a 6-well plate (1 × 106 cells/well) for further culturing [46]. We then conducted cell transfection after the cells reached a coverage density of 70–80% using lipofectamine 3000 reagent (Invitrogen, USA), according to the manufacturer’s instructions. The miR-449c-5p mimic, miR-449c-5p inhibitor, mimic negative control (mimic NC), inhibitor NC, small interfering RNA (Si-ATP2B4), siRNA negative control (Si-NC), ATP2B4 overexpression plasmid (pcDNA3.1-ATP2B4), and empty pcDNA3.1 vector used in this study were designed and purchased from RiboBio (Guangzhou, China).
Immunofluorescence analysis
Immunofluorescence analysis was carried out to identify the tubular gland cells of the chicken uterus. Uterine tubular gland cells were placed in a 6-well plate, and were washed in PBS for 5min. Subsequently, the cells were fixed in 4% paraformaldehyde for 10 min and washed again; thereafter, 0.2% Triton X-100 was added to ensure permeability of the cell membrane for 10 min. The cells were washed and subsequently incubated overnight at 4℃ using primary antibody rabbit anti-Cytokertin 18 (Bioss, Beijing, China). The next morning, the cells were washed and incubated with fluorescence-labeled secondary antibody at dark room temperature for 1h. Cells were finally washed in a Tris-Buffered Saline Tween-20 (TBST) and we then observed and analyzed fluorescence intensity using a fluorescence microscope (DP80; Olympus, Japan).
Calcium ion detection in uterine tubular gland cells
The cells were cultured in 96-well plates and a calcium ion detection kit (BBcellProbe F03, BestBio Biotech Co. Ltd., Shanghai, China) was used to measure calcium ion concentration in uterine tubular gland cells following the manufacturer’s instructions. BBcellProbe F03 fluorescence probe was combined with the intracellular calcium ions to produce a strong fluorescence. Values of fluorescence intensity were measured using a microplate reader (Thermo Fisher, Varioskan LUX, USA) at an excitation wavelength of 490 nm and an emission wavelength of 516 nm. Subsequently, the fields were observed and photographed using a fluorescence microscope (DP80; Olympus, Japan). Three fields were randomly selected and Image-Pro plus software was used for the statistical analysis.
Quantitative real-time PCR (qRT-PCR)
qRT-PCR analysis was conducted with a reaction volume of 10 µL containing 5 µL TB GreenTM Premix (Takara), 0.5 µL forward and reverse primers, 1 µL cDNA, and 3 µL DNase/RNase-Free Deionized Water (Tiangen, Beijing, China). Reaction conditions followed proper protocols and instructions. Chicken GAPDH and U6 were used as internal controls. According to a gene bank, the primers were designed by Oligo 6.0 software and Primer premier 5.0 software; the primers used are listed in Table 1.
Table 1
Gene
|
Sequence (5' − 3')
|
Product Length (bp)
|
Annealing Temperature (℃)
|
ATP2B4
|
F: CCTCCGTCAATTCCACTCCC
|
89
|
58
|
R: CTACGGAACGCATTCACCAC
|
GAPDH
|
F: TCCTCCACCTTTGATGCG
|
146
|
59
|
R: GTGCCTGGCTCACTCCTT
|
F: Forward primer; R: Reverse primer.
|
Western blotting assay
Uterine tubular gland cells were lysed in lysis buffer (BestBio) and the total protein concentration was quantified using a BCA assay (BestBio) according to the manufacturer’s protocol. Immunoblots were performed using prescribed primary and secondary antibodies such as anti-ATP2B4 (PMCA4) (1:1000, Abcam) and goat anti-mouse IgG (Zen-Bio, Chengdu, China) respectively. Western blot procedures were conducted as previously described [47].
Statistical analysis
Data were expressed as mean ± standard error (SE). Statistical significance was assessed by one-way ANOVA followed by Duncan’s multiple range tests. SAS 9.3 (SAS Inst., Cary, North Carolina, USA) for Windows (GraphPad Software, San Diego, CA, USA) was used for all the statistical analyses. Differences were considered significant at P < 0.05 (*) and P < 0.01 (**).