Intraperitoneal injection of 5-azacytidine alleviates nerve injury-induced chronic neuropathic pain in rats: the involvement of DNA methylation in the lumbar spinal cord

doi:10.21203/rs.3.rs-2131664/v1

Download PDF

Research Article

Intraperitoneal injection of 5-azacytidine alleviates nerve injury-induced chronic neuropathic pain in rats: the involvement of DNA methylation in the lumbar spinal cord

https://doi.org/10.21203/rs.3.rs-2131664/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 11 Jan, 2023

Read the published version in Molecular Neurobiology →

You are reading this latest preprint version

Aims

To investigate the role of DNA methylation in modulating chronic neuropathic pain (NPP), identify possible target genes of DNA methylation involved in this process, and preliminarily confirm the medicinal value of the DNA methyltransferase (DNMT) inhibitor 5-azacytidine (5-AZA) in NPP by targeting gene methylation.

Methods

Two rat NPP models, chronic constriction injury (CCI) and spinal nerve ligation (SNL), were used. The DNA methylation profiles in the lumbar spinal cord were assayed using an Arraystar Rat RefSeq Promoter Array. The underlying genes with differential methylation were then identified and submitted to Gene Ontology and pathway analysis. Methyl-DNA immunoprecipitation quantitative PCR (MeDIP-qPCR) and quantitative reverse transcription-PCR (RT‒qPCR) were used to confirm gene methylation and expression. The protective function of 5-AZA in NPP and gene expression were evaluated via behavioral assays and RT‒qPCR, respectively.

Results

Analysis of the DNA methylation patterns in the lumbar spinal cord indicated that 1205 differentially methylated fragments in CCI rats were located within DNA promoter regions, including 638 hypermethylated fragments and 567 hypomethylated fragments. The methylation levels of Grm4, Htr4, Adrb2, Kcnf1, Gad2 and Pparg, which are associated with long-term potentiation (LTP) and glutamatergic synapse pathways, were increased with a corresponding decrease in their mRNA expression, in the spinal cords of CCI rats. Moreover, we found that the intraperitoneal injection of 5-AZA (4 mg/kg) attenuated CCI- or SNL-induced mechanical allodynia and thermal hyperalgesia. Finally, the mRNA expression of hypermethylated genes such as Grm4, Htr4, Adrb2, Kcnf1 and Gad2 was reversed after 5-AZA treatment.

Conclusion

Increasing methylation is a novel negative regulatory mechanism of target gene expression in chronic NPP. In rats, the intraperitoneal injection of 5-AZA alleviated spinal nociception, an effect accompanied by the reversed expression of hypermethylated genes. Thus, DNA methylation inhibition represents a promising strategy for protection against chronic NPP following nerve injury. Our study lays a theoretical foundation for 5-AZA to become a clinical targeted drug.

chronic neuropathic pain

nerve injury

lumbar spinal cord

5-azacytidine

epigenetic

DNA methylation

Neuropathic pain (NPP) is the most common category of pathological pain^[1] and is defined as pain brought on by a lesion or illness that affects the nervous system at either the peripheral or central level ^[2]. It is estimated that NPP has a prevalence of 6–10% in the general population, and it causes difficulties in daily activities and decreases productivity at work ^{[3, 4]}, resulting in poorer quality of life. However, current treatments for NPP are poorly effective because of the limited understanding of the molecular mechanisms involved. It has been established that central sensitization in the spinal cord plays a crucial role in the NPP condition ^{[5, 6]}, and altered gene expression contributes critically to the central sensitization and the initiation and maintenance of chronic NPP ^[7–9]. Notably, long-term NPP in animals led to alterations in mRNA expression across the genome, indicating that gene expression in the spinal cord is also significantly altered in response to chronic pain ^[10–12]. Interestingly, therapies that alleviate pain are accompanied by the reverse of chronic pain-induced regulation of pain-related mediators in the spinal cord ^[13–15].

Without changing the underlying genetic sequence, epigenetic regulation enables the steady control of gene expression to produce cell-type-specific phenotypes in response to experiential and environmental inputs ^[16]. DNA methylation is an epigenetic process that can be involved in the long-term control of gene expression ^[17]. DNA methyltransferases (DNMTs), which transfer a methyl group from the methyl donor s-adenosyl methionine to cytosine bases in the DNA, catalyze the methylation of DNA ^[17]. Typically, DNA methylation in a gene's promoter region causes epigenetic inhibition of gene expression ^[18].

Numerous studies have shown that chronic pain is associated with changes in DNA methylation throughout cells and tissues involved in pain pathways, including the dorsal root ganglion (DRG) ^{[19, 20]}, spinal cord ^{[21, 22]}, and brain ^{[23, 24]}. Additionally,

artificial enrichment reducing the DNA methylation levels in the spinal cord successfully attenuated pain ^{[25, 26]}. As DNMT inhibitors and regulators, 5-azacytidine (5-AZA) and 5-aza-2-deoxycytidine are used to treat a variety of pain-related or pain-comorbid disorders, such as cognitive impairment, depression, osteoarthritis, and cancer pain. ^[27–30]. However, the specific genes and biological systems associated with effective treatment of NPP in the spinal cord have not been well explored. Little is known about methylated genes which 5-AZA targets in the spinal cord during chronic NPP. The discovery of these systems will shed light on the processes by which the epigenome is altered by chronic NPP and how the epigenome might be therapeutically addressed.

We have already shown that abnormal DNA methylation is involved in constriction injury (CCI)-induced NPP ^[21]. In this study, we use an Arraystar Rat RefSeq Promoter Array to analyze changes in DNA methylation at the genome-wide level in the spinal cord caused by peripheral nerve injury. We show that CCI induces widespread lumbar spinal cord methylation changes, and more than 1200 genes are differentially methylated after CCI. Furthermore, the specific hypermethylated genes are located mainly in long-term potentiation (LTP) and glutamatergic synapse pathways. Moreover, intraperitoneal injection of 5-AZA alleviates mechanical allodynia and thermal hyperalgesia and counteracts changes in hypermethylated gene mRNA expression induced by chronic NPP following CCI- or spinal nerve ligation (SNL).

2.1. Animals

In this study, male Sprague‒Dawley (SD) rats weighing 220–250 g were employed. All animals were kept in a setting with a temperature of 22 ± 1°C, a relative humidity of 50 ± 1%, and a cycle of light and dark of 12 hr. They had access to food and water at all times in their separate cages. All protocols were approved by the ethics committee of the Fujian Cancer Hospital and adhered to Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

2.2. Experimental paradigm

Behavioral testing was performed before surgery and at 3, 5, 7, 10 and 14 Days after surgery in each rat. Under deep anesthesia, all the rats were killed and their ipsilateral lumbar spinal cords were immediately dissected 14 Days after behavioral testing. The first six rats were randomly divided into two groups and subjected to CCI or sham surgery (n = 3 for each group). On Day 14 after surgery, CCI rats and sham rats were killed under deep anesthesia, and their ipsilateral lumbar spinal cords were dissected for methyl-DNA immunoprecipitation (MeDIP)-on-chip and microarray data analysis. Then, to verify the chip results and assess the methylation of target genes by using MeDIP-qPCR, six rats were randomly divided into CCI and sham groups (n = 3), and their ipsilateral lumbar spinal cords were dissected on Day 14 after surgery. Next, twelve rats were randomly divided into CCI and sham groups (n = 6), and their ipsilateral lumbar spinal cords were used to detect the mRNA levels of target genes. Furthermore, to study the effects of 5-AZA on CCI-induced NPP, eighteen rats were randomly divided into three groups (n = 6 for each group): the sham + NS group, CCI + NS group and CCI + AZA group. CCI + AZA rats were treated with intraperitoneal (i.p.) injection of 4 mg/kg 5-AZA at a concentration of 1 mg/ml (Sigma, USA) once a day from Days 3 to 14 after CCI. Meanwhile, rats in the sham + NS group and CCI + NS group received the same volume of 0.9% saline. Moreover, to demonstrate the effects of 5-AZA on SNL-induced NPP, eighteen rats were randomly divided into three groups to receive SNL surgery (n = 6 for each group): the Sham + NS group, SNL + NS group and SNL + AZA group. From Days 3 to 14, the SNL + 5-AZA group rats were treated with 4 mg/kg 5-AZA (1 mg/ml, i.p., Sigma, USA) once daily. Meanwhile, Sham + NS and SNL + NS rats received the same volume of 0.9% saline. All intraperitoneal injections were administered between 9:00 am and 12:00 am. On Day 14 after surgery, the ipsilateral lumbar spinal cords of the last thirty-six rats were dissected to detect the mRNA levels of target genes after behavioral testing.

2.3. NPP model

2.3.1. Chronic constriction injury (CCI)

The CCI procedure was performed as previously described ^[31]. Briefly, rats were anesthetized with pentobarbital sodium (40 mg/kg, i.p.). The trunk of the right sciatic nerve was freed before it branched. Next, 4–0 chromic catgut was used to mildly ligate the trunk of the nerve with appropriate strength to slightly compress the epineuria and cause gentle tremor in the associated muscles. Four ligatures were made at intervals of 1 mm in the sciatic nerve trunk. Sham rats underwent the same surgical procedures without ligatures placement.

2.3.2. Spinal nerve ligation (SNL)

The SNL procedure was performed on the right L5 spinal nerve as previously described ^[32]. In short, the dorsal vertebral column of L4–L6 was surgically exposed under pentobarbital sodium anesthesia (40 mg/kg,ip). At L4–L6, the paraspinal muscles were dissociated from the spinal processes, and the L5 transverse process was delicately removed. The right L5 spinal nerve was exposed and firmly ligated distal to the DRG using 4–0 silk sutures. In the sham-operated group, the same procedure was followed, except that the L5 spinal nerve was not ligated.

2.4. Behavioral testing

The 2390 Electronic von Frey Anesthesiometer (IITC Life Science, USA) and the 37370 Plantar Test Instrument (Ugo Basile, Italy) were used to measure the mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL) in all rats before and 3, 5, 7, 10 and 14 Days after surgery, respectively, as previously described ^{[25, 26]}. The two tests ended with paw removal followed by distinct flinching movements. The intensity was automatically recorded after paw withdrawal. At five-minute intervals, each rat was measured five times. The maximum and minimum values were subtracted before averaging the MWT and TWL. All behavioral measurements were performed between 2:00 pm and 5:00 pm by a researcher who was blinded to the group assignment.

2.5. Methyl-DNA immunoprecipitation (MeDIP)-on-chip

Genomic DNA was extracted from lumbar spinal cords using a DNeasy Blood & Tissue Kit (Qiagen, Germany). Using a Bioruptor sonicator (Diagenode, Belgium), genomic DNA from each sample was sonicated to around 200–1000 bp fragments. One microgram of fragmented genomic DNA was immunoprecipitated with a mouse monoclonal anti-5-methylcytosine antibody (Diagenode, Belgium). MeDIP DNA was purified using Qiagen MinElute columns (Qiagen, Germany). The NimbleGen Dual-Color DNA Labeling Kit (NimbleGen Systems, USA) was used for DNA labeling. One microgram of DNA from each sample was incubated for 10 min at 98°C with 1 OD of Cy5-9mer primer (IP sample) or Cy3-9mer primer (input sample). The Arraystar Rat RefSeq Promoter Array (Arraystar, USA) was hybridized with labeled DNA. In order to study the epigenetic modifications and transcription factor binding sites within RefSeq gene promoter regions, this array covered 15,987 gene promoter regions (from around − 1300 bp to + 500 bp of the TSSs) by ~ 180,000 probes with a spacing of approximately 158 bp. Finally, an Agilent G2505C Scanner (Agilent Technologies, Germany) was used to wash and scan the arrays.

2.6. Microarray data analysis

From the normalized log2-ratio data, a sliding-window (1500 bp) peak-finding algorithm provided by NimbleScan v2.5 (Roche-NimbleGen, Sweden) was applied to analyze the MeDIP-chip data. A one-sided Kolmogorov‒Smirnov (KS) test was used to determine whether the probes were drawn from a significantly more positive distribution of intensity log2-ratios than the rest of the array. The region was assigned to an enrichment peak (EP), if several adjacent probes were increased significantly above a set threshold. The NimbleScan sliding-window peak-finding algorithm was rerun to identify the differentially enriched peaks (DEPs). Genes containing DEPs in the promoter were categorized as differentially methylated genes (DMGs). Then the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were used to analyze these genes. The significance of the pathway correlation to the conditions was denoted by the p value. The Gene Ontology project offers a controlled vocabulary to describe gene and gene product properties in any organism (http://www.geneontology.org). Three domains of biological process, cellular component and molecular function are all covered by Gene Ontology terms. To determine whether there was greater overlap between the DE list and the GO annotation list than would be predicted by chance, Fisher's exact test was utilized. The significance of GO term enrichment in the DE genes was denoted by the p value.

2.7. Real-time PCR on MeDIP-enriched DNA

The MeDIP assay combined with real-time PCR was used to quantitatively assess the methylation status of target genes to verify MeDIP-chip results. DNA extraction and MeDIP were performed as described above (2.5). We carried out real-time PCR with immunoprecipitated methylated DNA and input DNA by using the ViiA 7 Real-time PCR System (Applied Biosystems, USA), and 2 × PCR master mix (Arraystar, USA). The methylation levels of Grm4, Htr4, Adrb2, Kcnf1, Gad2 and Pparg were evaluated. The primers used for MeDIP-qPCR are shown in Table 1. 2^−△△CT values were used, and the relative enrichment of methylation in each sample was calculated using the signal ratios of immunoprecipitated DNA to input DNA: %MeDIP/Input = 2 (Ct^Input-Ct^ChIP) × Fd × 100%, Fold Enrichment = [% (MeDIP/Input)]/[% (Negative control/Input)].

Table 1

Primer sequences for MeDIP-qPCR analysis
Gene	Primer	Sequence (5´–3´)	bp
Grm4	Forward Reverse	CCTGCGGCATACTCATTCG AGGTGGATTCGCCTTTCG	80
Htr4	Forward Reverse	CCAGAGCTGGACGCTAACG TGAGGATTCAGGGACCGAG	134
Adrb2	Forward Reverse	CGCACAGCAGTCCCAGATT GGAGGGGCGAGGCACTAA	160
Kcnf1	Forward Reverse	CAGTGCTCGGGAGTGTCAGA GGGTTCAGGCTGCCAAGTC	169
Gad2	Forward Reverse	GGTTTGGAGGAAGGAGGGTG CAGCGATTGGCTCATTGTTTG	85
Pparg	Forward Reverse	ACGGAGCGTGACAGACAAAGT CTTCTCCTCAGACCGCATCC	132

2.8. Quantitative reverse transcription-PCR

The mRNA expression of the genes was determined by quantitative reverse transcription-PCR (RT‒qPCR). TRIzol Reagent (Invitrogen, USA) was used to extract total RNA. The cDNA templates were synthesized by reverse transcription using the SuperScript™ III First-Strand Synthesis System for RT‒PCR (Invitrogen, USA) and then saved at − 20°C. The ViiA 7 Real-time PCR System (Applied Biosystems, USA) and 2 × PCR master mix (Arraystar, USA) were used to perform real-time PCR. GAPDH was used as an internal standard, and the standard curve method was used to determine the relative expression levels of the target genes. Primers were produced by Shanghai Lifei Biotechnology Co., Ltd. in China and are listed in Table 2.

Table 2

Primer sequences for RT‒qPCR analysis
Gene	Primer	Sequence (5´–3´)	bp
Grm4	Forward Reverse	AGTGACAACAGCCGCTATGAC CACACACCTCCGTTCTCTCG	188
Htr4	Forward Reverse	TTTCAGACGTGCCTTCCTTAT CACCACATTCCACTGTATCCC	143
Adrb2	Forward Reverse	CACTCAGGAACGGGACGAA GTTATGAAGTAGTTGGTGACGGT	147
Kcnf1	Forward Reverse	CTCATCCTTGTCTCCTCCGTG CGTTGGTCAGTTCCATCATTC	283
Gad2	Forward Reverse	CGCACTGCCAAACAACTCTAA ATCTGCTGCTAATCCAACCAT	101
Pparg	Forward Reverse	TGCGGAAGCCCTTTGGT GCAGCAGGTTGTCTTGGATGT	177
GAPDH	Forward Reverse	GCTCTCTGCTCCTCCCTGTTCTA TGGTAACCAGGCGTCCGATA	124

2.9. Statistical analyses

The GraphPad Prism 5.0 software (GraphPad Software, CA) was used to conduct all statistical analyses. Data is presented as the mean ± SEM. The Student's t test was used for comparisons between two groups. Differences between sham, CCI or SNL and 5-AZA treatment conditions were analyzed using one-way analysis of variance (ANOVA) followed by Tukey's or Bonferroni’s post hoc test for multiple comparisons. P < 0.05 was considered significant.

3.1. DNA methylation status in response to CCI in the lumbar spinal cord in rats

MWT and TWL in rats were measured using behavioral tests. Two-way repeated-measures ANOVA showed MWT and TWL significantly decreased in the CCI rats than in the sham rats from 3 to 14 Days after surgery (all P < 0.01, Fig. 1A), indicating mechanical allodynia and thermal hyperalgesia in CCI rats were successfully established.

To study whether CCI led to abnormal methylation changes in DNA promoter regions at the genome-wide level, the Arraystar Rat RefSeq Promoter Arrays covering 15,987 gene promoter regions (between approximately − 1300 and + 500 bp of the TSSs) with ~ 180,000 probes separated by around 158 bp were used to detect differentially methylated regions in the DNAs which were extracted from lumbar spinal cord of the CCI and sham rats on Day 14 (Supplementary Table 1). There were 1205 differentially methylated fragments within DNA promoter regions, including 638 hypermethylated fragments and 567 hypomethylated fragments in CCI rats (Fig. 1B, C). And the hypermethylated fragments contained 292 (45.77%) high CpG-density promoters (HCP), 169 (26.49%) intermediate CpG-density promoters (ICP), and 177 (27.74%) low CpG-density promoters (LCP) (Fig. 1D).

3.2. Differentially methylated functional domains and signaling pathways in CCI rats

Gene Ontology (GO) analysis was used to identify ontology terms enriched among differentially methylated genes (DMGs) in the lumbar spinal cord of CCI rats. DMGs between hyper and hypomethylated regions in response to peripheral nerve injury were identified. The top 10 enriched ontologies of hyper and hypomethylated DMGs after CCI are shown in Fig. 2A and B. Organism process, developmental process, anatomical structure development, and ion transport were the top GO terms enriched among hypermethylated genes. While cellular component organization or bigenesis, establishment of localization, and transport were the top GO terms enriched among hypomethylated genes.

To identify the signaling pathways associated with these differentially methylated CpGs and genes, DMGs with p values < 0.05 were annotated using KEGG pathway analysis. The results of KEGG pathway analysis revealed that hypermethylated genes in the CCI group were enriched in a wide variety of biological processes involved in long-term potentiation (LTP), glutamatergic synapse, calcium signaling, and cAMP signaling pathways (Fig. 2C). While hypomethylated genes were enriched in the cell cycle and peroxisome pathways. Taken together, the results indicated that the methylation of genes associated with distinct biological processes was altered in response to peripheral nerve injury. The full list of GO terms and pathways enriched in the differentially methylated genes can be found in Supplementary Tables 2 and 3.

3.3. Screening and verification of differentially methylated genes in CCI rats

In accordance with the specified conditions, the hypermethylated DNAs in promoter regions were identified from the above microarray findings. Table 3 summarizes the six selected hypermethylated genes that predict the chronic NPP-related pathological signature in CCI rats, in order of PeakScore from high to low.

Table 3

The detailed information of selected hypermethylated genes for chronic neuropathic pain-related pathological signature
Gene Name	LocusLink ID	Location	Distance From TSS	PeakScore	PeakDMValue
Grm4	24417	chr20:5727530–5728514	-748	3.6	0.1079867
Htr4	25324	chr18:58415861–58417339	-560	2.76	0.0754781
Adrb2	24176	chr18:58176502–58176863	317	2.47	0.0806944
Kcnf1	298908	chr6:40912729–40913426	-9	2.46	0.0475188
Gad2	24380	chr17:96258807–96259009	-521	2.43	0.1376718
Pparg	25664	chr4:151491931–151493082	-939	2.41	0.0887667
Note: "PeakScore" the average -log10 (P-value) from probes within the peak; "PeakDMvalue" the median M' values from probes within the differential methylation peak.

We further validated the methylation status of 6 chronic NPP-related genes in rats by MeDIP-qPCR. As shown in Fig. 3, we observed that the methylation levels of Grm4, Htr4 and Kcnf1 were significantly increased in the CCI group compared to the sham group (P < 0.05 vs. the sham group, n = 3). Meanwhile, CCI-induced gene (Adrb2, Gad2 and Pparg) methylation was increased in comparison with the sham group. However, the methylation of Adrb2, Gad2 and Pparg was upregulated with no statistical significance (n = 3). These results indicated that the methylation levels of various genes, including Grm4, Htr4, Kcnf1, Adrb2, Gad2 and Pparg, might be enhanced by peripheral nerve injury.

3.4. Expression level of pain-related genes in the lumbar spinal cord after CCI

In line with the alterations in DNA methylation, gene expression detection by RT‒qPCR showed a decrease in the mRNA expression of Grm4, Htr4, Adrb2, Kcnf1 and Pparg in the CCI group compared with the sham group (P < 0.05, Fig. 4). However, Gad2 mRNA expression was consistently reduced, albeit without statistical significance. Based on these findings, peripheral nerve injury could alter the expression and methylation of Grm4, Htr4, Adrb2, Kcnf1 and Pparg genes in rats following the CCI procedure.

3.5. 5-AZA alleviated hyperalgesia and induced pain-related gene expression changes in the lumbar spinal cord after CCI

We examined the MWT and TWL after the intraperitoneal injection of 5-AZA in the CCI-induced NPP model. The MWT and TWL were recorded before CCI (baseline) and on Days 3, 5, 7, 10 and 14 after CCI (Fig. 5A). The baseline MWT and TWL in each group showed no significant differences. Compared to those in the Sham + NS group, the MWT and TWL were significantly reduced in the CCI + NS and CCI + AZA groups after CCI from Day 3 (all P < 0.05, Fig. 5B), indicating successful establishment of the CCI-induced NPP model. Mechanical allodynia and thermal hyperalgesia were partially improved on Day 5 in the CCI + AZA group compared to the CCI + NS group, and this improvement was maintained throughout the study (all P < 0.05, Fig. 5B). These results indicated that the intraperitoneal injection of 5-AZA alleviates the mechanical allodynia and thermal hyperalgesia induced by CCI.

Based on behavioral experiments, we explored the relationship between 5-AZA and pain-related gene expression using RT‒qPCR analysis. All pain-related genes (Grm4, Htr4, Adrb2, Kcnf1, Gad2 and Pparg) were evaluated on Day 14 after 5-AZA injection. The results showed that the mRNA expression of Grm4, Htr4, Adrb2 and Kcnf1 was significantly increased in the CCI + 5-AZA group compared to the CCI + NS group (P < 0.05, Fig. 5C).

3.6. 5-AZA alleviated hyperalgesia and induced pain-related gene expression changes in the lumbar spinal cord after SNL

We next examined the MWT and TWL after intraperitoneal injection of 5-AZA in the SNL-induced NPP model. MWT and TWL were recorded before SNL (baseline) and on Days 3, 5, 7, 10 and 14 (Fig. 6A). The baselines of MWT and TWL in each group showed no significant differences. Compared to the Sham + NS group, the MWT and TWL were significantly reduced in the SNL + NS and SNL + AZA groups from Day 3 after SNL (all P < 0.05, Fig. 6B), indicating the successful establishment of the SNL-induced NPP model. Mechanical allodynia and thermal hyperalgesia were partially improved on Day 5 in the SNL + AZA group compared to the SNL + NS group and maintained throughout the study (all P < 0.05, Fig. 6B). These results indicated that the intraperitoneal injection of 5-AZA alleviated the mechanical allodynia and thermal hyperalgesia induced by SNL.

Based on behavioral experiments, we explored the relationship between 5-AZA and pain-related gene expression by RT‒qPCR analysis. All pain-related genes (Grm4, Htr4, Adrb2, Kcnf1, Gad2 and Pparg) were evaluated on Day 14 after 5-AZA injection. The results showed that the mRNA expression of Grm4, Htr4, Adrb2, Kcnf1 and Gad2 was significantly increased in the SNL + 5-AZA group compared to the SNL + NS group (P < 0.05, Fig. 6C).

Chronic NPP has multiple dimensions, including nociception, emotional distress, and cognitive dysfunction, and the epigenetic mechanisms are implicated in these conditions. However, the role of DNA hypermethylation in the context of methylation modulation and NPP is not entirely clear. Our results showed that NPP altered DNA methylation profiles and induced a decrease in mRNA expression of some pain-related genes. Methylation inhibition improved nociception associated with CCI/SNL-induced NPP and reversed the decrease in hypermethylated gene mRNA expression followed by nerve injury.

DNA methylation is critical in pain memory and synaptic plasticity ^[33]. Previous studies reported abnormal changes in global DNA methylation and the methylation of specific promoters in rodent lumbar spinal cords 1–21 Days following CCI/SNL surgery ^{[22, 25, 34]}. However, the methylation profiles of the DNA promoter region in the lumbar spinal cord in nerve injury-induced NPP rats have not been well explored. Here, we used the Arraystar Rat DNA Promoter Array, a reliable and efficient platform ^[35], to identify the methylation profiles at the genome-wide level in the DNA promoter regions of the lumbar spinal cord in rats 14 Days following CCI surgery. In this study, more than 1200 fragments were differentially methylated after CCI treatment, including 638 hypermethylated fragments and 567 hypomethylated fragments, which indicated that CCI could be capable of inducing widespread lumbar spinal cord methylation changes. Our previous study showed that the overall DNA methylation level in the spinal cord increased significantly in CCI rats ^[25]. Here, we focused on genes whose methylation increased and whose encoded proteins were expressed at a lower level in CCI rats.

After identifying differentially methylated genes in the lumbar spinal cord associated with CCI-induced NPP, GO analysis and KEGG pathway analysis revealed genome-wide methylation patterns. The top GO terms among hypermethylated genes were organism process, developmental process, anatomical structure development, and ion transport, while the top KEGG pathways were long-term potentiation (LTP), glutamatergic synapse, calcium signaling, and cAMP signaling pathways. Among the genes altered by NPP in the promoter region, Grm4, Htr4, Adrb2, Kcnf1, Gad2 and Pparg belonged to development processes and ion transport, and these genes are involved in LTP and glutamatergic synapse pathways ^[36–40]. Previous studies have shown that DNA methylation changes in certain genes (such as Htr4, Gad2, Adrb2 and Pparg) could interfere with the expression of their encoded proteins in some pathological states ^{[30, 41–44]}. Here, our results showed that Grm4, Htr4 and Kcnf1 were significantly hypermethylated and that Adrb2, Gad2 and Pparg were not significantly hypermethylated in CCI rats. Conversely, the mRNA levels of these genes were decreased to various degrees, suggesting the negative regulation of DNA methylation in its encoded targets under NPP conditions.

Aberrant DNA methylation in the nervous system is associated with pain conditions. Numerous studies have demonstrated the possibility of attenuating chronic pain by modulating DNA methylation ^{[22, 25, 45, 46]}. For example, restoring DNA methylation levels through the methyl donor s-adenosyl methionine, improved cognitive and emotional functions damaged by spared nerve injury ^[47]. Increased DNMT3a in the DRG led to undesirable opioid analgesic effects, and blocking this increase restored the analgesic effects of morphine or loperamide and attenuated the development of their analgesic tolerance under NPP ^[48]. Moreover, intrathecal administration of 5-AZA or decitabine, a DNMT inhibitor, reversed methylation levels corresponding to the amelioration of pain ^{[25, 26]}. The US Food and Drug Administration (FDA) has approved 5-AZA as a chemotherapy agent in the treatment of malignant tumors and myelodysplastic syndromes ^[49]. However, the operation of intrathecal administration of 5-AZA is complex, so its clinical application is limited. A previous study showed that intraperitoneal administration of 5-aza-2’-deoxycytidine provided relief from incisional nociceptive sensitization ^[46]. Thus, we examined the effect of 5-AZA on CCI/SNL-induced NPP via intraperitoneal injection for the first time, and we observed that daily intraperitoneal injection of 5-AZA (4 mg/kg) did not affect the normal movement, eating habits, body weight, or lifespan of rats.

An increase in DNA methylation in response to nerve injury is well established, and inhibiting the increase with treatment has been reported. Sun et al. found that DNMT1 expression was upregulated after peripheral nerve injury and that blocking DNMT1 could reverse the hypermethylation and abnormal excitability and sensitivity in injured DRG neurons ^[50]. Another similar study reported that blocking the upregulation of DNMTs with RG108 alleviated spared nerve injury-induced pain ^[51]. Furthermore, nerve injury or incision-related hyperalgesia can be attenuated by 5-aza-2’-deoxycytidine, which also induces α5-GABA_A receptor or Oprm1 reversion ^{[46, 52]}. DNA demethylation in the DRG was proven to alleviate SNL-induced pain hypersensitivities coinciding with rescued expression of µ-opioid receptors and the potassium voltage gated channel Kv1.2 ^[53]. Moreover, 5-AZA was reported to reverse the hypermethylation and reduced expression of Adrb2 in PM2.5-induced cardiomyocytes apoptosis ^[44]. Consistent with these studies, our results showed that 5-AZA treatment obviously attenuated CCI/SNL-induced mechanical allodynia and thermal hyperalgesia, coinciding with reversed mRNA expression of the hypermethylated genes; Grm4, Htr4, Adrb2, and Kcnf1 expression was observed in both CCI and SNL rats, and Gad2 expression was observed in SNL rats. We infer that the modulation of DNA methylation in these genes in the spinal cord through 5-AZA treatment might be a promising epigenetic mechanism and therapeutic target for the relief of chronic NPP.

Grm4 encodes metabotropic glutamate receptor 4 (mGluR4), which contributes to pain modulation by suppressing glutamatergic hyperactivation ^{[54, 55]}; its exogenous activation reversed the sensitivity imbalances of chronic NPP in the dorsal spinal region ^{[56, 57]}. Adrb2 encodes the β2-adrenergic receptor (β2-AR) ^[58], which is widely expressed in the normal and injured central nervous system ^[38]. Adrb2 activation could alleviate multiple chronic NPPs ^{[59, 60]}. Consistent with these studies, our results showed that intraperitoneal 5-AZA reversed Grm4 and Adrb2 mRNA expression, coinciding with attenuated hyperalgesia in both CCI and SNL rats. These results further demonstrate the pivotal role of Grm4 and Adrb2 in NPP. Htr4 encodes 5-hydroxytryptamine receptor 4 (5-HT4R), which has been found to produce antinociceptive or pronociceptive effects in the spinal cord ^[61–63]. We observed that Htr4 mRNA levels recovered after 5-AZA treatment in parallel with pain relief, which indicates that Htr4 may produce antinociceptive effects as an inhibitory receptor subtype of 5-HT in the lumbar spinal cord after nerve injury. KCNF1 is a potassium channel gene and encodes Kv5.1, which does not produce functional potassium current alone but can form a functional complex with Kv2.1 to result in physiological effects ^{[64, 65]}. The contribution of the Kv5.1 channel to the physiology of NPP has not been investigated, and our results first showed that the increase in Kv5.1 mRNA was reversed after 5-AZA treatment in CCI/SNL rats, suggesting that Kv5.1 may be involved in the occurrence and development of NPP. Although Gad2 and Pparg were downregulated in CCI rats ^{[66, 67]}, we observed that Gad2 was reduced only after SNL, while Pparg was decreased only after CCI. More experiments may be needed to investigate the correlations of Gad2 and Pparg with NPP. It is crucial to note that the correlation of Grm4 and Kcnf1 between DNA methylation and NPP was reported here for the first time and might become a promising direction for pain treatment.

There are a few limitations in this study. First, due to the small sample size of 3 to 6 animals, these results should be considered exploratory. Second, DNA methylation assessment was performed at only one time point and therefore cannot depict the temporal dynamics of DNA methylation in response to pain during the acute-to-chronic process. Third, the impact of 5-AZA on the target gene methylation level was not examined. As stated above, chronic systemic administration of 5-AZA relieves NPP along with the restoration of hypermethylated gene expression. Future studies incorporating the modulation of target gene methylation and protein levels are needed to characterize the explicit change during NPP. Finally, the phenomena described here are correlative; further investigation is needed to explore the causal and detailed relationships between spinal cord methylation and chronic NPP. Despite these limitations, these results provide an important insight into the DNA methylation of novel spinal cord target genes associated with the successful treatment of chronic NPP.

In summary, our findings reveal the DNA methylation profiles at the genome-wide level in the DNA promoter regions of the spinal cord in CCI rats, and offer important evidence for reversing NPP and the decrease in target gene expression caused by nerve injury by employing an epigenetic regulator to enhance methylation in CCI and SNL rats. The hypermethylation occurred mainly in genes which are associated with development, structure, and ion transport and are involved in LTP and glutamatergic synapse pathways. The methylation and mRNA levels of these target genes (Grm4, Htr4, Adrb2, Kcnf1, Gad2 and Pparg) may contribute to NPP persistence or recovery in the spinal cord after therapeutic interventions of intraperitoneal injection of 5-AZA. These findings provide crucial insight into the relationship between chronic NPP and call for the increased exploration of epigenetic interventions, such as intraperitoneal injection of 5-AZA, for the treatment of chronic NPP.

Ethics approval All protocols were approved by the ethics committee of the Fujian Cancer Hospital and adhered to Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

Consent to participate Not applicable.

Consent for publication All authors have read and approved the submission of the manuscript.

Availability of data and materials The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Funding This study was supported by the Natural Science Foundation of Fujian Province of China (No. 2021J01434), the National Natural Science Foundation of China (No. 81400921) and the Natural Science Foundation of Guangdong Province of China (No. 2018A030313781).

Authors' contributions Ying Wang and Xuan Li designed the study, collated the data, carried out data analyses, and produced the initial draft of the manuscript. DeZhao Liu and ZhiSen Dai provided critical advice and contributed to drafting the manuscript. YiSheng You, Yan Chen, ChenXing Lei and YouYou Lv performed the experiments. All authors have read and approved the final submitted manuscript.

Conflict of interest statement The authors have no conflicts of interest to declare.

Acknowledgements

This study was supported by the Natural Science Foundation of Fujian Province of China (No. 2021J01434), the National Natural Science Foundation of China (No. 81400921) and the Natural Science Foundation of Guangdong Province of China (No. 2018A030313781).

Gilron, I., R. Baron, and T. Jensen, Neuropathic pain: principles of diagnosis and treatment. Mayo Clin Proc, 2015. 90(4): 532-45.http://dx.doi.org/10.1016/j.mayocp.2015.01.018
Ralf Baron, A.B., Gunnar Wasner, Neuropathic pain: diagnosis, pathophysiological mechanisms, and treatment. The Lancet Neurology, 2010. 9(8): 807-819.http://dx.doi.org/10.1016/S1474-4422(10)70143-5
Bouhassira, D., Neuropathic pain: Definition, assessment and epidemiology. Revue Neurologique, 2019. 175(1): 16-25.http://dx.doi.org/https://doi.org/10.1016/j.neurol.2018.09.016
Bushnell, M.C., M. Ceko, and L.A. Low, Cognitive and emotional control of pain and its disruption in chronic pain. Nat Rev Neurosci, 2013. 14(7): 502-11.http://dx.doi.org/10.1038/nrn3516
Tsuda, M., K. Koga, T. Chen, and M. Zhuo, Neuronal and microglial mechanisms for neuropathic pain in the spinal dorsal horn and anterior cingulate cortex. J Neurochem, 2017. 141(4): 486-498.http://dx.doi.org/10.1111/jnc.14001
West, S.J., K. Bannister, A.H. Dickenson, and D.L. Bennett, Circuitry and plasticity of the dorsal horn--toward a better understanding of neuropathic pain. Neuroscience, 2015. 300: 254-75.http://dx.doi.org/10.1016/j.neuroscience.2015.05.020
Liu, Y., L.-J. Zhou, J. Wang, D. Li, W.-J. Ren, J. Peng, X. Wei, T. Xu, W.-J. Xin, R.-P. Pang, Y.-Y. Li, Z.-H. Qin, M. Murugan, M.P. Mattson, L.-J. Wu, and X.-G. Liu, TNF-α Differentially Regulates Synaptic Plasticity in the Hippocampus and Spinal Cord by Microglia-Dependent Mechanisms after Peripheral Nerve Injury. The Journal of Neuroscience, 2017. 37(4): 871-881.http://dx.doi.org/10.1523/jneurosci.2235-16.2017
Woolf, C.J., Central sensitization: implications for the diagnosis and treatment of pain. Pain, 2011. 152(3 Suppl): S2-S15.http://dx.doi.org/10.1016/j.pain.2010.09.030
Voscopoulos, C. and M. Lema, When does acute pain become chronic? Br J Anaesth, 2010. 105 Suppl 1: i69-85.http://dx.doi.org/10.1093/bja/aeq323
Parisien, M., A. Samoshkin, S.N. Tansley, M.H. Piltonen, L.J. Martin, N. El-Hachem, C. Dagostino, M. Allegri, J.S. Mogil, A. Khoutorsky, and L. Diatchenko, Genetic pathway analysis reveals a major role for extracellular matrix organization in inflammatory and neuropathic pain. Pain, 2019. 160(4): 932-944.http://dx.doi.org/10.1097/j.pain.0000000000001471
Hozumi, T., S. Sawai, T. Jitsuishi, K. Kitajo, K. Inage, Y. Eguchi, Y. Shiga, M. Narita, S. Orita, S. Ohtori, and A. Yamaguchi, Gene expression profiling of the spinal cord at the chronic pain phase identified CDKL5 as a candidate gene for neural remodeling. Neurosci Lett, 2021. 749: 135772.http://dx.doi.org/10.1016/j.neulet.2021.135772
Du, H., Z. Liu, X. Tan, Y. Ma, and Q. Gong, Identification of the Genome-wide Expression Patterns of Long Non-coding RNAs and mRNAs in Mice with Streptozotocin-induced Diabetic Neuropathic Pain. Neuroscience, 2019. 402: 90-103.http://dx.doi.org/10.1016/j.neuroscience.2018.12.040
Ghosh, K. and H.L. Pan, Epigenetic Mechanisms of Neural Plasticity in Chronic Neuropathic Pain. ACS Chem Neurosci, 2022. 13(4): 432-441.http://dx.doi.org/10.1021/acschemneuro.1c00841
Hsieh, M.C., Y.C. Ho, C.Y. Lai, D. Chou, H.H. Wang, G.D. Chen, T.B. Lin, and H.Y. Peng, Melatonin impedes Tet1-dependent mGluR5 promoter demethylation to relieve pain. J Pineal Res, 2017. 63(4).http://dx.doi.org/10.1111/jpi.12436
Hsieh, M.C., C.Y. Lai, Y.C. Ho, H.H. Wang, J.K. Cheng, Y.P. Chau, and H.Y. Peng, Tet1-dependent epigenetic modification of BDNF expression in dorsal horn neurons mediates neuropathic pain in rats. Sci Rep, 2016. 6: 37411.http://dx.doi.org/10.1038/srep37411
Topper, M.J., M. Vaz, K.A. Marrone, J.R. Brahmer, and S.B. Baylin, The emerging role of epigenetic therapeutics in immuno-oncology. Nat Rev Clin Oncol, 2020. 17(2): 75-90.http://dx.doi.org/10.1038/s41571-019-0266-5
Morgan, A.E., T.J. Davies, and M.T. Mc Auley, The role of DNA methylation in ageing and cancer. Proc Nutr Soc, 2018. 77(4): 412-422.http://dx.doi.org/10.1017/S0029665118000150
Perri, F., F. Longo, M. Giuliano, F. Sabbatino, G. Favia, F. Ionna, R. Addeo, G. Della Vittoria Scarpati, G. Di Lorenzo, and S. Pisconti, Epigenetic control of gene expression: Potential implications for cancer treatment. Crit Rev Oncol Hematol, 2017. 111: 166-172.http://dx.doi.org/10.1016/j.critrevonc.2017.01.020
Garriga, J., G. Laumet, S.R. Chen, Y. Zhang, J. Madzo, J.J. Issa, H.L. Pan, and J. Jelinek, Nerve Injury-Induced Chronic Pain Is Associated with Persistent DNA Methylation Reprogramming in Dorsal Root Ganglion. J Neurosci, 2018. 38(27): 6090-6101.http://dx.doi.org/10.1523/JNEUROSCI.2616-17.2018
Pollema-Mays, S.L., M.V. Centeno, A.V. Apkarian, and M. Martina, Expression of DNA methyltransferases in adult dorsal root ganglia is cell-type specific and up regulated in a rodent model of neuropathic pain. Front Cell Neurosci, 2014. 8: 217.http://dx.doi.org/10.3389/fncel.2014.00217
Wang, Y., Z.P. Lin, H.Z. Zheng, S. Zhang, Z.L. Zhang, Y. Chen, Y.S. You, and M.H. Yang, Abnormal DNA methylation in the lumbar spinal cord following chronic constriction injury in rats. Neurosci Lett, 2016. 610: 1-5.http://dx.doi.org/10.1016/j.neulet.2015.10.048
Shao, C., Y. Gao, D. Jin, X. Xu, S. Tan, H. Yu, Q. Zhao, L. Zhao, W. Wang, and D. Wang, DNMT3a methylation in neuropathic pain. J Pain Res, 2017. 10: 2253-2262.http://dx.doi.org/10.2147/JPR.S130654
Gregoire, S., M. Millecamps, L. Naso, S. Do Carmo, A.C. Cuello, M. Szyf, and L.S. Stone, Therapeutic benefits of the methyl donor S-adenosylmethionine on nerve injury-induced mechanical hypersensitivity and cognitive impairment in mice. Pain, 2017. 158(5): 802-810.http://dx.doi.org/10.1097/j.pain.0000000000000811
Topham, L., S. Gregoire, H. Kang, M. Salmon-Divon, E. Lax, M. Millecamps, M. Szyf, and L.S. Stone, The transition from acute to chronic pain: dynamic epigenetic reprogramming of the mouse prefrontal cortex up to 1 year after nerve injury. Pain, 2020. 161(10): 2394-2409.http://dx.doi.org/10.1097/j.pain.0000000000001917
Wang, Y., C. Liu, Q.L. Guo, J.Q. Yan, X.Y. Zhu, C.S. Huang, and W.Y. Zou, Intrathecal 5-azacytidine inhibits global DNA methylation and methyl- CpG-binding protein 2 expression and alleviates neuropathic pain in rats following chronic constriction injury. Brain Res, 2011. 1418: 64-9.http://dx.doi.org/10.1016/j.brainres.2011.08.040
Miao, X.R., L.C. Fan, S. Wu, Q. Mao, Z. Li, B. Lutz, J.T. Xu, Z. Lu, and Y.X. Tao, DNMT3a contributes to the development and maintenance of bone cancer pain by silencing Kv1.2 expression in spinal cord dorsal horn. Mol Pain, 2017. 13: 1744806917740681.http://dx.doi.org/10.1177/1744806917740681
Xing, B., P. Liu, W.J. Xu, F.Y. Xu, and Y.H. Dang, Effect of microinjecting of 5-aza-2-deoxycytidine into ventrolateral orbital cortex on depressive-like behavior in rats. Neurosci Lett, 2014. 574: 11-4.http://dx.doi.org/10.1016/j.neulet.2014.04.050
Yu, C.C., C. He, Y.J. Du, S. Gao, Y.F. Lin, S.Q. Wang, L. Wang, J. Wang, X.S. Wang, T. Jiang, and L.H. Kong, Preventive electroacupuncture reduces cognitive deficits in a rat model of D-galactose-induced aging. Neural Regen Res, 2021. 16(5): 916-923.http://dx.doi.org/10.4103/1673-5374.297090
Appel, C.K., N.N. Scheff, C.T. Viet, B.L. Schmidt, and A.M. Heegaard, Decitabine attenuates nociceptive behavior in a murine model of bone cancer pain. Pain, 2019. 160(3): 619-631.http://dx.doi.org/10.1097/j.pain.0000000000001442
Zhu, X., F. Chen, K. Lu, A. Wei, Q. Jiang, and W. Cao, PPARgamma preservation via promoter demethylation alleviates osteoarthritis in mice. Ann Rheum Dis, 2019. 78(10): 1420-1429.http://dx.doi.org/10.1136/annrheumdis-2018-214940
Grace, P.M., K.A. Strand, E.L. Galer, D.J. Urban, X. Wang, M.V. Baratta, T.J. Fabisiak, N.D. Anderson, K. Cheng, L.I. Greene, D. Berkelhammer, Y. Zhang, A.L. Ellis, H.H. Yin, S. Campeau, K.C. Rice, B.L. Roth, S.F. Maier, and L.R. Watkins, Morphine paradoxically prolongs neuropathic pain in rats by amplifying spinal NLRP3 inflammasome activation. Proc Natl Acad Sci U S A, 2016. 113(24): E3441-50.http://dx.doi.org/10.1073/pnas.1602070113
Wang, D., T. Chen, Y. Gao, R. Quirion, and Y. Hong, Inhibition of SNL-induced upregulation of CGRP and NPY in the spinal cord and dorsal root ganglia by the 5-HT(2A) receptor antagonist ketanserin in rats. Pharmacol Biochem Behav, 2012. 101(3): 379-86.http://dx.doi.org/10.1016/j.pbb.2012.02.004
Moore, L.D., T. Le, and G. Fan, DNA methylation and its basic function. Neuropsychopharmacology, 2013. 38(1): 23-38.http://dx.doi.org/10.1038/npp.2012.112
Zhao, J.Y., L. Liang, X. Gu, Z. Li, S. Wu, L. Sun, F.E. Atianjoh, J. Feng, K. Mo, S. Jia, B.M. Lutz, A. Bekker, E.J. Nestler, and Y.X. Tao, DNA methyltransferase DNMT3a contributes to neuropathic pain by repressing Kcna2 in primary afferent neurons. Nat Commun, 2017. 8: 14712.http://dx.doi.org/10.1038/ncomms14712
Huang, C.Z., J.H. Xu, W. Zhong, Z.S. Xia, S.Y. Wang, D. Cheng, J.Y. Li, T.F. Wu, Q.K. Chen, and T. Yu, Sox9 transcriptionally regulates Wnt signaling in intestinal epithelial stem cells in hypomethylated crypts in the diabetic state. Stem Cell Res Ther, 2017. 8(1): 60.http://dx.doi.org/10.1186/s13287-017-0507-4
Boccella, S., I. Marabese, F. Guida, L. Luongo, S. Maione, and E. Palazzo, The Modulation of Pain by Metabotropic Glutamate Receptors 7 and 8 in the Dorsal Striatum. Curr Neuropharmacol, 2020. 18(1): 34-50.http://dx.doi.org/10.2174/1570159X17666190618121859
McKinnell, R.M., S.R. Armstrong, D.T. Beattie, S.K. Choi, P.R. Fatheree, R.A. Gendron, A. Goldblum, P.P. Humphrey, D.D. Long, D.G. Marquess, J.P. Shaw, J.A. Smith, S.D. Turner, and R.G. Vickery, A multivalent approach to the design and discovery of orally efficacious 5-HT4 receptor agonists. J Med Chem, 2009. 52(17): 5330-43.http://dx.doi.org/10.1021/jm900881j
Lemmens, S., L. Kusters, A. Bronckaers, N. Geurts, and S. Hendrix, The beta2-Adrenoceptor Agonist Terbutaline Stimulates Angiogenesis via Akt and ERK Signaling. J Cell Physiol, 2017. 232(2): 298-308.http://dx.doi.org/10.1002/jcp.25483
Smith, P.A., K+ Channels in Primary Afferents and Their Role in Nerve Injury-Induced Pain. Frontiers in Cellular Neuroscience, 2020. 14.http://dx.doi.org/10.3389/fncel.2020.566418
Trindade da Silva, C.A., J.T. Clemente-Napimoga, H.B. Abdalla, R.T. Basting, and M.H. Napimoga, Peroxisome proliferator-activated receptor-gamma (PPARgamma) and its immunomodulation function: current understanding and future therapeutic implications. Expert Rev Clin Pharmacol, 2022. 15(3): 295-303.http://dx.doi.org/10.1080/17512433.2022.2071697
Hu, Z., X. Ying, L. Huang, Y. Zhao, D. Zhou, J. Liu, J. Zhong, T. Huang, W. Zhang, F. Cheng, and S. Duan, Association of human serotonin receptor 4 promoter methylation with autism spectrum disorder. Medicine, 2020. 99(4).http://dx.doi.org/10.1097/md.0000000000018838
Zanni, G., S. Goto, A.F. Fragopoulou, G. Gaudenzi, V. Naidoo, E. Di Martino, G. Levy, C.A. Dominguez, O. Dethlefsen, A. Cedazo-Minguez, P. Merino-Serrais, A. Stamatakis, O. Hermanson, and K. Blomgren, Lithium treatment reverses irradiation-induced changes in rodent neural progenitors and rescues cognition. Mol Psychiatry, 2021. 26(1): 322-340.http://dx.doi.org/10.1038/s41380-019-0584-0
Labouesse, M.A., E. Dong, D.R. Grayson, A. Guidotti, and U. Meyer, Maternal immune activation induces GAD1 and GAD2 promoter remodeling in the offspring prefrontal cortex. Epigenetics, 2015. 10(12): 1143-55.http://dx.doi.org/10.1080/15592294.2015.1114202
Yang, X., T. Zhao, L. Feng, Y. Shi, J. Jiang, S. Liang, B. Sun, Q. Xu, J. Duan, and Z. Sun, PM2.5-induced ADRB2 hypermethylation contributed to cardiac dysfunction through cardiomyocytes apoptosis via PI3K/Akt pathway. Environ Int, 2019. 127: 601-614.http://dx.doi.org/10.1016/j.envint.2019.03.057
Liu, L., D. Xu, T. Wang, Y. Zhang, X. Yang, X. Wang, and Y. Tang, Epigenetic reduction of miR-214-3p upregulates astrocytic colony-stimulating factor-1 and contributes to neuropathic pain induced by nerve injury. Pain, 2020. 161(1): 96-108.http://dx.doi.org/10.1097/j.pain.0000000000001681
Taylor, B., Y. Sun, P. Sahbaie, D. Liang, W. Li, X. Shi, P. Kingery, and J.D. Clark, DNA Methylation Modulates Nociceptive Sensitization after Incision. Plos One, 2015. 10(11).http://dx.doi.org/10.1371/journal.pone.0142046
Topham, L., S. Gregoire, H. Kang, M. Salmon-Divon, E. Lax, M. Millecamps, M. Szyf, and L. Stone, The methyl donor S-adenosyl methionine reverses the DNA methylation signature of chronic neuropathic pain in mouse frontal cortex. Pain Rep, 2021. 6(2): e944.http://dx.doi.org/10.1097/PR9.0000000000000944
Sun, L., J.Y. Zhao, X. Gu, L. Liang, S. Wu, K. Mo, J. Feng, W. Guo, J. Zhang, A. Bekker, X. Zhao, E.J. Nestler, and Y.X. Tao, Nerve injury-induced epigenetic silencing of opioid receptors controlled by DNMT3a in primary afferent neurons. Pain, 2017. 158(6): 1153-1165.http://dx.doi.org/10.1097/j.pain.0000000000000894
Buckstein, R., K. Yee, R.A. Wells, and M.D.S. Canadian Consortium on Evidence-based Care in, 5-Azacytidine in myelodysplastic syndromes: a clinical practice guideline. Cancer Treat Rev, 2011. 37(2): 160-7.http://dx.doi.org/10.1016/j.ctrv.2010.05.006
Sun, L., X. Gu, Z. Pan, X. Guo, J. Liu, F.E. Atianjoh, S. Wu, K. Mo, B. Xu, L. Liang, A. Bekker, and Y.X. Tao, Contribution of DNMT1 to Neuropathic Pain Genesis Partially through Epigenetically Repressing Kcna2 in Primary Afferent Neurons. J Neurosci, 2019. 39(33): 6595-6607.http://dx.doi.org/10.1523/JNEUROSCI.0695-19.2019
Liu, R., X.M. Wu, X. He, R.Z. Wang, X.Y. Yin, F. Zhou, M.H. Ji, and J.C. Shen, Contribution of DNA methyltransferases to spared nerve injury induced depression partially through epigenetically repressing Bdnf in hippocampus: Reversal by ketamine. Pharmacol Biochem Behav, 2021. 200: 173079.http://dx.doi.org/10.1016/j.pbb.2020.173079
Franco-Enzastiga, U., G. Garcia, J. Murbartian, R. Gonzalez-Barrios, A.B. Salinas-Abarca, B. Sanchez-Hernandez, D. Tavares-Ferreira, L.A. Herrera, P. Barragan-Iglesias, R. Delgado-Lezama, T.J. Price, and V. Granados-Soto, Sex-dependent pronociceptive role of spinal alpha5 -GABAA receptor and its epigenetic regulation in neuropathic rodents. J Neurochem, 2021. 156(6): 897-916.http://dx.doi.org/10.1111/jnc.15140
Wu, Q., G. Wei, F. Ji, S. Jia, S. Wu, X. Guo, L. He, Z. Pan, X. Miao, Q. Mao, Y. Yang, M. Cao, and Y.X. Tao, TET1 Overexpression Mitigates Neuropathic Pain Through Rescuing the Expression of mu-Opioid Receptor and Kv1.2 in the Primary Sensory Neurons. Neurotherapeutics, 2019. 16(2): 491-504.http://dx.doi.org/10.1007/s13311-018-00689-x
Zhang, H.M., S.R. Chen, and H.L. Pan, Effects of activation of group III metabotropic glutamate receptors on spinal synaptic transmission in a rat model of neuropathic pain. Neuroscience, 2009. 158(2): 875-84.http://dx.doi.org/10.1016/j.neuroscience.2008.10.042
Vilar, B., J. Busserolles, B. Ling, S. Laffray, L. Ulmann, F. Malhaire, E. Chapuy, Y. Aissouni, M. Etienne, E. Bourinet, F. Acher, J.P. Pin, A. Eschalier, and C. Goudet, Alleviating pain hypersensitivity through activation of type 4 metabotropic glutamate receptor. J Neurosci, 2013. 33(48): 18951-65.http://dx.doi.org/10.1523/JNEUROSCI.1221-13.2013
Goudet, C., E. Chapuy, A. Alloui, F. Acher, J.P. Pin, and A. Eschalier, Group III metabotropic glutamate receptors inhibit hyperalgesia in animal models of inflammation and neuropathic pain. Pain, 2008. 137(1): 112-124.http://dx.doi.org/10.1016/j.pain.2007.08.020
Wang, H., W. Jiang, R. Yang, and Y. Li, Spinal metabotropic glutamate receptor 4 is involved in neuropathic pain. Neuroreport, 2011. 22(5): 244-8.http://dx.doi.org/10.1097/WNR.0b013e3283453843
Nicholson, R., A.K. Dixon, D. Spanswick, and K. Lee, Noradrenergic receptor mRNA expression in adult rat superficial dorsal horn and dorsal root ganglion neurons. Neurosci Lett, 2005. 380(3): 316-21.http://dx.doi.org/10.1016/j.neulet.2005.01.079
Bohren, Y., L.H. Tessier, S. Megat, H. Petitjean, S. Hugel, D. Daniel, M. Kremer, S. Fournel, L. Hein, R. Schlichter, M.J. Freund-Mercier, I. Yalcin, and M. Barrot, Antidepressants suppress neuropathic pain by a peripheral beta2-adrenoceptor mediated anti-TNFalpha mechanism. Neurobiol Dis, 2013. 60: 39-50.http://dx.doi.org/10.1016/j.nbd.2013.08.012
Zhang, F.F., N. Morioka, H. Abe, S. Fujii, K. Miyauchi, Y. Nakamura, K. Hisaoka-Nakashima, and Y. Nakata, Stimulation of spinal dorsal horn beta2-adrenergic receptor ameliorates neuropathic mechanical hypersensitivity through a reduction of phosphorylation of microglial p38 MAP kinase and astrocytic c-jun N-terminal kinase. Neurochem Int, 2016. 101: 144-155.http://dx.doi.org/10.1016/j.neuint.2016.11.004
Liu, Q.Q., X.X. Yao, S.H. Gao, R. Li, B.J. Li, W. Yang, and R.J. Cui, Role of 5-HT receptors in neuropathic pain: potential therapeutic implications. Pharmacol Res, 2020. 159: 104949.http://dx.doi.org/10.1016/j.phrs.2020.104949
Song, Z., B.A. Meyerson, and B. Linderoth, Spinal 5-HT receptors that contribute to the pain-relieving effects of spinal cord stimulation in a rat model of neuropathy. Pain, 2011. 152(7): 1666-1673.http://dx.doi.org/10.1016/j.pain.2011.03.012
Pineda-Farias, J.B., P. Barragan-Iglesias, A. Valdivieso-Sanchez, J. Rodriguez-Silverio, F.J. Flores-Murrieta, V. Granados-Soto, and H.I. Rocha-Gonzalez, Spinal 5-HT4 and 5-HT6 receptors contribute to the maintenance of neuropathic pain in rats. Pharmacol Rep, 2017. 69(5): 916-923.http://dx.doi.org/10.1016/j.pharep.2017.04.001
Bocksteins, E., Kv5, Kv6, Kv8, and Kv9 subunits: No simple silent bystanders. Journal of General Physiology, 2016. 147(2): 105-125.http://dx.doi.org/10.1085/jgp.201511507
Stas, J.I., E. Bocksteins, A.J. Labro, and D.J. Snyders, Modulation of Closed-State Inactivation in Kv2.1/Kv6.4 Heterotetramers as Mechanism for 4-AP Induced Potentiation. PLoS One, 2015. 10(10): e0141349.http://dx.doi.org/10.1371/journal.pone.0141349
Jiang, P., Q. Jiang, Y. Yan, Z. Hou, and D. Luo, Propofol ameliorates neuropathic pain and neuroinflammation through PPAR gamma up-regulation to block Wnt/beta-catenin pathway. Neurol Res, 2021. 43(1): 71-77.http://dx.doi.org/10.1080/01616412.2020.1823107
Farzad, B., H. Rajabi, R. Gharakhanlou, D.J. Allison, P. Hayat, and S.B. Jameie, Swimming Training Attenuates Allodynia and Hyperalgesia Induced by Peripheral Nerve Injury in an Adult Male Rat Neuropathic Model: Effects on Irisin and GAD65. Pain Med, 2018. 19(11): 2236-2245.http://dx.doi.org/10.1093/pm/pnx294

Download PDF

Journal Publication

published 11 Jan, 2023

Read the published version in Molecular Neurobiology →

Reviewers agreed at journal
28 Oct, 2022
Reviewers invited by journal
26 Oct, 2022
Editor invited by journal
23 Oct, 2022
Editor assigned by journal
05 Oct, 2022
First submitted to journal
05 Oct, 2022

You are reading this latest preprint version

Intraperitoneal injection of 5-azacytidine alleviates nerve injury-induced chronic neuropathic pain in rats: the involvement of DNA methylation in the lumbar spinal cord

Status:

Journal Publication

Version 1

Abstract

Aims

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials And Methods

2.1. Animals

2.2. Experimental paradigm

2.3. NPP model

2.3.1. Chronic constriction injury (CCI)

2.3.2. Spinal nerve ligation (SNL)

2.4. Behavioral testing

2.5. Methyl-DNA immunoprecipitation (MeDIP)-on-chip

2.6. Microarray data analysis

2.7. Real-time PCR on MeDIP-enriched DNA

2.8. Quantitative reverse transcription-PCR

2.9. Statistical analyses

3. Results

3.1. DNA methylation status in response to CCI in the lumbar spinal cord in rats

3.2. Differentially methylated functional domains and signaling pathways in CCI rats

3.3. Screening and verification of differentially methylated genes in CCI rats

3.4. Expression level of pain-related genes in the lumbar spinal cord after CCI

3.5. 5-AZA alleviated hyperalgesia and induced pain-related gene expression changes in the lumbar spinal cord after CCI

3.6. 5-AZA alleviated hyperalgesia and induced pain-related gene expression changes in the lumbar spinal cord after SNL

4. Discussion

5. Conclusions

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1